ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart43h01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin ... 898 0.0
2gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds 234 2e-58
3gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protei... 234 2e-58
4gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrins... 194 2e-46
5ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predic... 186 4e-44
6gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein... 186 4e-44
7gb|AY109332.1| Zea mays CL502_5 mRNA sequence 186 4e-44
8gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein... 178 1e-41
9ref|XM_466869.1| Oryza sativa (japonica cultivar-group), mRNA 170 3e-39
10gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence 170 3e-39
11dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin,... 170 3e-39
12dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clon... 170 3e-39
13dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd 170 3e-39
14gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, comple... 135 1e-28
15ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA 121 2e-24
16ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group... 121 2e-24
17ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group... 121 2e-24
18dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 2e-24
19dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 2e-24
20dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 2e-24
21dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 2e-24
22dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 2e-24
23gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, comp... 121 2e-24
24gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, co... 117 3e-23
25gb|BT016583.1| Zea mays clone Contig416 mRNA sequence 113 5e-22
26gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds 113 5e-22
27gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein... 113 5e-22
28emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major ... 107 3e-20
29dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 105 1e-19
30gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein... 105 1e-19
31dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA ... 105 1e-19
32gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrins... 105 1e-19
33emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4,... 105 1e-19
34gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel... 105 1e-19
35gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA 105 1e-19
36ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G3... 103 5e-19
37emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for p... 103 5e-19
38emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides m... 103 5e-19
39emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Co... 103 5e-19
40emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Co... 103 5e-19
41emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Co... 103 5e-19
42emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Co... 103 5e-19
43emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Co... 103 5e-19
44emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Co... 103 5e-19
45emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Co... 103 5e-19
46gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete s... 103 5e-19
47gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic pr... 100 8e-18
48ref|NM_187084.1| Oryza sativa (japonica cultivar-group), mRNA 100 8e-18
49ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group... 100 8e-18
50ref|NM_187081.2| Oryza sativa (japonica cultivar-group), mRNA 100 8e-18
51emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for p... 100 8e-18
52dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 8e-18
53dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 8e-18
54gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds 98 3e-17
55gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putat... 98 3e-17
56dbj|AB206101.1| Mimosa pudica pip2;3 mRNA for plasma membrane in... 94 5e-16
57emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic... 92 2e-15
58emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein 92 2e-15
59gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water chann... 92 2e-15
60gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1)... 92 2e-15
61dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 90 8e-15
62dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic D... 90 8e-15
63gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasm... 90 8e-15
64emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrins... 88 3e-14
65gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrin... 88 3e-14
66dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 88 3e-14
67dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D... 88 3e-14
68dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 88 3e-14
69dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane ... 86 1e-13
70ref|XM_475029.1| Oryza sativa (japonica cultivar-group), predic... 84 5e-13
71dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 5e-13
72dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 5e-13
73dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 5e-13
74dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 5e-13
75gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, ... 82 2e-12
76ref|NM_115202.1| Arabidopsis thaliana PIP2A; water channel AT3G5... 80 7e-12
77ref|NM_001035774.1| Arabidopsis thaliana PIP2A AT3G53420 (PIP2A)... 80 7e-12
78ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37... 80 7e-12
79gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (... 80 7e-12
80emb|X75883.1|ATPIP2A A.thaliana mRNA for plasma membrane intrins... 80 7e-12
81gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma m... 80 7e-12
82gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putat... 80 7e-12
83gb|AY072374.1| Arabidopsis thaliana plasma membrane intrinsic pr... 80 7e-12
84gb|AF428426.1|AF428426 Arabidopsis thaliana AT3g53420/F4P12_120 ... 80 7e-12
85gb|AY056085.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, co... 80 7e-12
86dbj|AK220982.1| Arabidopsis thaliana mRNA for plasma membrane in... 80 7e-12
87gb|AY044327.1| Arabidopsis thaliana plasma membrane intrinsic pr... 80 7e-12
88gb|AY039579.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, co... 80 7e-12
89emb|BX824659.1|CNS0A6W2 Arabidopsis thaliana Full-length cDNA Co... 80 7e-12
90emb|BX824010.1|CNS0A6YX Arabidopsis thaliana Full-length cDNA Co... 80 7e-12
91emb|BX823952.1|CNS0A4TL Arabidopsis thaliana Full-length cDNA Co... 80 7e-12
92emb|BX842136.1|CNS09YDO Arabidopsis thaliana Full-length cDNA Co... 80 7e-12
93gb|AY087854.1| Arabidopsis thaliana clone 38965 mRNA, complete s... 80 7e-12
94gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete s... 80 7e-12
95dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative tran... 80 7e-12
96ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channe... 78 3e-11
97gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete s... 78 3e-11
98ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channe... 76 1e-10
99dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds 76 1e-10
100gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 76 1e-10
101gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 76 1e-10
102gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 76 1e-10
103emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Co... 76 1e-10
104emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Co... 76 1e-10
105emb|AJ605565.1| Ricinus communis partial mRNA for putative aquap... 76 1e-10
106gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (... 74 5e-10
107gb|BT013307.1| Lycopersicon esculentum clone 134975R, mRNA sequence 74 5e-10
108gb|DQ450066.1| Arachis hypogaea clone 10A4R1GZ putative aquapori... 74 5e-10
109gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel... 74 5e-10
110gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com... 74 5e-10
111gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrins... 74 5e-10
112ref|NM_119676.2| Arabidopsis thaliana PIP3 (PLASMA MEMBRANE INTR... 72 2e-09
113emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for p... 72 2e-09
114gb|AY081580.1| Arabidopsis thaliana plasma membrane intrinsic pr... 72 2e-09
115gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putat... 72 2e-09
116gb|AY062803.1| Arabidopsis thaliana plasma membrane intrinsic pr... 72 2e-09
117gb|AF412110.1|AF412110 Arabidopsis thaliana AT4g35100/M4E13_150 ... 72 2e-09
118gb|AF003728.1|AF003728 Arabidopsis thaliana plasma membrane intr... 72 2e-09
119emb|BX826680.1|CNS0A37C Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
120emb|BX826294.1|CNS0A39S Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
121emb|BX827919.1|CNS0A2ZT Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
122emb|BX827124.1|CNS0A2UI Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
123gb|AY088485.1| Arabidopsis thaliana clone 7108 mRNA, complete se... 72 2e-09
124dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
125dbj|D85193.1| Arabidopsis thaliana mRNA, partial cds 72 2e-09
126dbj|AB005246.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 72 2e-09
127gb|U78297.1|ATU78297 Arabidopsis thaliana plasma membrane intrin... 72 2e-09
128ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channe... 70 7e-09
129ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic... 70 7e-09
130gb|AC006260.4| Arabidopsis thaliana chromosome 2 clone T2N18 map... 70 7e-09
131gb|AY081593.1| Arabidopsis thaliana water channel-like protein (... 70 7e-09
132gb|AY059948.1| Arabidopsis thaliana water channel - like protein... 70 7e-09
133dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - li... 70 7e-09
134emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
135emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
136emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
137emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
138gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds 70 7e-09
139gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete se... 70 7e-09
140dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 7e-09
141dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 7e-09
142dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 7e-09
143dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 7e-09
144gb|U27347.1|GMU27347 Glycine max putative water channel protein ... 70 7e-09
145dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membran... 70 7e-09
146emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for p... 68 3e-08
147gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic prot... 68 3e-08
148dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds 68 3e-08
149gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds 68 3e-08
150dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane ... 68 3e-08
151gb|DQ226873.1| Boechera divaricarpa isolate SLW-C-G04 mRNA sequence 66 1e-07
152emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, ... 66 1e-07
153emb|AL035522.1|ATT12J5 Arabidopsis thaliana DNA chromosome 4, BA... 66 1e-07
154emb|AL022023.1|ATM4E13 Arabidopsis thaliana DNA chromosome 4, BA... 66 1e-07
155dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membra... 66 1e-07
156gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, c... 66 1e-07
157gb|AF118383.1|AF118383 Brassica napus plasma membrane intrinsic ... 66 1e-07
158dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membran... 66 1e-07
159gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic pr... 64 4e-07
160ref|XM_519026.1| PREDICTED: Pan troglodytes aquaporin 1 (LOC4633... 64 4e-07
161ref|NM_198098.1| Homo sapiens aquaporin 1 (Colton blood group) (... 64 4e-07
162gb|AY312581.1| Homo sapiens aquaporin 1 splice variant 3 (AQP1) ... 64 4e-07
163gb|AY312580.1| Homo sapiens aquaporin 1 splice variant 2 (AQP1) ... 64 4e-07
164gb|BC022486.1| Homo sapiens aquaporin 1 (Colton blood group), mR... 64 4e-07
165emb|CR859936.1| Pongo pygmaeus mRNA; cDNA DKFZp469G0320 (from cl... 64 4e-07
166emb|CR617260.1| full-length cDNA clone CS0DI057YC23 of Placenta ... 64 4e-07
167gb|AF480415.1| Homo sapiens aquaporin 1 (AQP1) gene, partial cds 64 4e-07
168gb|U41518.1|HSU41518 Human channel-like integral membrane protei... 64 4e-07
169gb|S73482.1| uterine water channel=28 kda erythrocyte integral m... 64 4e-07
170gb|AY034596.1| Macaca radiata aquaporin 1 mRNA, partial cds 64 4e-07
171gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein... 64 4e-07
172gb|AY170841.1| Axonopus compressus plasma membrane MIP protein m... 64 4e-07
173gb|U41517.1|HSU41517 Human channel-like integral membrane protei... 64 4e-07
174gb|M77829.1|HUMCHIP28A Human channel-like integral membrane prot... 64 4e-07
175gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, ... 62 2e-06
176gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map ... 62 2e-06
177dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane in... 62 2e-06
178gb|AF118382.1|AF118382 Brassica napus plasma membrane intrinsic ... 62 2e-06
179emb|AL132966.1|ATF4P12 Arabidopsis thaliana DNA chromosome 3, BA... 62 2e-06
180dbj|AB012045.1| Raphanus sativus mRNA for Plasma membrane aquapo... 62 2e-06
181gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence 60 7e-06
182gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-... 60 7e-06
183emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein 60 7e-06
184emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,... 60 7e-06
185dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane in... 60 7e-06
186emb|AJ605568.1| Ricinus communis partial mRNA for putative aquap... 60 7e-06
187dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membra... 60 7e-06
188dbj|AB002149.1| Nicotiana excelsior mRNA for water channel prote... 60 7e-06
189gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (... 58 3e-05
190ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative... 58 3e-05
191gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mR... 58 3e-05
192gb|AY189973.1| Juglans regia plasma intrinsic protein 2,1 mRNA, ... 58 3e-05
193emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp... 58 3e-05
194gb|AF367457.1| Prunus persica clone Mip1 membrane intrinsic prot... 58 3e-05
195gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 geno... 58 3e-05
196gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds 58 3e-05
197gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, c... 58 3e-05
198dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
199dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
200dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
201emb|AJ605575.1| Ricinus communis mRNA for aquaporin (Pip2-1 gene... 58 3e-05
202dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
203dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
204dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
205dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
206dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
207dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
208gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 58 3e-05
209dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membran... 58 3e-05
210gb|AY856055.1| Notomys alexis aquaporin 1 mRNA, partial cds 56 1e-04
211gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic pr... 56 1e-04
212ref|NM_001009194.1| Ovis aries aquaporin 1 (AQP1), mRNA 54 4e-04
213gb|BT025412.1| Bos taurus aquaporin 1 (Colton blood group) (AQP1... 54 4e-04
214gb|BT014251.1| Lycopersicon esculentum clone 133453R, mRNA sequence 54 4e-04
215gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence 54 4e-04
216gb|AY496102.1| Capsicum annuum Vip2 protein mRNA, complete cds 54 4e-04
217emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic... 54 4e-04
218emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening memb... 54 4e-04
219emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening memb... 54 4e-04
220emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for p... 54 4e-04
221emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet... 54 4e-04
222ref|NM_174702.3| Bos taurus aquaporin 1 (Aqp1), mRNA 54 4e-04
223gb|AF452014.1|AF452014 Petunia x hybrida aquaporin-like protein ... 54 4e-04
224gb|AF009037.1|AF009037 Ovis aries aquaporin 1 (aqp1) mRNA, compl... 54 4e-04
225gb|BC105525.1| Bos taurus aquaporin 1, mRNA (cDNA clone MGC:1290... 54 4e-04
226gb|S74759.1|S74759S1 water channel protein CHIP29 [cattle, ocula... 54 4e-04
227gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds 54 4e-04
228dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 4e-04
229dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 4e-04
230dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 4e-04
231gb|AF028005.1|AF028005 Bos taurus water channel protein CHIP29 m... 54 4e-04
232gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ... 54 4e-04
233gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel prot... 54 4e-04
234dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ... 54 4e-04
235gb|AF452012.1|AF452012 Petunia x hybrida aquaporin-like protein ... 52 0.002
236gb|AY059380.1| Medicago truncatula aquaporin (PIP2-1) mRNA, comp... 52 0.002
237gb|AC148995.2| Medicago truncatula chromosome 7 BAC clone mth2-4... 52 0.002
238gb|AF154641.1| Nicotiana tabacum clone PR16 mRNA sequence 52 0.002
239gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma... 52 0.002
240gb|U97023.1|PVU97023 Phaseolus vulgaris putative aquaporin-1 (Mi... 52 0.002
241gb|U18403.1|ACU18403 Atriplex canescens aquaporin mRNA, complete... 52 0.002
242ref|NM_116008.2| Arabidopsis thaliana PIP1A; water channel AT3G6... 50 0.007
243ref|NM_001003130.1| Canis familiaris aquaporin 1 (Colton blood g... 50 0.007
244gb|AC146187.2| Pan troglodytes BAC clone RP43-25A10 from 7, comp... 50 0.007
245ref|XM_850474.1| PREDICTED: Canis familiaris aquaporin 1 (AQP1),... 50 0.007
246gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic pro... 50 0.007
247emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4,... 50 0.007
248emb|AJ289701.1|VFA289701 Vicia faba mRNA for aquaporin (aq1 gene) 50 0.007
249gb|AY097398.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, com... 50 0.007
250gb|AY058113.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, com... 50 0.007
251gb|AF218774.1|AF218774 Lycopersicon esculentum putative water ch... 50 0.007
252gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein... 50 0.007
253gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein... 50 0.007
254emb|BX824874.1|CNS0A5T5 Arabidopsis thaliana Full-length cDNA Co... 50 0.007
255emb|BX824209.1|CNS0A5OV Arabidopsis thaliana Full-length cDNA Co... 50 0.007
256emb|BX823595.1|CNS0A5AA Arabidopsis thaliana Full-length cDNA Co... 50 0.007
257gb|AC092408.3| Papio anubis clone RP41-446H8, complete sequence 50 0.007
258gb|AC091620.3| Papio anubis clone RP41-400H11, complete sequence 50 0.007
259gb|AY088439.1| Arabidopsis thaliana clone 6690 mRNA, complete se... 50 0.007
260gb|AF180528.1|AF180528 Canis familiaris water channel aquaporin-... 50 0.007
261gb|AF266760.1|AF266760 Vicia faba plasma membrane aquaporin mRNA... 50 0.007
262emb|AJ605574.1| Ricinus communis mRNA for aquaporin (Pip1-1 gene... 50 0.007
263gb|AC005155.1|AC005155 Homo sapiens PAC clone RP5-877J2 from 7p1... 50 0.007
264gb|AY953319.1| Homo sapiens aquaporin 1 (channel-forming integra... 50 0.007
265gb|AY103580.1| Zea mays PCO072544 mRNA sequence 50 0.007
266gb|L77969.2|SPIAQUA Spinacia oleracea aquaporin mRNA, complete cds 50 0.007
267dbj|AB011374.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, p... 50 0.007
268dbj|AB011373.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, c... 50 0.007
269gb|AY489268.1| Physcomitrella patens aquaporin PIP 2 mRNA, compl... 48 0.026
270ref|NM_007472.1| Mus musculus aquaporin 1 (Aqp1), mRNA 48 0.026
271gb|DQ018113.1| Physcomitrella patens plasma membrane aquaporin (... 48 0.026
272gb|BC007125.1| Mus musculus aquaporin 1, mRNA (cDNA clone MGC:56... 48 0.026
273gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds 48 0.026
274emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrins... 48 0.026
275emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, ... 48 0.026
276emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, B... 48 0.026
277emb|AJ849324.1| Populus tremula x Populus tremuloides mRNA for p... 48 0.026
278dbj|AK128905.1| Mus musculus cDNA fis, clone TRACH2020336, highl... 48 0.026
279dbj|AK158226.1| Mus musculus adult inner ear cDNA, RIKEN full-le... 48 0.026
280gb|AF452011.1|AF452011 Petunia x hybrida aquaporin-like protein ... 48 0.026
281dbj|AK172361.1| Mus musculus activated spleen cDNA, RIKEN full-l... 48 0.026
282dbj|AK158389.1| Mus musculus adult inner ear cDNA, RIKEN full-le... 48 0.026
283dbj|AK157333.1| Mus musculus activated spleen cDNA, RIKEN full-l... 48 0.026
284dbj|AK166280.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cD... 48 0.026
285dbj|AK171627.1| Mus musculus activated spleen cDNA, RIKEN full-l... 48 0.026
286dbj|AK081886.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 48 0.026
287dbj|AK086688.1| Mus musculus 15 days embryo head cDNA, RIKEN ful... 48 0.026
288gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein... 48 0.026
289emb|AJ605569.1| Ricinus communis partial mRNA for putative aquap... 48 0.026
290gb|U60147.1|BVU60147 Beta vulgaris plasma membrane major intrins... 48 0.026
291gb|L02914.1|MUSGROEARB Mus musculus aquaporin-1 (AQ1) mRNA, comp... 48 0.026
292ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G0... 46 0.10
293ref|NM_127238.2| Arabidopsis thaliana PIP2;8/PIP3B; water channe... 46 0.10
294gb|AY585335.1| Sus scrofa aquaporin-1 (AQP1) mRNA, complete cds 46 0.10
295emb|AJ001416.1|NTAQUAPOR Nicotiana tabacum mRNA for aquaporin 1 46 0.10
296emb|X67948.1|RNCHIP28 R.norvegicus mRNA for channel integral mem... 46 0.10
297emb|Z83830.1|PAMIP1 P.abies mRNA for porin Mip1 46 0.10
298emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel... 46 0.10
299emb|X75881.1|ATPIP1A A.thaliana mRNA for plasma membrane intrins... 46 0.10
300emb|X70257.1|RNCHIP28K R.norvegicus mRNA for channel integral pr... 46 0.10
301emb|X71069.1|RNCHIPA R.norvegicus CHIP 28 mRNA 46 0.10
302emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B 46 0.10
303emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for p... 46 0.10
304emb|AJ515031.1|CAR515031 Cicer arietinum partial mRNA for aquopo... 46 0.10
305gb|AF367458.1| Prunus persica clone Mip2 membrane intrinsic prot... 46 0.10
306ref|NM_012778.1| Rattus norvegicus aquaporin 1 (Aqp1), mRNA 46 0.10
307gb|AF290620.1|AF290620 Nicotiana glauca putative PIP2 (MIP4) mRN... 46 0.10
308gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic pr... 46 0.10
309gb|AF386739.1|AF386739 Medicago truncatula aquaporin protein PIP... 46 0.10
310gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative pl... 46 0.10
311gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, ... 46 0.10
312gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, ... 46 0.10
313emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Co... 46 0.10
314gb|BT005214.1| Arabidopsis thaliana At2g16850 mRNA, complete cds 46 0.10
315ref|NM_214454.1| Sus scrofa aquaporin 1 (AQP1), mRNA 46 0.10
316gb|AY089124.1| Arabidopsis thaliana clone 36296 mRNA, complete s... 46 0.10
317gb|AF440271.1| Nicotiana tabacum aquaporin (NtPIP1;1) mRNA, comp... 46 0.10
318emb|AJ699398.2| Chenopodium rubrum mRNA for aquaporin PIP1 (PIP1... 46 0.10
319gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic pr... 46 0.10
320gb|BC090068.1| Rattus norvegicus aquaporin 1, mRNA (cDNA clone M... 46 0.10
321gb|AF024511.1|AF024511 Nicotiana tabacum aquaporin 1 mRNA, compl... 46 0.10
322gb|U60148.1|BVU60148 Beta vulgaris plasma membrane major intrins... 46 0.10
323gb|L07268.1|RATCHIP28A Rattus norvegicus water channel (CHIP28) ... 46 0.10
324dbj|AB002148.1| Nicotiana excelsior mRNA for water channel prote... 46 0.10
325ref|NM_202760.1| Arabidopsis thaliana TMP-C AT4G00430 (TMP-C) tr... 44 0.41
326ref|NM_116268.2| Arabidopsis thaliana TMP-C; water channel AT4G0... 44 0.41
327gb|AY781788.1| Glycyrrhiza uralensis plasma membrane intrinsic p... 44 0.41
328gb|AC153004.18| Medicago truncatula clone mth2-101j9, complete s... 44 0.41
329gb|AC138580.19| Medicago truncatula clone mth2-14e15, complete s... 44 0.41
330gb|BT000330.1| Arabidopsis thaliana probable plasma membrane int... 44 0.41
331emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative pl... 44 0.41
332emb|AJ289695.1|POC289695 Posidonia oceanica partial aq2 gene for... 44 0.41
333gb|AY120785.1| Arabidopsis thaliana probable plasma membrane int... 44 0.41
334gb|AY099825.1| Arabidopsis thaliana probable plasma membrane int... 44 0.41
335ref|NM_176253.1| Drosophila melanogaster CG17664-RB, transcript ... 44 0.41
336ref|NM_137967.2| Drosophila melanogaster CG17664-RA, transcript ... 44 0.41
337gb|AF452013.1|AF452013 Petunia x hybrida aquaporin-like protein ... 44 0.41
338gb|AF452010.1|AF452010 Petunia x hybrida channel-like protein (P... 44 0.41
339gb|BT006313.1| Arabidopsis thaliana At4g00430 mRNA, complete cds 44 0.41
340gb|AC005639.2|AC005639 Drosophila melanogaster, chromosome 2R, r... 44 0.41
341emb|BX827573.1|CNS0A3MW Arabidopsis thaliana Full-length cDNA Co... 44 0.41
342emb|BX829233.1|CNS0A3FQ Arabidopsis thaliana Full-length cDNA Co... 44 0.41
343dbj|AB206098.1| Mimosa pudica pip1;1 mRNA for plasma membrane in... 44 0.41
344gb|AY069151.1| Drosophila melanogaster GH16993 full insert cDNA 44 0.41
345dbj|D85192.1| Arabidopsis thaliana mRNA for transmembrane protei... 44 0.41
346gb|AY107589.1| Zea mays PCO085320 mRNA sequence 44 0.41
347gb|AE003461.3| Drosophila melanogaster chromosome 2R, section 69... 44 0.41
348dbj|D26609.1|ATHTMP Arabidopsis thaliana mRNA for transmembrane ... 44 0.41
349gb|U26537.1|MCU26537 Mesembryanthemum crystallinum major intrins... 44 0.41
350dbj|AP004484.1| Lotus japonicus genomic DNA, chromosome 1, clone... 44 0.41
351dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane ... 44 0.41
352dbj|AB002147.1| Nicotiana excelsior mRNA for water channel prote... 44 0.41
353gb|AC116395.21| Mus musculus chromosome 14, clone RP23-106K9, co... 42 1.6
354gb|AY961922.1| Picea abies probable aquaporin (Aqp) mRNA, partia... 42 1.6
355emb|AJ000031.1|CPPMIP1 Carica papaya mRNA for membrane channel p... 42 1.6
356emb|AL139041.17| Human DNA sequence from clone RP11-408O19 on ch... 42 1.6
357emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel... 42 1.6
358emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for p... 42 1.6
359emb|BX004993.16| Zebrafish DNA sequence from clone CH211-163C2 i... 42 1.6
360dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 42 1.6
361gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putat... 42 1.6
362emb|BX323881.7| Zebrafish DNA sequence from clone CH211-274G13 i... 42 1.6
363gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome 42 1.6
364gb|DQ294252.1| Solanum tuberosum clone 068H03 plasma membrane in... 42 1.6
365gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN... 42 1.6
366gb|L36095.1|CIPMIPA Mesembryanthemum crystallinum mipA mRNA, com... 42 1.6
367gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mip... 42 1.6
368dbj|AB024534.1| Rattus norvegicus gene for thiazide-sensitive Na... 42 1.6
369emb|CT025527.7| Mouse DNA sequence from clone RP23-279J20 on chr... 40 6.4
370emb|Z82265.1|CEF02H6 Caenorhabditis elegans Cosmid F02H6, comple... 40 6.4
371gb|DQ451602.1| Salicornia bigelovii plasma membrane major intrin... 40 6.4
372emb|AL162386.17| Human DNA sequence from clone RP11-272P10 on ch... 40 6.4
373emb|Z93764.1|PAZ93764 P.abies mRNA for membrane intrinsic protein 40 6.4
374emb|AJ222973.1|LAAJ2973 Lupinus albus mRNA for aquaporin, partial 40 6.4
375tpg|BK003523.1| TPA: TPA_inf: Drosophila melanogaster HDC02994 (... 40 6.4
376gb|AC092643.2| Homo sapiens BAC clone RP11-393P9 from 4, complet... 40 6.4
377gb|AC160646.2| Gallus gallus BAC clone CH261-24P2 from chromosom... 40 6.4
378gb|AC009202.7| Drosophila melanogaster, chromosome 2L, region 36... 40 6.4
379dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 6.4
380dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.4
381dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.4
382gb|AC115004.14| Mus musculus chromosome 3, clone RP24-182K13, co... 40 6.4
383gb|AC011662.1|AC011662 Drosophila melanogaster, chromosome 2L, r... 40 6.4
384gb|AE003656.2| Drosophila melanogaster chromosome 2L, section 65... 40 6.4
385emb|AL732627.14| Mouse DNA sequence from clone RP23-183L6 on chr... 40 6.4
386gb|U60149.1|BVU60149 Beta vulgaris plasma membrane major intrins... 40 6.4
387gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein ... 40 6.4
388gb|AC164108.2| Mus musculus BAC clone RP24-96K15 from chromosome... 40 6.4

