ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart43h09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL390243.22| Human DNA sequence from clone RP6-102O10 on chr... 50 0.004
2gb|AF078790.1| Caenorhabditis elegans cosmid F36H12, complete se... 44 0.26
3emb|AL590365.14| Human DNA sequence from clone RP11-455B2 on chr... 42 1.0
4gb|AC021549.9| Homo sapiens chromosome 18, clone RP11-650P15, co... 42 1.0
5ref|NM_196176.1| Oryza sativa (japonica cultivar-group) putative... 40 4.1
6gb|AC124807.11| Mus musculus chromosome 3, clone RP23-137I13, co... 40 4.1
7gb|AC111678.6| Rattus norvegicus 18 BAC CH230-60A14 (Children's ... 40 4.1
8gb|AC114474.2| Genomic sequence for Oryza sativa, Nipponbare str... 40 4.1
9gb|AC114147.5| Rattus norvegicus BAC CH230-144F3 (Children's Ho... 40 4.1
10gb|AC092748.2| Genomic sequence for Oryza sativa, Nipponbare str... 40 4.1
11dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.1
12gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 4.1
13emb|BX897734.11| Zebrafish DNA sequence from clone CH211-194J14,... 40 4.1

>emb|AL390243.22| Human DNA sequence from clone RP6-102O10 on chromosome 1p32.1-33
             Contains a novel gene, complete sequence
          Length = 84595

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 36    tacttaaaacacatataaatatcaaatacagat 68
             |||||| |||||||||||||| |||||||||||
Sbjct: 12539 tacttacaacacatataaataacaaatacagat 12507



to top

>gb|AF078790.1| Caenorhabditis elegans cosmid F36H12, complete sequence
          Length = 43907

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 27    cttactttttacttaaaacaca 48
             ||||||||||||||||||||||
Sbjct: 19427 cttactttttacttaaaacaca 19406



to top

>emb|AL590365.14| Human DNA sequence from clone RP11-455B2 on chromosome 10 Contains the
              gene for a novel thioesterase domain containing protein
              (FLJ11106), the gene for ribonuclease P (38kD) (RPP38), the
              gene for a novel protein (FLJ38219), the gene for a novel
              protein, the NMT2 gene for N-myristoyltransferase 2, the 3'
              end of the gene for a novel protein (LOC221061), a novel
              gene, a pseudogene similar to part of
              glyceraldehyde-3-phosphate dehydrogenase
              (GAPD)(G3PD,GAPDH), a peptidylprolyl isomerase A
              (cyclophilin A) (PPIA)(CYPA,CYPH) pseudogene, a NADH
              dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa
              (NDUFA4)(MLRQ) pseudogene and three CpG islands, complete
              sequence
          Length = 194802

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 48     atataaatatcaaatacagat 68
              |||||||||||||||||||||
Sbjct: 125066 atataaatatcaaatacagat 125046



to top

>gb|AC021549.9| Homo sapiens chromosome 18, clone RP11-650P15, complete sequence
          Length = 183066

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 51    taaatatcaaatacagatcat 71
             |||||||||||||||||||||
Sbjct: 87703 taaatatcaaatacagatcat 87683



to top

>ref|NM_196176.1| Oryza sativa (japonica cultivar-group) putative Tyrosine/DOPA
            decarboxylase 2 (OSJNBa0032N04.8), mRNA
          Length = 1581

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 264  agcccgatcctggaccaccttcca 287
            ||||||||||||||| ||||||||
Sbjct: 1545 agcccgatcctggacaaccttcca 1522



to top

>gb|AC124807.11| Mus musculus chromosome 3, clone RP23-137I13, complete sequence
          Length = 213113

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 36    tacttaaaacacatataaat 55
             ||||||||||||||||||||
Sbjct: 49506 tacttaaaacacatataaat 49487



to top

>gb|AC111678.6| Rattus norvegicus 18 BAC CH230-60A14 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 146568

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 31     ctttttacttaaaacacata 50
              ||||||||||||||||||||
Sbjct: 108359 ctttttacttaaaacacata 108378



to top

>gb|AC114474.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0032N04, from chromosome 10, complete sequence
          Length = 159445

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 264   agcccgatcctggaccaccttcca 287
             ||||||||||||||| ||||||||
Sbjct: 62170 agcccgatcctggacaaccttcca 62193



to top

>gb|AC114147.5| Rattus norvegicus  BAC CH230-144F3 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 214988

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 31    ctttttacttaaaacacata 50
             ||||||||||||||||||||
Sbjct: 66077 ctttttacttaaaacacata 66096



to top

>gb|AC092748.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0019N10, from chromosome 10, complete sequence
          Length = 192267

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 264    agcccgatcctggaccaccttcca 287
              ||||||||||||||| ||||||||
Sbjct: 170210 agcccgatcctggacaaccttcca 170187



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 264      agcccgatcctggaccaccttcca 287
                ||||||||||||||| ||||||||
Sbjct: 11744109 agcccgatcctggacaaccttcca 11744132



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 264      agcccgatcctggaccaccttcca 287
                ||||||||||||||| ||||||||
Sbjct: 11751449 agcccgatcctggacaaccttcca 11751472



to top

>emb|BX897734.11| Zebrafish DNA sequence from clone CH211-194J14, complete sequence
          Length = 151729

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 31     ctttttacttaaaacacatataaatatc 58
              ||||||| |||||||| |||||||||||
Sbjct: 131490 ctttttaattaaaacaaatataaatatc 131517


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,443,736
Number of Sequences: 3902068
Number of extensions: 3443736
Number of successful extensions: 71194
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 71131
Number of HSP's gapped (non-prelim): 63
length of query: 309
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 287
effective length of database: 17,147,199,772
effective search space: 4921246334564
effective search space used: 4921246334564
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top