>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete cds
          Length = 1343

 Score =  898 bits (453), Expect = 0.0
 Identities = 469/473 (99%), Gaps = 1/473 (0%)
 Strand = Plus / Minus

                                                                        
Query: 5    aaccgaaccgtacgtacacattgcatttcaaatttcccccc-aagttacctggatgcgta 63
            ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 1225 aaccgaaccgtacgtacacattgcatttcaaatttcccccccaagttacctggatgcgta 1166

                                                                        
Query: 64   catgacatgacagtacatcatcctcatcattcataaacattacatggaagcaaacactga 123
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1165 catgacatgacagtacatcatcctcatcattcataaacattacatggaagcaaacactga 1106

                                                                        
Query: 124  ctgacgaagacacactcgatcggtagagaaaacaagcagcaagcgcgggcggcgagccga 183
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 1105 ctgacgaagacacactcgatcggtagagaaaacaagcagcaagcgcgggcggcgagcaga 1046

                                                                        
Query: 184  ggaaagcagaggcgcgcgcaaagaccagcagaatccagggaccccaacggaggcccctct 243
            ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 1045 ggaaagcagagacgcgcgcaaagaccagcagaatccagggacccgaacggaggcccctct 986

                                                                        
Query: 244  gtcctctgccatatctacagttcatacgcctccgaccatctagcggctgccgaaggaggc 303
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 985  gtcctctgccatatctacagttcatacgcctccgaccatctagcggctgccgaaggaggc 926

                                                                        
Query: 304  agacgagccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgat 363
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 925  agacgagccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgat 866

                                                                        
Query: 364  ggcggccccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgtt 423
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 865  ggcggccccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgtt 806

                                                                 
Query: 424  gttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 805  gttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 753



to top

>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds
          Length = 1104

 Score =  234 bits (118), Expect = 2e-58
 Identities = 166/182 (91%)
 Strand = Plus / Minus

                                                                       
Query: 295 gaaggaggcagacgagccgaacttggtggcgctggccctcagcacgtactggtggtacaa 354
           ||||||||||||||| || | ||||| |||||||||||||||||||||||||||||||  
Sbjct: 852 gaaggaggcagacgatcccagcttggcggcgctggccctcagcacgtactggtggtacgc 793

                                                                       
Query: 355 ggcggcgatggcggccccgatgaatggccccacccagaacatccagtggtcatcccaggc 414
            |||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 792 cgcggcgatggcggcgccgatgaatggacccacccagaagatccagtggtcatcccaggc 733

                                                                       
Query: 415 cttctcgttgttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgcc 474
           ||| |||||||||||||| || ||||| || |||||||| ||||||||||||||||||||
Sbjct: 732 cttgtcgttgttgtagatgacagcagcgcccaagctcctggccgggttgatgccggtgcc 673

             
Query: 475 gg 476
           ||
Sbjct: 672 gg 671



to top

>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete
           cds
          Length = 1207

 Score =  234 bits (118), Expect = 2e-58
 Identities = 166/182 (91%)
 Strand = Plus / Minus

                                                                       
Query: 295 gaaggaggcagacgagccgaacttggtggcgctggccctcagcacgtactggtggtacaa 354
           ||||||||||||||| || | ||||| |||||||||||||||||||||||||||||||  
Sbjct: 907 gaaggaggcagacgatcccagcttggcggcgctggccctcagcacgtactggtggtacgc 848

                                                                       
Query: 355 ggcggcgatggcggccccgatgaatggccccacccagaacatccagtggtcatcccaggc 414
            |||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 847 cgcggcgatggcggcgccgatgaatggacccacccagaagatccagtggtcatcccaggc 788

                                                                       
Query: 415 cttctcgttgttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgcc 474
           ||| |||||||||||||| || ||||| || |||||||| ||||||||||||||||||||
Sbjct: 787 cttgtcgttgttgtagatgacagcagcgcccaagctcctggccgggttgatgccggtgcc 728

             
Query: 475 gg 476
           ||
Sbjct: 727 gg 726



to top

>gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           complete cds
          Length = 1235

 Score =  194 bits (98), Expect = 2e-46
 Identities = 149/166 (89%)
 Strand = Plus / Minus

                                                                       
Query: 311 ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 370
           |||| ||||| ||||||||||||||||||||||||||||||   ||||||||||||||| 
Sbjct: 886 ccgagcttggcggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcg 827

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           ||||| |  |||||||||||||| ||||| ||||||||||||||||| || |||||||||
Sbjct: 826 ccgatcagcggccccacccagaagatccattggtcatcccaggccttgtctttgttgtag 767

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           || || |||||||| ||||| |||||||||||||||||||||||||
Sbjct: 766 atgacagcagctcccaagcttctcgccgggttgatgccggtgccgg 721



to top

>ref|XM_473219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 873

 Score =  186 bits (94), Expect = 4e-44
 Identities = 160/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 295 gaaggaggcagacgagccgaacttggtggcgctggccctcagcacgtactggtggtacaa 354
           ||||||||  || ||||||| ||||| ||||||||||||||| ||||||||||||||   
Sbjct: 864 gaaggaggaggaagagccgagcttggcggcgctggccctcaggacgtactggtggtaggc 805

                                                                       
Query: 355 ggcggcgatggcggccccgatgaatggccccacccagaacatccagtggtcatcccaggc 414
           ||||||||||||||| |||||||  |||||||||||||| ||||||||||||| ||| ||
Sbjct: 804 ggcggcgatggcggcgccgatgaggggccccacccagaagatccagtggtcatgccatgc 745

                                                                       
Query: 415 cttctcgttgttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgcc 474
           ||| |  | |||||||||||| |||||||| |||||||| ||||||||||||||||||||
Sbjct: 744 cttgtgctggttgtagatcaccgcagctcccaagctccttgccgggttgatgccggtgcc 685

             
Query: 475 gg 476
           ||
Sbjct: 684 gg 683



to top

>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete
           cds
          Length = 1156

 Score =  186 bits (94), Expect = 4e-44
 Identities = 148/166 (89%)
 Strand = Plus / Minus

                                                                       
Query: 311 ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 370
           |||| ||||||||||||||| ||||||||||||||||||||   ||||||||||||||| 
Sbjct: 922 ccgagcttggtggcgctggctctcagcacgtactggtggtaggcggcggcgatggcggcg 863

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           ||||| | ||| ||||||||||| ||||| ||||| ||||||||||| || |||||||||
Sbjct: 862 ccgatcagtgggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtag 803

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           || || || ||||| |||||||||||||||||||||||||||||||
Sbjct: 802 atgaccgcggctcccaagctcctcgccgggttgatgccggtgccgg 757



to top

>gb|AY109332.1| Zea mays CL502_5 mRNA sequence
          Length = 1969

 Score =  186 bits (94), Expect = 4e-44
 Identities = 148/166 (89%)
 Strand = Plus / Minus

                                                                       
Query: 311 ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 370
           |||| ||||||||||||||| ||||||||||||||||||||   ||||||||||||||| 
Sbjct: 350 ccgagcttggtggcgctggctctcagcacgtactggtggtaggcggcggcgatggcggcg 291

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           ||||| | ||| ||||||||||| ||||| ||||| ||||||||||| || |||||||||
Sbjct: 290 ccgatcagtgggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtag 231

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           || || || ||||| |||||||||||||||||||||||||||||||
Sbjct: 230 atgaccgcggctcccaagctcctcgccgggttgatgccggtgccgg 185



 Score =  105 bits (53), Expect = 1e-19
 Identities = 116/137 (84%)
 Strand = Plus / Minus

                                                                        
Query: 340  gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
            |||||||||||| ||||| |||||||| || || | ||  || ||||||||||| |||||
Sbjct: 1594 gtactggtggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatcca 1535

                                                                        
Query: 400  gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgg 459
            |||||||||||| | ||| || ||||||||||  ||||| || || | |||||| |||||
Sbjct: 1534 gtggtcatcccatggcttgtccttgttgtagacgacggcggcgcccaggctcctggccgg 1475

                             
Query: 460  gttgatgccggtgccgg 476
            |||||||||||||||||
Sbjct: 1474 gttgatgccggtgccgg 1458



to top

>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete
           cds
          Length = 1171

 Score =  178 bits (90), Expect = 1e-41
 Identities = 147/166 (88%)
 Strand = Plus / Minus

                                                                       
Query: 311 ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 370
           |||| ||||||||||||||||||||||||||||||||||||   ||||||||||||||| 
Sbjct: 932 ccgagcttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcg 873

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           || || | ||| ||||||||||| ||||| ||||| ||||||||||| || |||||||||
Sbjct: 872 ccaatcagtgggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtag 813

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           || || || ||||| | |||||||||||||||||||||||||||||
Sbjct: 812 atgaccgcggctcccaggctcctcgccgggttgatgccggtgccgg 767



to top

>ref|XM_466869.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1214

 Score =  170 bits (86), Expect = 3e-39
 Identities = 146/166 (87%)
 Strand = Plus / Minus

                                                                       
Query: 311 ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 370
           |||| ||||| ||||||||||||||||||||||||||||||   ||||||||||||||| 
Sbjct: 912 ccgagcttggcggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcg 853

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           ||||| |  || ||||||||||| ||||| ||||||||||||||||| || |||||||||
Sbjct: 852 ccgatcagggggcccacccagaagatccattggtcatcccaggccttgtccttgttgtag 793

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           || || || | ||| ||||||||||||||||| |||||||||||||
Sbjct: 792 ataaccgcggttcccaagctcctcgccgggttaatgccggtgccgg 747



to top

>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence
          Length = 1215

 Score =  170 bits (86), Expect = 3e-39
 Identities = 146/166 (87%)
 Strand = Plus / Minus

                                                                       
Query: 311 ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 370
           |||| ||||||||||||||||||||||||||||||||||||   ||||||||||||||| 
Sbjct: 940 ccgagcttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcg 881

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           || || | ||| ||||||||||| ||||| ||||| ||||||||||| || |||||||||
Sbjct: 880 ccaatcagtggacccacccagaagatccattggtcgtcccaggccttgtccttgttgtag 821

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           || || || ||||| | | |||||||||||||||||||||||||||
Sbjct: 820 atgaccgcggctcccaggatcctcgccgggttgatgccggtgccgg 775



to top

>dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin, complete cds
          Length = 1318

 Score =  170 bits (86), Expect = 3e-39
 Identities = 146/166 (87%)
 Strand = Plus / Minus

                                                                       
Query: 311 ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 370
           |||| ||||| |||||||||||||||||| |||||||||||   |||||| |||||||| 
Sbjct: 974 ccgagcttggcggcgctggccctcagcacatactggtggtaggcggcggcaatggcggcg 915

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           ||||| | ||||||||||||||| ||||| ||||||||||||||||| ||  ||||||||
Sbjct: 914 ccgatcagtggccccacccagaagatccattggtcatcccaggccttgtcagtgttgtag 855

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           || || |||||||| ||||| ||||| |||||||||||||||||||
Sbjct: 854 atgacagcagctcccaagcttctcgcggggttgatgccggtgccgg 809



to top

>dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E03, full
           insert sequence
          Length = 1214

 Score =  170 bits (86), Expect = 3e-39
 Identities = 146/166 (87%)
 Strand = Plus / Minus

                                                                       
Query: 311 ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 370
           |||| ||||| ||||||||||||||||||||||||||||||   ||||||||||||||| 
Sbjct: 912 ccgagcttggcggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcg 853

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           ||||| |  || ||||||||||| ||||| ||||||||||||||||| || |||||||||
Sbjct: 852 ccgatcagggggcccacccagaagatccattggtcatcccaggccttgtccttgttgtag 793

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           || || || | ||| ||||||||||||||||| |||||||||||||
Sbjct: 792 ataaccgcggttcccaagctcctcgccgggttaatgccggtgccgg 747



to top

>dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd
          Length = 1251

 Score =  170 bits (86), Expect = 3e-39
 Identities = 146/166 (87%)
 Strand = Plus / Minus

                                                                       
Query: 311 ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 370
           |||| ||||| |||||||||||||||||| |||||||||||   |||||| |||||||| 
Sbjct: 894 ccgagcttggcggcgctggccctcagcacatactggtggtaggcggcggcaatggcggcg 835

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           ||||| | ||||||||||||||| ||||| ||||||||||||||||| ||  ||||||||
Sbjct: 834 ccgatcagtggccccacccagaagatccattggtcatcccaggccttgtcagtgttgtag 775

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           || || |||||||| ||||| ||||| |||||||||||||||||||
Sbjct: 774 atgacagcagctcccaagcttctcgcggggttgatgccggtgccgg 729



to top

>gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, complete cds
          Length = 901

 Score =  135 bits (68), Expect = 1e-28
 Identities = 119/136 (87%)
 Strand = Plus / Minus

                                                                       
Query: 341 tactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccag 400
           ||||||||||| || || || ||||| || || |||||||| || |||||||||||||| 
Sbjct: 813 tactggtggtagaatgcagcaatggcagctccaatgaatggtccgacccagaacatccaa 754

                                                                       
Query: 401 tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccggg 460
           ||||||||||||||||| |||||||| ||||| || |||||||||||||| || ||||||
Sbjct: 753 tggtcatcccaggccttgtcgttgttatagatgacagcagctccgaagcttctagccggg 694

                           
Query: 461 ttgatgccggtgccgg 476
           ||||| ||||||||||
Sbjct: 693 ttgataccggtgccgg 678



to top

>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Minus

                                                                       
Query: 340 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
           |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 926 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 867

                                                                       
Query: 400 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgg 459
            ||||  | ||| ||||||||||||||| |||| ||||| ||||||| |||||| |||||
Sbjct: 866 atggttgtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgg 807

                            
Query: 460 gttgatgccggtgccgg 476
           |||||||||||||||||
Sbjct: 806 gttgatgccggtgccgg 790



to top

>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Minus

                                                                       
Query: 340 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
           |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 928 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 869

                                                                       
Query: 400 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgg 459
            ||||  | ||| ||||||||||||||| |||| ||||| ||||||| |||||| |||||
Sbjct: 868 atggttgtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgg 809

                            
Query: 460 gttgatgccggtgccgg 476
           |||||||||||||||||
Sbjct: 808 gttgatgccggtgccgg 792



to top

>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Minus

                                                                       
Query: 340 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
           |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 929 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 870

                                                                       
Query: 400 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgg 459
            ||||  | ||| ||||||||||||||| |||| ||||| ||||||| |||||| |||||
Sbjct: 869 atggttgtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgg 810

                            
Query: 460 gttgatgccggtgccgg 476
           |||||||||||||||||
Sbjct: 809 gttgatgccggtgccgg 793



to top

>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Minus

                                                                       
Query: 340 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
           |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 926 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 867

                                                                       
Query: 400 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgg 459
            ||||  | ||| ||||||||||||||| |||| ||||| ||||||| |||||| |||||
Sbjct: 866 atggttgtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgg 807

                            
Query: 460 gttgatgccggtgccgg 476
           |||||||||||||||||
Sbjct: 806 gttgatgccggtgccgg 790



to top

>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full
           insert sequence
          Length = 1451

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Minus

                                                                       
Query: 340 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
           |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 520 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 461

                                                                       
Query: 400 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgg 459
            ||||  | ||| ||||||||||||||| |||| ||||| ||||||| |||||| |||||
Sbjct: 460 atggttgtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgg 401

                            
Query: 460 gttgatgccggtgccgg 476
           |||||||||||||||||
Sbjct: 400 gttgatgccggtgccgg 384



to top

>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Minus

                                                                       
Query: 340 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
           |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 926 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 867

                                                                       
Query: 400 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgg 459
            ||||  | ||| ||||||||||||||| |||| ||||| ||||||| |||||| |||||
Sbjct: 866 atggttgtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgg 807

                            
Query: 460 gttgatgccggtgccgg 476
           |||||||||||||||||
Sbjct: 806 gttgatgccggtgccgg 790



to top

>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Minus

                                                                       
Query: 340 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
           |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 928 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 869

                                                                       
Query: 400 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgg 459
            ||||  | ||| ||||||||||||||| |||| ||||| ||||||| |||||| |||||
Sbjct: 868 atggttgtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgg 809

                            
Query: 460 gttgatgccggtgccgg 476
           |||||||||||||||||
Sbjct: 808 gttgatgccggtgccgg 792



to top

>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Minus

                                                                       
Query: 340 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
           |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 929 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 870

                                                                       
Query: 400 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgg 459
            ||||  | ||| ||||||||||||||| |||| ||||| ||||||| |||||| |||||
Sbjct: 869 atggttgtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgg 810

                            
Query: 460 gttgatgccggtgccgg 476
           |||||||||||||||||
Sbjct: 809 gttgatgccggtgccgg 793



to top

>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Minus

                                                                       
Query: 340 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
           |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 916 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 857

                                                                       
Query: 400 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgg 459
            ||||  | ||| ||||||||||||||| |||| ||||| ||||||| |||||| |||||
Sbjct: 856 atggttgtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgg 797

                            
Query: 460 gttgatgccggtgccgg 476
           |||||||||||||||||
Sbjct: 796 gttgatgccggtgccgg 780



to top

>gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, complete cds
          Length = 1201

 Score =  117 bits (59), Expect = 3e-23
 Identities = 116/135 (85%)
 Strand = Plus / Minus

                                                                       
Query: 342 actggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagt 401
           |||||||||| || || || ||||| ||||| |||||||| ||||||||||| ||||| |
Sbjct: 858 actggtggtagaatgctgctatggctgccccaatgaatggtcccacccagaagatccaat 799

                                                                       
Query: 402 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggt 461
           ||||||||||||| ||||  | |||| |||| || ||||||||||  ||||| |||||||
Sbjct: 798 ggtcatcccaggctttctgttggttgaagataacagcagctccgagactcctggccgggt 739

                          
Query: 462 tgatgccggtgccgg 476
           |||||||||||||||
Sbjct: 738 tgatgccggtgccgg 724



to top

>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence
          Length = 1348

 Score =  113 bits (57), Expect = 5e-22
 Identities = 117/137 (85%)
 Strand = Plus / Minus

                                                                       
Query: 340 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
           |||||||||||| ||||| |||||||| || || | ||  || ||||||||||| |||||
Sbjct: 872 gtactggtggtagaaggccgcgatggcagcgcccacgagggggcccacccagaagatcca 813

                                                                       
Query: 400 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgg 459
           |||||| ||||||| ||| || ||||||||||| ||||| || || | |||||| |||||
Sbjct: 812 gtggtcgtcccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgg 753

                            
Query: 460 gttgatgccggtgccgg 476
           |||||||||||||||||
Sbjct: 752 gttgatgccggtgccgg 736



to top

>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds
          Length = 1133

 Score =  113 bits (57), Expect = 5e-22
 Identities = 117/137 (85%)
 Strand = Plus / Minus

                                                                       
Query: 340 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
           |||||||||||| ||||| |||||||| || || | ||  || ||||||||||| |||||
Sbjct: 820 gtactggtggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatcca 761

                                                                       
Query: 400 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgg 459
           |||||| ||||||| ||| || ||||||||||| ||||| || || | |||||| |||||
Sbjct: 760 gtggtcgtcccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgg 701

                            
Query: 460 gttgatgccggtgccgg 476
           |||||||||||||||||
Sbjct: 700 gttgatgccggtgccgg 684



to top

>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete
           cds
          Length = 1171

 Score =  113 bits (57), Expect = 5e-22
 Identities = 117/137 (85%)
 Strand = Plus / Minus

                                                                       
Query: 340 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
           |||||||||||| ||||| |||||||| || || | ||  || ||||||||||| |||||
Sbjct: 891 gtactggtggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatcca 832

                                                                       
Query: 400 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgg 459
           |||||| ||||||| ||| || ||||||||||| ||||| || || | |||||| |||||
Sbjct: 831 gtggtcgtcccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgg 772

                            
Query: 460 gttgatgccggtgccgg 476
           |||||||||||||||||
Sbjct: 771 gttgatgccggtgccgg 755



to top

>emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major intrinsic protein PIPc
          Length = 800

 Score =  107 bits (54), Expect = 3e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           |||| ||||||||| |||||||| ||||| ||||||||||| || ||  |||||||| ||
Sbjct: 516 ccgaggaatggcccaacccagaaaatccaatggtcatcccaagcttttccgttgttgaag 457

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           |||||||| || |||||||||||||||||||| || ||||||||||
Sbjct: 456 atcacggcggcgccgaagctcctcgccgggttaatcccggtgccgg 411



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                            
Query: 295      gaaggaggcagacgagccgaacttggtggcgctggccctcagcacgtactggtggtacaa 354
                ||||||||  || ||||||| ||||| ||||||||||||||| ||||||||||||||   
Sbjct: 26074856 gaaggaggaggaagagccgagcttggcggcgctggccctcaggacgtactggtggtaggc 26074797

                                                             
Query: 355      ggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
                ||||||||||||||| |||||||  |||||||||||||| |||||
Sbjct: 26074796 ggcggcgatggcggcgccgatgaggggccccacccagaagatcca 26074752



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                     
Query: 424      gttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
                |||||||||||| |||||||| |||||||| ||||||||||||||||||||||
Sbjct: 26074218 gttgtagatcaccgcagctcccaagctccttgccgggttgatgccggtgccgg 26074166



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                      
Query: 423      tgttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
                |||||||||| | |||||| || | ||||||||| |||||||||||||||||||
Sbjct: 28020774 tgttgtagatgatggcagcgccaaggctcctcgctgggttgatgccggtgccgg 28020721



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                           
Query: 400     gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgg 459
               |||||| ||||| |||||||  | ||||||||| ||||| || |||| |||||  || ||
Sbjct: 8906894 gtggtcgtcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagg 8906953

                                
Query: 460     gttgatgccggtgccgg 476
               ||||||||| |||||||
Sbjct: 8906954 gttgatgcccgtgccgg 8906970



to top

>gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein ZmPIP2-2 mRNA, complete
           cds
          Length = 1268

 Score =  105 bits (53), Expect = 1e-19
 Identities = 116/137 (84%)
 Strand = Plus / Minus

                                                                       
Query: 340 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
           |||||||||||| ||||| |||||||| || || | ||  || ||||||||||| |||||
Sbjct: 944 gtactggtggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatcca 885

                                                                       
Query: 400 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgg 459
           |||||||||||| | ||| || ||||||||||  ||||| || || | |||||| |||||
Sbjct: 884 gtggtcatcccatggcttgtccttgttgtagacgacggcggcgcccaggctcctggccgg 825

                            
Query: 460 gttgatgccggtgccgg 476
           |||||||||||||||||
Sbjct: 824 gttgatgccggtgccgg 808



to top

>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel
           protein, partial cds
          Length = 880

 Score =  105 bits (53), Expect = 1e-19
 Identities = 116/137 (84%)
 Strand = Plus / Minus

                                                                       
Query: 340 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
           |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 492 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 433

                                                                       
Query: 400 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgg 459
            ||||  | ||||||||||||||||||| |||| ||||| | ||||  | |||| |||||
Sbjct: 432 ttggttgtgccaggccttctcgttgttgaagatgacggccggtccggtggtcctggccgg 373

                            
Query: 460 gttgatgccggtgccgg 476
           |||||||||||||||||
Sbjct: 372 gttgatgccggtgccgg 356



to top

>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
           complete cds
          Length = 1283

 Score =  105 bits (53), Expect = 1e-19
 Identities = 134/161 (83%)
 Strand = Plus / Minus

                                                                       
Query: 316 cttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggccccgat 375
           |||| |||||| |||||| || | |||||||||||| ||||| ||||| || || |||||
Sbjct: 917 cttgatggcgccggccctgaggatgtactggtggtagaaggccgcgatcgccgcgccgat 858

                                                                       
Query: 376 gaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcac 435
            |  || || |||||||| ||||| || |||||||||||||| || ||||||||||| ||
Sbjct: 857 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 798

                                                    
Query: 436 ggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           ||| || || | |||||  ||||||||||||||||||||||
Sbjct: 797 ggcggcccccaggctccgggccgggttgatgccggtgccgg 757



to top

>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11,
              complete sequence
          Length = 163039

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                          
Query: 295    gaaggaggcagacgagccgaacttggtggcgctggccctcagcacgtactggtggtacaa 354
              ||||||||  || ||||||| ||||| ||||||||||||||| ||||||||||||||   
Sbjct: 109183 gaaggaggaggaagagccgagcttggcggcgctggccctcaggacgtactggtggtaggc 109124

                                                           
Query: 355    ggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
              ||||||||||||||| |||||||  |||||||||||||| |||||
Sbjct: 109123 ggcggcgatggcggcgccgatgaggggccccacccagaagatcca 109079



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                   
Query: 424    gttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
              |||||||||||| |||||||| |||||||| ||||||||||||||||||||||
Sbjct: 108545 gttgtagatcaccgcagctcccaagctccttgccgggttgatgccggtgccgg 108493



to top

>gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel protein MipC mRNA,
           complete cds
          Length = 1066

 Score =  105 bits (53), Expect = 1e-19
 Identities = 95/109 (87%)
 Strand = Plus / Minus

                                                                       
Query: 368 gccccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttg 427
           ||||| |||||||| || |||||||| ||||| || ||||||||||||||||  | ||||
Sbjct: 856 gccccaatgaatggtccaacccagaaaatccaatgatcatcccaggccttctgttggttg 797

                                                            
Query: 428 tagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           |||||||||||||||||||| || || || ||||||||||| |||||||
Sbjct: 796 tagatcacggcagctccgaaacttctagctgggttgatgccagtgccgg 748



to top

>gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA
          Length = 582

 Score =  105 bits (53), Expect = 1e-19
 Identities = 95/109 (87%)
 Strand = Plus / Minus

                                                                       
Query: 368 gccccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttg 427
           ||||| |||||||| || |||||||| ||||| || ||||||||||||||||  | ||||
Sbjct: 372 gccccaatgaatggtccaacccagaaaatccaatgatcatcccaggccttctgttggttg 313

                                                            
Query: 428 tagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           |||||||||||||||||||| || || || ||||||||||| |||||||
Sbjct: 312 tagatcacggcagctccgaaacttctagctgggttgatgccagtgccgg 264



to top

>ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G37170 (PIP2B) mRNA,
           complete cds
          Length = 1143

 Score =  103 bits (52), Expect = 5e-19
 Identities = 93/104 (89%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
           |||||||| ||||||||||| ||||||||||||||||| | ||| ||| ||||| |||||
Sbjct: 827 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttatagat 769

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||| ||||| ||||||||||||||||| ||||
Sbjct: 768 tacggcagctccgaaactcctagccgggttgatgccggttccgg 725



to top

>emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.3 gene)
          Length = 1187

 Score =  103 bits (52), Expect = 5e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           |||||||| ||||||||||||||||| ||||| || |||||||||||||| |||||||||
Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741

                               
Query: 446 aagctcctcgccgggttgat 465
           |||||||| || ||||||||
Sbjct: 740 aagctcctagcagggttgat 721



to top

>emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides mRNA for major intrinsic
           protein 1 (mip1 gene)
          Length = 1187

 Score =  103 bits (52), Expect = 5e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           |||||||| ||||||||||||||||| ||||| || |||||||||||||| |||||||||
Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741

                               
Query: 446 aagctcctcgccgggttgat 465
           |||||||| || ||||||||
Sbjct: 740 aagctcctagcagggttgat 721



to top

>emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB17ZB02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1041

 Score =  103 bits (52), Expect = 5e-19
 Identities = 93/104 (89%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
           |||||||| ||||||||||| ||||||||||||||||| | ||| ||| ||||| |||||
Sbjct: 812 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttatagat 754

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||| ||||| ||||||||||||||||| ||||
Sbjct: 753 tacggcagctccgaaactcctagccgggttgatgccggttccgg 710



to top

>emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH65ZF08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1079

 Score =  103 bits (52), Expect = 5e-19
 Identities = 93/104 (89%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
           |||||||| ||||||||||| ||||||||||||||||| | ||| ||| ||||| |||||
Sbjct: 812 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttatagat 754

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||| ||||| ||||||||||||||||| ||||
Sbjct: 753 tacggcagctccgaaactcctagccgggttgatgccggttccgg 710



to top

>emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZA12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score =  103 bits (52), Expect = 5e-19
 Identities = 93/104 (89%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
           |||||||| ||||||||||| ||||||||||||||||| | ||| ||| ||||| |||||
Sbjct: 803 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttatagat 745

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||| ||||| ||||||||||||||||| ||||
Sbjct: 744 tacggcagctccgaaactcctagccgggttgatgccggttccgg 701



to top

>emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH49ZD05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1074

 Score =  103 bits (52), Expect = 5e-19
 Identities = 93/104 (89%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
           |||||||| ||||||||||| ||||||||||||||||| | ||| ||| ||||| |||||
Sbjct: 812 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttatagat 754

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||| ||||| ||||||||||||||||| ||||
Sbjct: 753 tacggcagctccgaaactcctagccgggttgatgccggttccgg 710



to top

>emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH47ZD11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1095

 Score =  103 bits (52), Expect = 5e-19
 Identities = 93/104 (89%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
           |||||||| ||||||||||| ||||||||||||||||| | ||| ||| ||||| |||||
Sbjct: 812 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttatagat 754

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||| ||||| ||||||||||||||||| ||||
Sbjct: 753 tacggcagctccgaaactcctagccgggttgatgccggttccgg 710



to top

>emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS38ZC08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 821

 Score =  103 bits (52), Expect = 5e-19
 Identities = 93/104 (89%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
           |||||||| ||||||||||| ||||||||||||||||| | ||| ||| ||||| |||||
Sbjct: 504 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttatagat 446

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||| ||||| ||||||||||||||||| ||||
Sbjct: 445 tacggcagctccgaaactcctagccgggttgatgccggttccgg 402



to top

>emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH30ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1083

 Score =  103 bits (52), Expect = 5e-19
 Identities = 93/104 (89%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
           |||||||| ||||||||||| ||||||||||||||||| | ||| ||| ||||| |||||
Sbjct: 813 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttatagat 755

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||| ||||| ||||||||||||||||| ||||
Sbjct: 754 tacggcagctccgaaactcctagccgggttgatgccggttccgg 711



to top

>gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete sequence
          Length = 1104

 Score =  103 bits (52), Expect = 5e-19
 Identities = 93/104 (89%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
           |||||||| ||||||||||| ||||||||||||||||| | ||| ||| ||||| |||||
Sbjct: 828 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttatagat 770

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||| ||||| ||||||||||||||||| ||||
Sbjct: 769 tacggcagctccgaaactcctagccgggttgatgccggttccgg 726



to top

>gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic protein 2-like mRNA,
           complete cds
          Length = 1277

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 92/106 (86%)
 Strand = Plus / Minus

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           |||||||||||||| |||||||| |||||||| |||||||| ||||| |||  |||| | 
Sbjct: 840 ccgatgaatggcccgacccagaaaatccagtgttcatcccacgccttgtcgccgttgaaa 781

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           |||||||| || ||||| ||||||||||||||||| ||||| ||||
Sbjct: 780 atcacggccgccccgaaactcctcgccgggttgattccggtaccgg 735



to top

>ref|NM_187084.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 852

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 113/134 (84%)
 Strand = Plus / Minus

                                                                       
Query: 343 ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtg 402
           |||||||||||  || ||||| || ||||||||||| ||||| |||||||| ||||| ||
Sbjct: 798 ctggtggtacagcgctgcgatcgccgccccgatgaacggcccaacccagaagatccactg 739

                                                                       
Query: 403 gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggtt 462
            |||  ||| |||||   |||||||||||  ||||| || |||| |||||||||||||||
Sbjct: 738 atcactccatgccttgctgttgttgtagacgacggcggcgccgaggctcctcgccgggtt 679

                         
Query: 463 gatgccggtgccgg 476
           ||||||||||||||
Sbjct: 678 gatgccggtgccgg 665



to top

>ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group), P0475E07.134 mRNA
          Length = 619

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 113/134 (84%)
 Strand = Plus / Minus

                                                                       
Query: 343 ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtg 402
           |||||||||||  || ||||| || ||||||||||| ||||| |||||||| ||||| ||
Sbjct: 356 ctggtggtacagcgctgcgatcgccgccccgatgaacggcccaacccagaagatccactg 297

                                                                       
Query: 403 gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggtt 462
            |||  ||| |||||   |||||||||||  ||||| || |||| |||||||||||||||
Sbjct: 296 atcactccatgccttgctgttgttgtagacgacggcggcgccgaggctcctcgccgggtt 237

                         
Query: 463 gatgccggtgccgg 476
           ||||||||||||||
Sbjct: 236 gatgccggtgccgg 223



to top

>ref|NM_187081.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1215

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 113/134 (84%)
 Strand = Plus / Minus

                                                                       
Query: 343 ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtg 402
           |||||||||||  || ||||| || || |||||||| ||||| |||||||| ||||| ||
Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842

                                                                       
Query: 403 gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggtt 462
            |||  ||||||||| | ||||||||||| ||||||  | |||| |||||| ||||||||
Sbjct: 841 atcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggtt 782

                         
Query: 463 gatgccggtgccgg 476
           ||||||||||||||
Sbjct: 781 gatgccggtgccgg 768



to top

>emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.5 gene)
          Length = 1094

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 113/134 (84%)
 Strand = Plus / Minus

                                                                       
Query: 332 ctcagcacgtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccag 391
           ||||| ||||| ||||| || || || || || |||||||| ||||| ||||| ||||||
Sbjct: 860 ctcaggacgtattggtgatataaagcagcaattgcggccccaatgaaaggcccgacccag 801

                                                                       
Query: 392 aacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctc 451
           || ||||| ||||||||||| ||||| || | |||||| ||||| |||||||| ||||||
Sbjct: 800 aagatccaatggtcatcccatgccttgtcttcgttgtatatcacagcagctccaaagctc 741

                         
Query: 452 ctcgccgggttgat 465
           || |||||||||||
Sbjct: 740 ctagccgggttgat 727



to top

>dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-132-C10, full
           insert sequence
          Length = 618

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 113/134 (84%)
 Strand = Plus / Minus

                                                                       
Query: 343 ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtg 402
           |||||||||||  || ||||| || ||||||||||| ||||| |||||||| ||||| ||
Sbjct: 355 ctggtggtacagcgctgcgatcgccgccccgatgaacggcccaacccagaagatccactg 296

                                                                       
Query: 403 gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggtt 462
            |||  ||| |||||   |||||||||||  ||||| || |||| |||||||||||||||
Sbjct: 295 atcactccatgccttgctgttgttgtagacgacggcggcgccgaggctcctcgccgggtt 236

                         
Query: 463 gatgccggtgccgg 476
           ||||||||||||||
Sbjct: 235 gatgccggtgccgg 222



to top

>dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132K03, full
           insert sequence
          Length = 1215

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 113/134 (84%)
 Strand = Plus / Minus

                                                                       
Query: 343 ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtg 402
           |||||||||||  || ||||| || || |||||||| ||||| |||||||| ||||| ||
Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842

                                                                       
Query: 403 gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggtt 462
            |||  ||||||||| | ||||||||||| ||||||  | |||| |||||| ||||||||
Sbjct: 841 atcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggtt 782

                         
Query: 463 gatgccggtgccgg 476
           ||||||||||||||
Sbjct: 781 gatgccggtgccgg 768



to top

>gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds
          Length = 1216

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 112/133 (84%)
 Strand = Plus / Minus

                                                                       
Query: 342 actggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagt 401
           |||||||||| ||||| || ||||| || || ||||| || || ||||| || ||||| |
Sbjct: 868 actggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagatccact 809

                                                                       
Query: 402 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggt 461
           ||||||||||||||||||| ||||||||||| || ||||| || || ||||| || ||||
Sbjct: 808 ggtcatcccaggccttctcattgttgtagataacagcagcccccaaactcctggcagggt 749

                        
Query: 462 tgatgccggtgcc 474
           |||| ||||||||
Sbjct: 748 tgataccggtgcc 736



to top

>gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-1
           (PIP2-1) mRNA, complete cds
          Length = 1300

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 112/133 (84%)
 Strand = Plus / Minus

                                                                       
Query: 342 actggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagt 401
           |||||||||| ||||| || ||||| || || ||||| || || ||||| || ||||| |
Sbjct: 864 actggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagatccact 805

                                                                       
Query: 402 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggt 461
           ||||||||||||||||||| ||||||||||| || ||||| || || ||||| || ||||
Sbjct: 804 ggtcatcccaggccttctcattgttgtagataacagcagcccccaaactcctggcagggt 745

                        
Query: 462 tgatgccggtgcc 474
           |||| ||||||||
Sbjct: 744 tgataccggtgcc 732



to top

>dbj|AB206101.1| Mimosa pudica pip2;3 mRNA for plasma membrane intrinsic protein
           2;3, complete cds
          Length = 1218

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 113/135 (83%)
 Strand = Plus / Minus

                                                                       
Query: 342 actggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagt 401
           |||||||||| || || || ||||| || || |||||||| ||||||||||| ||||| |
Sbjct: 897 actggtggtagaatgctgctatggctgcaccaatgaatggtcccacccagaagatccaat 838

                                                                       
Query: 402 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggt 461
           | | ||||||||| ||||  | |||| ||||||| ||||||||||| ||||| |||||||
Sbjct: 837 gtttatcccaggctttctgttggttgaagatcacagcagctccgaaactcctggccgggt 778

                          
Query: 462 tgatgccggtgccgg 476
           | |||||||| ||||
Sbjct: 777 taatgccggtaccgg 763



to top

>emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic protein 2
          Length = 1214

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 91/106 (85%)
 Strand = Plus / Minus

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           |||||||||||||| |||||||| |||||||| || ||||| ||||| |||  |||| | 
Sbjct: 806 ccgatgaatggcccgacccagaaaatccagtgttcgtcccatgccttgtcgccgttgaaa 747

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           |||||||| || ||||| ||||||||||||||||| ||||| ||||
Sbjct: 746 atcacggccgccccgaaactcctcgccgggttgattccggtaccgg 701



to top

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 112/134 (83%)
 Strand = Plus / Minus

                                                                       
Query: 343 ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtg 402
           ||||||||| | |||||| |  ||||| |||||||| || || |||||||| ||||||||
Sbjct: 898 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 839

                                                                       
Query: 403 gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggtt 462
           |||   |||||| | |||  |||||||||| | ||| || |||| |||||||||||||||
Sbjct: 838 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 779

                         
Query: 463 gatgccggtgccgg 476
           ||||||||||||||
Sbjct: 778 gatgccggtgccgg 765



to top

>gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water channel protein MipH (MipH)
           mRNA, complete cds
          Length = 1347

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 85/98 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 tggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtgg 403
           |||||||| | |||||||||||| ||||| ||||| || || |||||||| ||||| || 
Sbjct: 884 tggtggtagatggcggcgatggcagccccaatgaacggtccgacccagaaaatccactga 825

                                                 
Query: 404 tcatcccaggccttctcgttgttgtagatcacggcagc 441
           |||||||||||||| | ||||||||||||||| |||||
Sbjct: 824 tcatcccaggccttgttgttgttgtagatcacagcagc 787



to top

>gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1) mRNA, complete
           cds
          Length = 480

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 109/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 342 actggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagt 401
           |||||||||| ||||| || ||||| || || ||||| || || ||||| || ||||| |
Sbjct: 418 actggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagatccact 359

                                                                       
Query: 402 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggt 461
           ||||||||||||||||||| ||||||||||| || ||||| || || ||||| || ||||
Sbjct: 358 ggtcatcccaggccttctcattgttgtagataacagcagcccccaaactcctggcagggt 299

                     
Query: 462 tgatgccggt 471
           |||| |||||
Sbjct: 298 tgataccggt 289



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 78/89 (87%)
 Strand = Plus / Minus

                                                                            
Query: 311      ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 370
                |||| ||||| ||||||||||||||||||||||||||||||   ||||||||||||||| 
Sbjct: 25184693 ccgagcttggcggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcg 25184634

                                             
Query: 371      ccgatgaatggccccacccagaacatcca 399
                ||||| |  || ||||||||||| |||||
Sbjct: 25184633 ccgatcagggggcccacccagaagatcca 25184605



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                            
Query: 401      tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccggg 460
                ||||||||||||||||| || ||||||||||| || || | ||| |||||||||||||||
Sbjct: 25184041 tggtcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccggg 25183982

                                
Query: 461      ttgatgccggtgccgg 476
                || |||||||||||||
Sbjct: 25183981 ttaatgccggtgccgg 25183966



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 56/68 (82%)
 Strand = Plus / Minus

                                                                            
Query: 401      tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccggg 460
                ||||||| |||||| |  || ||||||||||| | |||||| || | |||||| || |||
Sbjct: 27065067 tggtcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctggg 27065008

                        
Query: 461      ttgatgcc 468
                ||||||||
Sbjct: 27065007 ttgatgcc 27065000



to top

>dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1469H02
          Length = 136602

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 78/89 (87%)
 Strand = Plus / Minus

                                                                         
Query: 311   ccgaacttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggcc 370
             |||| ||||| ||||||||||||||||||||||||||||||   ||||||||||||||| 
Sbjct: 85086 ccgagcttggcggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcg 85027

                                          
Query: 371   ccgatgaatggccccacccagaacatcca 399
             ||||| |  || ||||||||||| |||||
Sbjct: 85026 ccgatcagggggcccacccagaagatcca 84998



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                         
Query: 401   tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccggg 460
             ||||||||||||||||| || ||||||||||| || || | ||| |||||||||||||||
Sbjct: 84434 tggtcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccggg 84375

                             
Query: 461   ttgatgccggtgccgg 476
             || |||||||||||||
Sbjct: 84374 ttaatgccggtgccgg 84359



to top

>gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasma membrane
           intrinsic protein mRNA, complete cds
          Length = 1120

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 111/133 (83%)
 Strand = Plus / Minus

                                                                       
Query: 344 tggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtgg 403
           |||||||| || ||||| ||||| || || |  ||||| || |||||||| ||||| |||
Sbjct: 788 tggtggtagaatgcggcaatggcagcaccaacaaatggtccaacccagaagatccactgg 729

                                                                       
Query: 404 tcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggttg 463
           |||||||| ||||| || |||||||| || || ||||||||||| ||||| || ||||||
Sbjct: 728 tcatcccatgccttgtccttgttgtaaattacagcagctccgaaactcctggctgggttg 669

                        
Query: 464 atgccggtgccgg 476
           || ||||||||||
Sbjct: 668 ataccggtgccgg 656



to top

>emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrinsic protein 2b
          Length = 1095

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 91/104 (87%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 432
           |||||||| ||||||||||| ||||||||||||||||| ||| | ||| ||||| |||||
Sbjct: 779 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttatagat 721

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            ||||  |||||||| ||||| ||||||||||||||||| ||||
Sbjct: 720 tacggacgctccgaaactcctagccgggttgatgccggttccgg 677



to top

>gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           partial cds
          Length = 411

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 401 tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccggg 460
           ||||||| ||||||| | || ||||||||||| || |||||||| ||||| |||||||||
Sbjct: 410 tggtcattccaggccctgtctttgttgtagatgacagcagctcccaagcttctcgccggg 351

                           
Query: 461 ttgatgccggtgccgg 476
           ||||||||||||||||
Sbjct: 350 ttgatgccggtgccgg 335



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 59/64 (92%)
 Strand = Plus / Minus

                                                                            
Query: 413      gccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtg 472
                ||||||||||||||| |||| ||||| ||||||| |||||| ||||||||||||||||||
Sbjct: 15355603 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtg 15355544

                    
Query: 473      ccgg 476
                ||||
Sbjct: 15355543 ccgg 15355540



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                        
Query: 421      gttgttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
                |||||||||||  ||||| || |||| |||||||||||||||||||||||||||||
Sbjct: 15324237 gttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccgg 15324182



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                        
Query: 421      gttgttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
                ||||||||| || ||||| || |||| |||||||||||||||||||||||||||||
Sbjct: 15316357 gttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccgg 15316302



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                            
Query: 409      ccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggttgatgcc 468
                ||||||||| | ||||||||||| ||||||  | |||| |||||| ||||||||||||||
Sbjct: 15306318 ccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggttgatgcc 15306259

                        
Query: 469      ggtgccgg 476
                ||||||||
Sbjct: 15306258 ggtgccgg 15306251



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                         
Query: 343      ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
                |||||||||||  || ||||| || ||||||||||| ||||| |||||||| |||||
Sbjct: 15324447 ctggtggtacagcgctgcgatcgccgccccgatgaacggcccaacccagaagatcca 15324391



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                         
Query: 343      ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
                |||||||||||  || ||||| || ||||||||||| ||||| |||||||| |||||
Sbjct: 15316534 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatcca 15316478



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                            
Query: 340      gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
                |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 15355800 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 15355741



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                         
Query: 343      ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
                |||||||||||  || ||||| || || |||||||| ||||| |||||||| |||||
Sbjct: 15306498 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatcca 15306442



to top

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 59/64 (92%)
 Strand = Plus / Minus

                                                                         
Query: 413   gccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtg 472
             ||||||||||||||| |||| ||||| ||||||| |||||| ||||||||||||||||||
Sbjct: 62602 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtg 62543

                 
Query: 473   ccgg 476
             ||||
Sbjct: 62542 ccgg 62539



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                     
Query: 421   gttgttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
             |||||||||||  ||||| || |||| |||||||||||||||||||||||||||||
Sbjct: 31236 gttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccgg 31181



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                     
Query: 421   gttgttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
             ||||||||| || ||||| || |||| |||||||||||||||||||||||||||||
Sbjct: 23356 gttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccgg 23301



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                         
Query: 409   ccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggttgatgcc 468
             ||||||||| | ||||||||||| ||||||  | |||| |||||| ||||||||||||||
Sbjct: 13317 ccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggttgatgcc 13258

                     
Query: 469   ggtgccgg 476
             ||||||||
Sbjct: 13257 ggtgccgg 13250



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                      
Query: 343   ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
             |||||||||||  || ||||| || ||||||||||| ||||| |||||||| |||||
Sbjct: 31446 ctggtggtacagcgctgcgatcgccgccccgatgaacggcccaacccagaagatcca 31390



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                      
Query: 343   ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
             |||||||||||  || ||||| || ||||||||||| ||||| |||||||| |||||
Sbjct: 23533 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatcca 23477



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                         
Query: 340   gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
             |||||||||||| || || ||||||||||| |||| ||| || || |||||||| |||||
Sbjct: 62799 gtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 62740



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                      
Query: 343   ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
             |||||||||||  || ||||| || || |||||||| ||||| |||||||| |||||
Sbjct: 13497 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatcca 13441



to top

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 89/104 (85%)
 Strand = Plus / Minus

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           |||||||| || ||||||||||| ||||||||||| ||||| |||| ||  |||||||||
Sbjct: 889 ccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 830

                                                       
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgcc 474
           || | ||| || |||| |  ||||||||||||||||||||||||
Sbjct: 829 atgatggcggcgccgagggacctcgccgggttgatgccggtgcc 786



to top

>dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane aquaporin 2c,
           complete cds
          Length = 1065

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 112/135 (82%)
 Strand = Plus / Minus

                                                                       
Query: 342 actggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagt 401
           ||||||| || || || ||||||||||| || |||||||| ||||||||||| |||||||
Sbjct: 832 actggtgataaaatgcagcgatggcggctccaatgaatggtcccacccagaatatccagt 773

                                                                       
Query: 402 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggt 461
           |||||||||| | |||    | ||||||||| || || |||||||| ||||| |||||||
Sbjct: 772 ggtcatcccacggcttggactcgttgtagataaccgcggctccgaaactcctggccgggt 713

                          
Query: 462 tgatgccggtgccgg 476
           | || ||||| ||||
Sbjct: 712 taataccggttccgg 698



to top

>ref|XM_475029.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           |||||||| |||||| ||||||| ||||||||||| ||||| |||||||  | |||||||
Sbjct: 758 ccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttgtag 699

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           || ||||| || |||| |||||  || ||||||||||| |||||||
Sbjct: 698 atgacggcggcgccgatgctccgggcagggttgatgcccgtgccgg 653



to top

>dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-B01, full
           insert sequence
          Length = 1067

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           |||||||| |||||| ||||||| ||||||||||| ||||| |||||||  | |||||||
Sbjct: 744 ccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttgtag 685

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           || ||||| || |||| |||||  || ||||||||||| |||||||
Sbjct: 684 atgacggcggcgccgatgctccgggcagggttgatgcccgtgccgg 639



to top

>dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086E18, full
           insert sequence
          Length = 1308

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           |||||||| |||||| ||||||| ||||||||||| ||||| |||||||  | |||||||
Sbjct: 857 ccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttgtag 798

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           || ||||| || |||| |||||  || ||||||||||| |||||||
Sbjct: 797 atgacggcggcgccgatgctccgggcagggttgatgcccgtgccgg 752



to top

>dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-B05, full
           insert sequence
          Length = 1309

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           |||||||| |||||| ||||||| ||||||||||| ||||| |||||||  | |||||||
Sbjct: 851 ccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttgtag 792

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           || ||||| || |||| |||||  || ||||||||||| |||||||
Sbjct: 791 atgacggcggcgccgatgctccgggcagggttgatgcccgtgccgg 746



to top

>dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-B10, full
           insert sequence
          Length = 1296

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           |||||||| |||||| ||||||| ||||||||||| ||||| |||||||  | |||||||
Sbjct: 845 ccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttgtag 786

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           || ||||| || |||| |||||  || ||||||||||| |||||||
Sbjct: 785 atgacggcggcgccgatgctccgggcagggttgatgcccgtgccgg 740



to top

>gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, complete cds
          Length = 909

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           |||||||| ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 740 acccagaagatccaatggtcatcccacgccttctcgttgttgtagataacagcagcacca 681

                            
Query: 446 aagctcctcgccgggtt 462
           ||||| ||||| |||||
Sbjct: 680 aagcttctcgctgggtt 664



to top

>ref|NM_115202.1| Arabidopsis thaliana PIP2A; water channel AT3G53420 (PIP2A)
            transcript variant AT3G53420.1 mRNA, complete cds
          Length = 1347

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                        
Query: 374  atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
            |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||||||||
Sbjct: 1029 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 971

                                                        
Query: 433  cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
             |||||||||||||| ||||| |||||||| || ||||| ||||
Sbjct: 970  tacggcagctccgaaactccttgccgggttaattccggttccgg 927



to top

>ref|NM_001035774.1| Arabidopsis thaliana PIP2A AT3G53420 (PIP2A) transcript variant
           AT3G53420.2 mRNA, complete cds
          Length = 1278

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
           |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||||||||
Sbjct: 979 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 921

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||| ||||| |||||||| || ||||| ||||
Sbjct: 920 tacggcagctccgaaactccttgccgggttaattccggttccgg 877



to top

>ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37180 (RD28) mRNA,
           complete cds
          Length = 1143

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 432
           |||||||| ||||||||||| ||||||||||||||||| ||| | ||| |||||  ||||
Sbjct: 831 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttaaagat 773

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            ||||| |||||||| ||||| ||||||||||| ||||| ||||
Sbjct: 772 tacggcggctccgaaactcctagccgggttgataccggttccgg 729



to top

>gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (At2g37180) mRNA,
           complete cds
          Length = 889

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 432
           |||||||| ||||||||||| ||||||||||||||||| ||| | ||| |||||  ||||
Sbjct: 764 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttaaagat 706

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            ||||| |||||||| ||||| ||||||||||| ||||| ||||
Sbjct: 705 tacggcggctccgaaactcctagccgggttgataccggttccgg 662



to top

>emb|X75883.1|ATPIP2A A.thaliana mRNA for plasma membrane intrinsic protein 2a
          Length = 1112

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
           |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||||||||
Sbjct: 809 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 751

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||| ||||| |||||||| || ||||| ||||
Sbjct: 750 tacggcagctccgaaactccttgccgggttaattccggttccgg 707



to top

>gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic
           protein 2C (At2g37180) mRNA, complete cds
          Length = 1151

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 432
           |||||||| ||||||||||| ||||||||||||||||| ||| | ||| |||||  ||||
Sbjct: 831 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttaaagat 773

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            ||||| |||||||| ||||| ||||||||||| ||||| ||||
Sbjct: 772 tacggcggctccgaaactcctagccgggttgataccggttccgg 729



to top

>gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-2
           (PIP2-2) mRNA, complete cds
          Length = 1171

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                       
Query: 377 aatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacg 436
           ||||| || |||||||| ||||| ||||| |||||  | || || ||||||||||| |||
Sbjct: 793 aatggtccgacccagaagatccactggtcgtcccaaactttttcattgttgtagatgacg 734

                                                   
Query: 437 gcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           || || ||||||||||| || |||||||||||||||||||
Sbjct: 733 gcggcgccgaagctcctggcggggttgatgccggtgccgg 694



to top

>gb|AY072374.1| Arabidopsis thaliana plasma membrane intrinsic protein 2a
           (At3g53420) mRNA, complete cds
          Length = 1122

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
           |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||||||||
Sbjct: 821 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 763

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||| ||||| |||||||| || ||||| ||||
Sbjct: 762 tacggcagctccgaaactccttgccgggttaattccggttccgg 719



to top

>gb|AF428426.1|AF428426 Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds
          Length = 1112

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
           |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||||||||
Sbjct: 829 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 771

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||| ||||| |||||||| || ||||| ||||
Sbjct: 770 tacggcagctccgaaactccttgccgggttaattccggttccgg 727



to top

>gb|AY056085.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds
          Length = 864

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
           |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||||||||
Sbjct: 770 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 712

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||| ||||| |||||||| || ||||| ||||
Sbjct: 711 tacggcagctccgaaactccttgccgggttaattccggttccgg 668



to top

>dbj|AK220982.1| Arabidopsis thaliana mRNA for plasma membrane intrinsic protein 2a,
           partial cds, clone: RAFL22-59-G07
          Length = 420

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
           |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||||||||
Sbjct: 111 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 53

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||| ||||| |||||||| || ||||| ||||
Sbjct: 52  tacggcagctccgaaactccttgccgggttaattccggttccgg 9



to top

>gb|AY044327.1| Arabidopsis thaliana plasma membrane intrinsic protein 2a
           (F4P12.12) mRNA, complete cds
          Length = 956

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
           |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||||||||
Sbjct: 770 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 712

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||| ||||| |||||||| || ||||| ||||
Sbjct: 711 tacggcagctccgaaactccttgccgggttaattccggttccgg 668



to top

>gb|AY039579.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds
          Length = 1129

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
           |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||||||||
Sbjct: 829 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 771

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||| ||||| |||||||| || ||||| ||||
Sbjct: 770 tacggcagctccgaaactccttgccgggttaattccggttccgg 727



to top

>emb|BX824659.1|CNS0A6W2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH62ZH05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1056

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
           |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||||||||
Sbjct: 812 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 754

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||| ||||| |||||||| || ||||| ||||
Sbjct: 753 tacggcagctccgaaactccttgccgggttaattccggttccgg 710



to top

>emb|BX824010.1|CNS0A6YX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH14ZC12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1035

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
           |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||||||||
Sbjct: 809 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 751

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||| ||||| |||||||| || ||||| ||||
Sbjct: 750 tacggcagctccgaaactccttgccgggttaattccggttccgg 707



to top

>emb|BX823952.1|CNS0A4TL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH10ZA03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1071

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
           |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||||||||
Sbjct: 817 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 759

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||| ||||| |||||||| || ||||| ||||
Sbjct: 758 tacggcagctccgaaactccttgccgggttaattccggttccgg 715



to top

>emb|BX842136.1|CNS09YDO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS52ZB11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1117

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
           |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||||||||
Sbjct: 813 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 755

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            |||||||||||||| ||||| |||||||| || ||||| ||||
Sbjct: 754 tacggcagctccgaaactccttgccgggttaattccggttccgg 711



to top

>gb|AY087854.1| Arabidopsis thaliana clone 38965 mRNA, complete sequence
          Length = 1352

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                        
Query: 374  atgaatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagat 432
            |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||||||||
Sbjct: 1031 atgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgttgtagat 973

                                                        
Query: 433  cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
             |||||||||||||| ||||| |||||||| || ||||| ||||
Sbjct: 972  tacggcagctccgaaactccttgccgggttaattccggttccgg 929



to top

>gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete sequence
          Length = 1060

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 432
           |||||||| ||||||||||| ||||||||||||||||| ||| | ||| |||||  ||||
Sbjct: 831 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttaaagat 773

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            ||||| |||||||| ||||| ||||||||||| ||||| ||||
Sbjct: 772 tacggcggctccgaaactcctagccgggttgataccggttccgg 729



to top

>dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative transmenbrane channel
           protein
          Length = 1121

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagat 432
           |||||||| ||||||||||| ||||||||||||||||| ||| | ||| |||||  ||||
Sbjct: 814 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgttaaagat 756

                                                       
Query: 433 cacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
            ||||| |||||||| ||||| ||||||||||| ||||| ||||
Sbjct: 755 tacggcggctccgaaactcctagccgggttgataccggttccgg 712



to top

>ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channel AT5G60660
           (PIP2;4/PIP2F) mRNA, complete cds
          Length = 1139

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           ||||| || ||||| ||||| ||||||||||| ||||||||||| || ||||||||||| 
Sbjct: 808 acccaaaaaatccattggtcgtcccaggccttttcgttgttgtaaataacggcagctcca 749

                                          
Query: 446 aagctcctcgccgggttgatgccggtgccgg 476
           ||||| |  ||||||||||| ||||| ||||
Sbjct: 748 aagctacgagccgggttgataccggttccgg 718



to top

>gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete sequence
          Length = 1120

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           ||||| || ||||| ||||| ||||||||||| ||||||||||| || ||||||||||| 
Sbjct: 808 acccaaaaaatccattggtcgtcccaggccttttcgttgttgtaaataacggcagctcca 749

                                          
Query: 446 aagctcctcgccgggttgatgccggtgccgg 476
           ||||| |  ||||||||||| ||||| ||||
Sbjct: 748 aagctacgagccgggttgataccggttccgg 718



to top

>ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channel AT2G39010
           (PIP2;6/PIP2E) mRNA, complete cds
          Length = 1245

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 377 aatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacg 436
           ||||| || |||||||| ||||| || |||||||| ||||| |  ||||||||||| |||
Sbjct: 851 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 792

                                                 
Query: 437 gcagctccgaagctcctcgccgggttgatgccggtgcc 474
           |||||||| || ||||| |||||||| || ||||||||
Sbjct: 791 gcagctccaaaactcctagccgggtttattccggtgcc 754



to top

>dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds
          Length = 1278

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 101/122 (82%)
 Strand = Plus / Minus

                                                                       
Query: 344 tggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtgg 403
           |||||||||||||| || ||||| || || || ||||| || | |||||| ||||| |||
Sbjct: 812 tggtggtacaaggcagcaatggcagctccaataaatggtccaagccagaagatccattgg 753

                                                                       
Query: 404 tcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggttg 463
           |||||||| || || || |||||||||||||| |||||||| || || || || ||||||
Sbjct: 752 tcatcccaagctttgtccttgttgtagatcacagcagctccaaaacttctagcagggttg 693

             
Query: 464 at 465
           ||
Sbjct: 692 at 691



to top

>gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1201

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 377 aatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacg 436
           ||||| || |||||||| ||||| || |||||||| ||||| |  ||||||||||| |||
Sbjct: 846 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 787

                                                 
Query: 437 gcagctccgaagctcctcgccgggttgatgccggtgcc 474
           |||||||| || ||||| |||||||| || ||||||||
Sbjct: 786 gcagctccaaaactcctagccgggtttattccggtgcc 749



to top

>gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 870

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 377 aatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacg 436
           ||||| || |||||||| ||||| || |||||||| ||||| |  ||||||||||| |||
Sbjct: 764 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 705

                                                 
Query: 437 gcagctccgaagctcctcgccgggttgatgccggtgcc 474
           |||||||| || ||||| |||||||| || ||||||||
Sbjct: 704 gcagctccaaaactcctagccgggtttattccggtgcc 667



to top

>gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1169

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 377 aatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacg 436
           ||||| || |||||||| ||||| || |||||||| ||||| |  ||||||||||| |||
Sbjct: 848 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 789

                                                 
Query: 437 gcagctccgaagctcctcgccgggttgatgccggtgcc 474
           |||||||| || ||||| |||||||| || ||||||||
Sbjct: 788 gcagctccaaaactcctagccgggtttattccggtgcc 751



to top

>emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB75ZE10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1128

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 377 aatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacg 436
           ||||| || |||||||| ||||| || |||||||| ||||| |  ||||||||||| |||
Sbjct: 825 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 766

                                                 
Query: 437 gcagctccgaagctcctcgccgggttgatgccggtgcc 474
           |||||||| || ||||| |||||||| || ||||||||
Sbjct: 765 gcagctccaaaactcctagccgggtttattccggtgcc 728



to top

>emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS74ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1160

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 377 aatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacg 436
           ||||| || |||||||| ||||| || |||||||| ||||| |  ||||||||||| |||
Sbjct: 835 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 776

                                                 
Query: 437 gcagctccgaagctcctcgccgggttgatgccggtgcc 474
           |||||||| || ||||| |||||||| || ||||||||
Sbjct: 775 gcagctccaaaactcctagccgggtttattccggtgcc 738



to top

>emb|AJ605565.1| Ricinus communis partial mRNA for putative aquaporin (Pip2-2 gene),
           clone pR450-3
          Length = 452

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 401 tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccggg 460
           ||||||||||| |||||||| ||||||||||| || ||||||||||| ||||| || |||
Sbjct: 431 tggtcatcccatgccttctccttgttgtagattacagcagctccgaaactccttgctggg 372

                         
Query: 461 ttgatgccggtgcc 474
           ||||| || |||||
Sbjct: 371 ttgattccagtgcc 358



to top

>gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (pip2) mRNA,
           complete cds
          Length = 1260

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                       
Query: 376 gaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcac 435
           |||||| || ||||| || ||||| ||||||||||||| ||| || | ||||||||| ||
Sbjct: 853 gaatggtccaacccaaaaaatccaatggtcatcccagggcttgtcttcgttgtagatgac 794

                                            
Query: 436 ggcagctccgaagctcctcgccgggttgatgcc 468
            |||||||| |||||||| || |||||||||||
Sbjct: 793 agcagctccaaagctcctagcagggttgatgcc 761



to top

>gb|BT013307.1| Lycopersicon esculentum clone 134975R, mRNA sequence
          Length = 1260

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 112/137 (81%)
 Strand = Plus / Minus

                                                                       
Query: 340 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
           |||||||||||| |  |||||||||   || ||||| |||||||| |||||||| |||||
Sbjct: 900 gtactggtggtagacagcggcgatgaaagctccgataaatggcccgacccagaaaatcca 841

                                                                       
Query: 400 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgg 459
           ||| || ||||| ||||| ||   |||| | ||||| || || ||||| |||||||||||
Sbjct: 840 gtgttcgtcccacgccttatcaccgttgaaaatcacagctgccccgaaactcctcgccgg 781

                            
Query: 460 gttgatgccggtgccgg 476
           |||||| ||||| ||||
Sbjct: 780 gttgattccggtaccgg 764



to top

>gb|DQ450066.1| Arachis hypogaea clone 10A4R1GZ putative aquaporin mRNA, partial
           cds
          Length = 607

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 103/125 (82%)
 Strand = Plus / Minus

                                                                       
Query: 344 tggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtgg 403
           |||||||| ||||| || ||||| ||||| |||||||| || ||||| || ||||| |||
Sbjct: 196 tggtggtagaaggctgcaatggctgccccaatgaatggtcctacccaaaagatccaatgg 137

                                                                       
Query: 404 tcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggttg 463
           |||||||||| ||| || | |||| |||| || |||||||| || ||||| || ||||| 
Sbjct: 136 tcatcccagggcttgtcttggttgaagataacagcagctccaaaactccttgcagggtta 77

                
Query: 464 atgcc 468
           |||||
Sbjct: 76  atgcc 72



to top

>gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel protein MipE mRNA,
           complete cds
          Length = 1179

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           |||||||| ||||| ||||||||||||  ||||| | ||||| |||| || ||||| |||
Sbjct: 871 acccagaaaatccaatggtcatcccagttcttcttgctgttgaagataacagcagcaccg 812

                                        
Query: 446 aagctcctcgccgggttgatgccggtgcc 474
           || ||||| || |||||||||||||||||
Sbjct: 811 aaactcctagcagggttgatgccggtgcc 783



to top

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 85/101 (84%)
 Strand = Plus / Minus

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           |||||||| || || |||||||| ||||||||||| ||||| |||| ||  |||||||||
Sbjct: 874 ccgatgaacggaccaacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 815

                                                    
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggt 471
           || | ||| || |||| |  |||||||||||||||||||||
Sbjct: 814 atgatggcggcgccgagggacctcgccgggttgatgccggt 774



to top

>gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrinsic protein homolog
           (mipE) mRNA, partial cds
          Length = 963

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           |||||||| ||||| ||||||||||||  ||||| | ||||| |||| || ||||| |||
Sbjct: 655 acccagaaaatccaatggtcatcccagttcttcttgctgttgaagataacagcagcaccg 596

                                        
Query: 446 aagctcctcgccgggttgatgccggtgcc 474
           || ||||| || |||||||||||||||||
Sbjct: 595 aaactcctagcagggttgatgccggtgcc 567



to top

>ref|NM_119676.2| Arabidopsis thaliana PIP3 (PLASMA MEMBRANE INTRINSIC PROTEIN 3);
           water channel AT4G35100 (PIP3) mRNA, complete cds
          Length = 1182

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 727

                               
Query: 446 aagctcctcgccgggttgat 465
           ||||| || || ||||||||
Sbjct: 726 aagcttctagctgggttgat 707



to top

>emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.2 gene)
          Length = 978

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                       
Query: 377 aatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacg 436
           |||||||| |||||||| ||||| || ||||||||||| || || |||||| |||| || 
Sbjct: 835 aatggcccaacccagaaaatccaatgatcatcccaggctttttcattgttgaagatgaca 776

                                           
Query: 437 gcagctccgaagctcctcgccgggttgatgcc 468
           ||||| || |||||||| || |||||||||||
Sbjct: 775 gcagcgccaaagctcctggcagggttgatgcc 744



to top

>gb|AY081580.1| Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           (At4g35100) mRNA, complete cds
          Length = 946

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 737 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 678

                               
Query: 446 aagctcctcgccgggttgat 465
           ||||| || || ||||||||
Sbjct: 677 aagcttctagctgggttgat 658



to top

>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1
           (PIP1-1) mRNA, complete cds
          Length = 1115

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 93/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 365 gcggccccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttg 424
           |||||||| |||||||| ||||||||||| ||||||||||| ||||| || |  || |||
Sbjct: 831 gcggccccaatgaatggtcccacccagaagatccagtggtcgtcccatgcgtggtccttg 772

                                                               
Query: 425 ttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           |||||||| | ||| || || | |||||  || |||||||||||||| ||||
Sbjct: 771 ttgtagatgatggccgcacccaggctccgagctgggttgatgccggttccgg 720



to top

>gb|AY062803.1| Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           (At4g35100; M4E13.150) mRNA, complete cds
          Length = 1036

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 784 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 725

                               
Query: 446 aagctcctcgccgggttgat 465
           ||||| || || ||||||||
Sbjct: 724 aagcttctagctgggttgat 705



to top

>gb|AF412110.1|AF412110 Arabidopsis thaliana AT4g35100/M4E13_150 mRNA, complete cds
          Length = 1026

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 727

                               
Query: 446 aagctcctcgccgggttgat 465
           ||||| || || ||||||||
Sbjct: 726 aagcttctagctgggttgat 707



to top

>gb|AF003728.1|AF003728 Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           mRNA, complete cds
          Length = 1030

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 765 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 706

                               
Query: 446 aagctcctcgccgggttgat 465
           ||||| || || ||||||||
Sbjct: 705 aagcttctagctgggttgat 686



to top

>emb|BX826680.1|CNS0A37C Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB53ZH03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1036

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 777 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 718

                               
Query: 446 aagctcctcgccgggttgat 465
           ||||| || || ||||||||
Sbjct: 717 aagcttctagctgggttgat 698



to top

>emb|BX826294.1|CNS0A39S Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB11ZA04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 999

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 775 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 716

                               
Query: 446 aagctcctcgccgggttgat 465
           ||||| || || ||||||||
Sbjct: 715 aagcttctagctgggttgat 696



to top

>emb|BX827919.1|CNS0A2ZT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH35ZA10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1019

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 774 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 715

                               
Query: 446 aagctcctcgccgggttgat 465
           ||||| || || ||||||||
Sbjct: 714 aagcttctagctgggttgat 695



to top

>emb|BX827124.1|CNS0A2UI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS11ZH09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 985

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 769 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 710

                               
Query: 446 aagctcctcgccgggttgat 465
           ||||| || || ||||||||
Sbjct: 709 aagcttctagctgggttgat 690



to top

>gb|AY088485.1| Arabidopsis thaliana clone 7108 mRNA, complete sequence
          Length = 1033

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 727

                               
Query: 446 aagctcctcgccgggttgat 465
           ||||| || || ||||||||
Sbjct: 726 aagcttctagctgggttgat 707



to top

>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0475E07
          Length = 139961

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                      
Query: 421    gttgttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
              |||||||||||  ||||| || |||| |||||||||||||||||||||||||||||
Sbjct: 110250 gttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccgg 110195



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                      
Query: 421    gttgttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
              ||||||||| || ||||| || |||| |||||||||||||||||||||||||||||
Sbjct: 102370 gttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccgg 102315



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                         
Query: 409   ccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggttgatgcc 468
             ||||||||| | ||||||||||| ||||||  | |||| |||||| ||||||||||||||
Sbjct: 92331 ccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggttgatgcc 92272

                     
Query: 469   ggtgccgg 476
             ||||||||
Sbjct: 92271 ggtgccgg 92264



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                       
Query: 343    ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
              |||||||||||  || ||||| || ||||||||||| ||||| |||||||| |||||
Sbjct: 110460 ctggtggtacagcgctgcgatcgccgccccgatgaacggcccaacccagaagatcca 110404



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                       
Query: 343    ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
              |||||||||||  || ||||| || ||||||||||| ||||| |||||||| |||||
Sbjct: 102547 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatcca 102491



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                      
Query: 343   ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
             |||||||||||  || ||||| || || |||||||| ||||| |||||||| |||||
Sbjct: 92511 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatcca 92455



to top

>dbj|D85193.1| Arabidopsis thaliana mRNA, partial cds
          Length = 748

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 476 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 417

                               
Query: 446 aagctcctcgccgggttgat 465
           ||||| || || ||||||||
Sbjct: 416 aagcttctagctgggttgat 397



to top

>dbj|AB005246.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUP24
          Length = 77999

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                         
Query: 401   tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccggg 460
             ||||| ||||||||||| ||||||||||| || ||||||||||| ||||| |  ||||||
Sbjct: 19103 tggtcgtcccaggccttttcgttgttgtaaataacggcagctccaaagctacgagccggg 19162

                             
Query: 461   ttgatgccggtgccgg 476
             ||||| ||||| ||||
Sbjct: 19163 ttgataccggttccgg 19178



to top

>gb|U78297.1|ATU78297 Arabidopsis thaliana plasma membrane intrinsic protein PIP3 mRNA,
           complete cds
          Length = 1046

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 784 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 725

                               
Query: 446 aagctcctcgccgggttgat 465
           ||||| || || ||||||||
Sbjct: 724 aagcttctagctgggttgat 705



to top

>ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channel AT4G23400
           (PIP1;5/PIP1D) mRNA, complete cds
          Length = 1128

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 433
           |||||||| || |||||||| ||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 843 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 784

                                              
Query: 434 acggcagctccgaagctcctcgccgggttgatgcc 468
           | |||||||||||  ||||| |||||||| |||||
Sbjct: 783 atggcagctccgagactcctggccgggttaatgcc 749



to top

>ref|XM_473480.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           |||||||| ||||| |||||||||||||| |   |  |||||||||| | |||||| || 
Sbjct: 767 acccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggcagcgcca 708

                                          
Query: 446 aagctcctcgccgggttgatgccggtgccgg 476
           | ||||||||| |||||||||||||||||||
Sbjct: 707 aggctcctcgctgggttgatgccggtgccgg 677



to top

>gb|AC006260.4| Arabidopsis thaliana chromosome 2 clone T2N18 map ve018, complete
             sequence
          Length = 80736

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                    
Query: 422   ttgttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
             ||||| ||||| |||||||||||||| ||||| ||||||||||||||||| ||||
Sbjct: 25095 ttgttatagattacggcagctccgaaactcctagccgggttgatgccggttccgg 25041



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                             
Query: 429   agatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
             |||| ||||| |||||||| ||||| ||||||||||| ||||| ||||
Sbjct: 20260 agattacggcggctccgaaactcctagccgggttgataccggttccgg 20307



to top

>gb|AY081593.1| Arabidopsis thaliana water channel-like protein (At4g23400) mRNA,
           complete cds
          Length = 956

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 433
           |||||||| || |||||||| ||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 794 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 735

                                              
Query: 434 acggcagctccgaagctcctcgccgggttgatgcc 468
           | |||||||||||  ||||| |||||||| |||||
Sbjct: 734 atggcagctccgagactcctggccgggttaatgcc 700



to top

>gb|AY059948.1| Arabidopsis thaliana water channel - like protein (At4g23400;
           F16G20.100) mRNA, complete cds
          Length = 1125

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 433
           |||||||| || |||||||| ||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 843 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 784

                                              
Query: 434 acggcagctccgaagctcctcgccgggttgatgcc 468
           | |||||||||||  ||||| |||||||| |||||
Sbjct: 783 atggcagctccgagactcctggccgggttaatgcc 749



to top

>dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - like protein, partial
           cds, clone: RAFL24-17-A12
          Length = 392

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 433
           |||||||| || |||||||| ||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 99  atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 40

                                              
Query: 434 acggcagctccgaagctcctcgccgggttgatgcc 468
           | |||||||||||  ||||| |||||||| |||||
Sbjct: 39  atggcagctccgagactcctggccgggttaatgcc 5



to top

>emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 454

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 433
           |||||||| || |||||||| ||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 167 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 108

                                              
Query: 434 acggcagctccgaagctcctcgccgggttgatgcc 468
           | |||||||||||  ||||| |||||||| |||||
Sbjct: 107 atggcagctccgagactcctggccgggttaatgcc 73



to top

>emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB51ZF11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 710

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 433
           |||||||| || |||||||| ||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 426 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 367

                                              
Query: 434 acggcagctccgaagctcctcgccgggttgatgcc 468
           | |||||||||||  ||||| |||||||| |||||
Sbjct: 366 atggcagctccgagactcctggccgggttaatgcc 332



to top

>emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS16ZB08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1066

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 433
           |||||||| || |||||||| ||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 832 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 773

                                              
Query: 434 acggcagctccgaagctcctcgccgggttgatgcc 468
           | |||||||||||  ||||| |||||||| |||||
Sbjct: 772 atggcagctccgagactcctggccgggttaatgcc 738



to top

>emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS21ZB06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 433
           |||||||| || |||||||| ||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 807 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 748

                                              
Query: 434 acggcagctccgaagctcctcgccgggttgatgcc 468
           | |||||||||||  ||||| |||||||| |||||
Sbjct: 747 atggcagctccgagactcctggccgggttaatgcc 713



to top

>gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds
          Length = 1070

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           |||||||| ||||| || |||||||| || || || ||||||||||| ||||| ||||||
Sbjct: 746 acccagaaaatccattgatcatcccaagctttgtctttgttgtagattacggcggctccg 687

                                          
Query: 446 aagctcctcgccgggttgatgccggtgccgg 476
           ||||| || || ||||| || ||||||||||
Sbjct: 686 aagcttctggcggggttaattccggtgccgg 656



to top

>gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete sequence
          Length = 1089

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 433
           |||||||| || |||||||| ||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 841 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 782

                                              
Query: 434 acggcagctccgaagctcctcgccgggttgatgcc 468
           | |||||||||||  ||||| |||||||| |||||
Sbjct: 781 atggcagctccgagactcctggccgggttaatgcc 747



to top

>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           |||||||| ||||| |||||||||||||| |   |  |||||||||| | |||||| || 
Sbjct: 844 acccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggcagcgcca 785

                                          
Query: 446 aagctcctcgccgggttgatgccggtgccgg 476
           | ||||||||| |||||||||||||||||||
Sbjct: 784 aggctcctcgctgggttgatgccggtgccgg 754



to top

>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           |||||||| ||||| |||||||||||||| |   |  |||||||||| | |||||| || 
Sbjct: 845 acccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggcagcgcca 786

                                          
Query: 446 aagctcctcgccgggttgatgccggtgccgg 476
           | ||||||||| |||||||||||||||||||
Sbjct: 785 aggctcctcgctgggttgatgccggtgccgg 755



to top

>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full
           insert sequence
          Length = 1167

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           |||||||| ||||| |||||||||||||| |   |  |||||||||| | |||||| || 
Sbjct: 847 acccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggcagcgcca 788

                                          
Query: 446 aagctcctcgccgggttgatgccggtgccgg 476
           | ||||||||| |||||||||||||||||||
Sbjct: 787 aggctcctcgctgggttgatgccggtgccgg 757



to top

>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
            insert sequence
          Length = 1462

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                        
Query: 386  acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
            |||||||| ||||| |||||||||||||| |   |  |||||||||| | |||||| || 
Sbjct: 1143 acccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggcagcgcca 1084

                                           
Query: 446  aagctcctcgccgggttgatgccggtgccgg 476
            | ||||||||| |||||||||||||||||||
Sbjct: 1083 aggctcctcgctgggttgatgccggtgccgg 1053



to top

>gb|U27347.1|GMU27347 Glycine max putative water channel protein (Pip1) mRNA, complete
           cds
          Length = 1255

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                       
Query: 344 tggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtgg 403
           |||||||| ||||| || ||||| || || || ||||| || ||||| || ||||| |||
Sbjct: 890 tggtggtagaaggctgcaatggctgctccaataaatggtccaacccaaaagatccaatgg 831

                                                                       
Query: 404 tcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggttg 463
           ||||||||||||||||  | |||||| || || |||||||| | |||||| || ||||| 
Sbjct: 830 tcatcccaggccttctgttggttgtacatgacagcagctcctaggctcctagcagggtta 771

                      
Query: 464 atgccggtgcc 474
           ||||| |||||
Sbjct: 770 atgccagtgcc 760



to top

>dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membrane intrinsic protein
           2-2, complete cds
          Length = 1051

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                       
Query: 344 tggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtgg 403
           |||||||| ||||| || || || || || ||||| || || |||||||| ||||| |||
Sbjct: 874 tggtggtagaaggctgcaattgctgctccaatgaagggtcctacccagaaaatccattgg 815

                                                                       
Query: 404 tcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggttg 463
           |||||||| ||||| || ||||||||||| || |||||||| |  || || || ||||||
Sbjct: 814 tcatcccaagccttgtctttgttgtagataacagcagctccaagacttctagcggggttg 755

                      
Query: 464 atgccggtgcc 474
           ||||| |||||
Sbjct: 754 atgccagtgcc 744



to top

>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin
          Length = 1291

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 423 tgttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           |||||||||| | ||| || |||| |||||||||||||||||||||||||||||
Sbjct: 657 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccgg 604



to top

>gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic protein (mip3) mRNA,
           partial cds
          Length = 495

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                       
Query: 397 ccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgc 456
           ||||||||| ||||||||||| || |||||||||||||| |||||||| | ||| || ||
Sbjct: 495 ccagtggtcgtcccaggccttgtcattgttgtagatcactgcagctccaaggcttcttgc 436

                             
Query: 457 cgggttgatgccggtgcc 474
            ||||| ||||| |||||
Sbjct: 435 tgggtttatgccagtgcc 418



to top

>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 383 cccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagct 442
           ||||||||||| ||||| ||||||| |||||| |  ||  |||||||||| | |||||| 
Sbjct: 873 cccacccagaagatccaatggtcattccaggcatggtccctgttgtagatgatggcagcc 814

                                             
Query: 443 ccgaagctcctcgccgggttgatgccggtgccgg 476
           || | |||||| || |||||||||||||||||||
Sbjct: 813 ccaaggctcctagctgggttgatgccggtgccgg 780



to top

>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 88/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           |||||||||||||| |||||||| ||||| ||||||| ||| || |      ||||||||
Sbjct: 882 ccgatgaatggcccaacccagaatatccaatggtcattccatgcgtgggatctgttgtag 823

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           || | ||||||||| | |||||| || |||||||||||||||||||
Sbjct: 822 atgatggcagctcccaggctccttgcagggttgatgccggtgccgg 777



to top

>dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane aquaporin 2b,
           complete cds
          Length = 1087

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 88/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           ||||||||||| ||||||||||| ||||||||||||||||| | |||    | |||||||
Sbjct: 804 ccgatgaatggtcccacccagaaaatccagtggtcatcccacggcttggactcgttgtag 745

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           || || || ||||| || ||||| |||||||| || ||||| ||||
Sbjct: 744 ataaccgcggctccaaaactcctggccgggttaatcccggttccgg 699



to top

>gb|DQ226873.1| Boechera divaricarpa isolate SLW-C-G04 mRNA sequence
          Length = 514

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           ||||| || ||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 163 acccaaaagatccaatggtcatcccaagccttctcgttgttgtagataacagcagcacca 104

                
Query: 446 aagct 450
           |||||
Sbjct: 103 aagct 99



to top

>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82
          Length = 195165

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                          
Query: 401    tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccggg 460
              ||||||||||| |||||||||||||||||||| || ||||| || ||||| || || |||
Sbjct: 164524 tggtcatcccacgccttctcgttgttgtagataacagcagcaccaaagcttctagctggg 164465

                   
Query: 461    ttgat 465
              |||||
Sbjct: 164464 ttgat 164460



to top

>emb|AL035522.1|ATT12J5 Arabidopsis thaliana DNA chromosome 4, BAC clone  T12J5 (ESSAII
             project)
          Length = 84499

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                         
Query: 401   tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccggg 460
             ||||||||||| |||||||||||||||||||| || ||||| || ||||| || || |||
Sbjct: 34602 tggtcatcccacgccttctcgttgttgtagataacagcagcaccaaagcttctagctggg 34543

                  
Query: 461   ttgat 465
             |||||
Sbjct: 34542 ttgat 34538



to top

>emb|AL022023.1|ATM4E13 Arabidopsis thaliana DNA chromosome 4, BAC clone M4E13 (ESSAII project)
          Length = 80346

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                         
Query: 401   tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccggg 460
             ||||||||||| |||||||||||||||||||| || ||||| || ||||| || || |||
Sbjct: 65557 tggtcatcccacgccttctcgttgttgtagataacagcagcaccaaagcttctagctggg 65498

                  
Query: 461   ttgat 465
             |||||
Sbjct: 65497 ttgat 65493



to top

>dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1223

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 84/101 (83%)
 Strand = Plus / Minus

                                                                       
Query: 368 gccccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttg 427
           ||||| ||||| || || |||||||| |||||||||||||||||||| | |   ||||||
Sbjct: 892 gccccaatgaacggtccaacccagaatatccagtggtcatcccaggcatgccgcttgttg 833

                                                    
Query: 428 tagatcacggcagctccgaagctcctcgccgggttgatgcc 468
           ||||| | |||||| ||||  ||||| || |||||||||||
Sbjct: 832 tagatgatggcagcgccgagactcctggctgggttgatgcc 792



to top

>gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, complete cds
          Length = 1192

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           ||||| || ||||| || ||||||||||||||    ||||||||||| || |||||||||
Sbjct: 813 acccaaaatatccattgatcatcccaggccttagaattgttgtagataaccgcagctccg 754

                                        
Query: 446 aagctcctcgccgggttgatgccggtgcc 474
           ||||| || || |||||||| ||||||||
Sbjct: 753 aagcttctagcggggttgattccggtgcc 725



to top

>gb|AF118383.1|AF118383 Brassica napus plasma membrane intrinsic protein 2 (PIP2) mRNA,
           complete cds
          Length = 1026

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 433
           |||||||| || |||||||| ||||||||||||||||| | |||    | ||||||||| 
Sbjct: 789 atgaatggtccaacccagaatatccagtggtcatcccacggcttggactcgttgtagata 730

                                        
Query: 434 acggcagctccgaagctcctcgccgggtt 462
           || ||||||||||| ||||| ||||||||
Sbjct: 729 accgcagctccgaaactccttgccgggtt 701



to top

>dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membrane intrinsic protein
           2-1, complete cds
          Length = 1311

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 102/125 (81%)
 Strand = Plus / Minus

                                                                       
Query: 344 tggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtgg 403
           |||||||| ||||| || ||||| || || ||||| || || | |||||| ||||| |||
Sbjct: 856 tggtggtagaaggcagcaatggcagctccaatgaaaggtccaagccagaagatccattgg 797

                                                                       
Query: 404 tcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggttg 463
           |||||||| || || || ||||| ||||| || |||||||| || ||||| || ||||||
Sbjct: 796 tcatcccaagctttgtccttgttatagatgacagcagctcctaaactcctagcagggttg 737

                
Query: 464 atgcc 468
           |||||
Sbjct: 736 atgcc 732



to top

>gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1086

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 433
           |||||||| || |||||||| ||||||||||||||||| ||||  || ||||||||||| 
Sbjct: 827 atgaatggtccaacccagaaaatccagtggtcatcccatgcctcgtctttgttgtagatg 768

                                           
Query: 434 acggcagctccgaagctcctcgccgggttgat 465
           |  |||||||| |  ||||| || ||||||||
Sbjct: 767 atagcagctccaagactcctggcagggttgat 736



to top

>ref|XM_519026.1| PREDICTED: Pan troglodytes aquaporin 1 (LOC463330), mRNA
          Length = 1185

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                                
Query: 369  ccccgatgaatggccccacccagaacatccagtggt 404
            ||||||||||||||||||||||||| ||||||||||
Sbjct: 1033 ccccgatgaatggccccacccagaaaatccagtggt 998



to top

>ref|NM_198098.1| Homo sapiens aquaporin 1 (Colton blood group) (AQP1), mRNA
          Length = 2764

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 369 ccccgatgaatggccccacccagaacatccagtggt 404
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 715 ccccgatgaatggccccacccagaaaatccagtggt 680



to top

>gb|AY312581.1| Homo sapiens aquaporin 1 splice variant 3 (AQP1) mRNA, partial cds,
           alternatively spliced
          Length = 334

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 369 ccccgatgaatggccccacccagaacatccagtggt 404
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 95  ccccgatgaatggccccacccagaaaatccagtggt 60



to top

>gb|AY312580.1| Homo sapiens aquaporin 1 splice variant 2 (AQP1) mRNA, partial cds,
           alternatively spliced
          Length = 472

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 369 ccccgatgaatggccccacccagaacatccagtggt 404
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 95  ccccgatgaatggccccacccagaaaatccagtggt 60



to top

>gb|BC022486.1| Homo sapiens aquaporin 1 (Colton blood group), mRNA (cDNA clone
           MGC:26324 IMAGE:4799283), complete cds
          Length = 2764

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 369 ccccgatgaatggccccacccagaacatccagtggt 404
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 715 ccccgatgaatggccccacccagaaaatccagtggt 680



to top

>emb|CR859936.1| Pongo pygmaeus mRNA; cDNA DKFZp469G0320 (from clone DKFZp469G0320)
          Length = 2784

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 369 ccccgatgaatggccccacccagaacatccagtggt 404
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 715 ccccgatgaatggccccacccagaaaatccagtggt 680



to top

>emb|CR617260.1| full-length cDNA clone CS0DI057YC23 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 2469

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 369 ccccgatgaatggccccacccagaacatccagtggt 404
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 704 ccccgatgaatggccccacccagaaaatccagtggt 669



to top

>gb|AF480415.1| Homo sapiens aquaporin 1 (AQP1) gene, partial cds
          Length = 810

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 369 ccccgatgaatggccccacccagaacatccagtggt 404
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 646 ccccgatgaatggccccacccagaaaatccagtggt 611



to top

>gb|U41518.1|HSU41518 Human channel-like integral membrane protein (AQP-1) mRNA, clone
           AQP-1-2344, partial cds
          Length = 2344

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 369 ccccgatgaatggccccacccagaacatccagtggt 404
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 309 ccccgatgaatggccccacccagaaaatccagtggt 274



to top

>gb|S73482.1| uterine water channel=28 kda erythrocyte integral membrane protein
           homolog [human, uterus, mRNA, 1340 nt]
          Length = 1340

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 369 ccccgatgaatggccccacccagaacatccagtggt 404
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 696 ccccgatgaatggccccacccagaaaatccagtggt 661



to top

>gb|AY034596.1| Macaca radiata aquaporin 1 mRNA, partial cds
          Length = 459

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 369 ccccgatgaatggccccacccagaacatccagtggt 404
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 362 ccccgatgaatggccccacccagaaaatccagtggt 327



to top

>gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein ZmPIP2-6 mRNA, complete
           cds
          Length = 1257

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 86/104 (82%)
 Strand = Plus / Minus

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           |||||||| || ||||||||||| ||||| |||||   |||||| ||   ||||||||| 
Sbjct: 872 ccgatgaacgggcccacccagaagatccactggtcgctccaggctttgctgttgttgtac 813

                                                       
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgcc 474
           |  ||||| || |||| |||||||||||||||||| ||||||||
Sbjct: 812 acgacggcggcgccgaggctcctcgccgggttgataccggtgcc 769



to top

>gb|AY170841.1| Axonopus compressus plasma membrane MIP protein mRNA, partial cds
          Length = 423

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 107/132 (81%)
 Strand = Plus / Minus

                                                                       
Query: 343 ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtg 402
           ||||||||| | |||||| | ||| || || ||||| || || |||||||| ||||| ||
Sbjct: 384 ctggtggtagatggcggctagggcagcgccaatgaaggggccgacccagaagatccaatg 325

                                                                       
Query: 403 gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggtt 462
           ||||| |||||| | |||  |||||||||| | |||||| || | |||||| || |||||
Sbjct: 324 gtcattccaggcgtgctccctgttgtagatgatggcagcgccaaggctcctagctgggtt 265

                       
Query: 463 gatgccggtgcc 474
           |||||| |||||
Sbjct: 264 gatgccagtgcc 253



to top

>gb|U41517.1|HSU41517 Human channel-like integral membrane protein (AQP-1) mRNA, clone
           AQP-1-1656, complete cds
          Length = 1657

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 369 ccccgatgaatggccccacccagaacatccagtggt 404
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 691 ccccgatgaatggccccacccagaaaatccagtggt 656



to top

>gb|M77829.1|HUMCHIP28A Human channel-like integral membrane protein (CHIP28) mRNA,
           complete cds
          Length = 1340

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 369 ccccgatgaatggccccacccagaacatccagtggt 404
           ||||||||||||||||||||||||| ||||||||||
Sbjct: 696 ccccgatgaatggccccacccagaaaatccagtggt 661



to top

>gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, complete cds
          Length = 1278

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 340 gtactggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatcca 399
           ||||||||| || || || || || ||||| || ||||| || || |||||||| |||||
Sbjct: 935 gtactggtgatagaatgcagctattgcggcaccaatgaagggtccgacccagaaaatcca 876

                                                              
Query: 400 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagct 450
            ||||||||||| ||||| || |||   |||||||| ||||||||||||||
Sbjct: 875 ttggtcatcccatgccttatccttgccatagatcacagcagctccgaagct 825



to top

>gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map CIC10A06, complete
             sequence
          Length = 96827

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                         
Query: 404   tcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggttg 463
             |||||||| ||||| |  ||||||||||| ||||||||||| || ||||| |||||||| 
Sbjct: 65642 tcatcccaagccttttgattgttgtagatgacggcagctccaaaactcctagccgggttt 65583

                        
Query: 464   atgccggtgcc 474
             || ||||||||
Sbjct: 65582 attccggtgcc 65572



to top

>dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane intrinsic protein
           2;4, complete cds
          Length = 1263

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 106/131 (80%)
 Strand = Plus / Minus

                                                                       
Query: 344 tggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtgg 403
           |||||||| | ||| || ||||| || || ||||| || |||||||| || |||||||||
Sbjct: 837 tggtggtaaatggcagctatggcagcaccaatgaaaggtcccacccaaaagatccagtgg 778

                                                                       
Query: 404 tcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggttg 463
           |||||||| ||||     |||||||| || || ||||| || |||||||| |||||||||
Sbjct: 777 tcatcccatgcctcaaaattgttgtacatgactgcagccccaaagctcctggccgggttg 718

                      
Query: 464 atgccggtgcc 474
           || || |||||
Sbjct: 717 ataccagtgcc 707



to top

>gb|AF118382.1|AF118382 Brassica napus plasma membrane intrinsic protein 1 (PIP1) mRNA,
           complete cds
          Length = 1093

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 78/91 (85%), Gaps = 2/91 (2%)
 Strand = Plus / Minus

                                                                       
Query: 376 gaatggccccacccagaacatccagtggtcatccca-ggccttctcgttgttgtagatca 434
           |||||| |||||||| || ||||||||||||||||| ||| | ||| | |||| |||| |
Sbjct: 778 gaatggtcccacccaaaatatccagtggtcatcccatggcttgctc-tcgttgaagataa 720

                                          
Query: 435 cggcagctccgaagctcctcgccgggttgat 465
           |||| |||||||| ||||| |||||||||||
Sbjct: 719 cggctgctccgaaactccttgccgggttgat 689



to top

>emb|AL132966.1|ATF4P12 Arabidopsis thaliana DNA chromosome 3, BAC clone F4P12
          Length = 144628

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                    
Query: 422   ttgttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
             ||||||||||| |||||||||||||| ||||| |||||||| || ||||| ||||
Sbjct: 44808 ttgttgtagattacggcagctccgaaactccttgccgggttaattccggttccgg 44862



to top

>dbj|AB012045.1| Raphanus sativus mRNA for Plasma membrane aquaporin (PAQ2),
           complete cds
          Length = 1126

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 75/87 (86%), Gaps = 2/87 (2%)
 Strand = Plus / Minus

                                                                       
Query: 377 aatggccccacccagaacatccagtggtcatcccaggcctt-ctcgttgttgtagatcac 435
           ||||| |||||||| || ||||||||||||||||||| ||| ||| | |||| |||| ||
Sbjct: 813 aatggtcccacccaaaatatccagtggtcatcccagggcttgctc-tcgttgaagatgac 755

                                      
Query: 436 ggcagctccgaagctcctcgccgggtt 462
           ||| |||||||| ||||| ||||||||
Sbjct: 754 ggctgctccgaaactccttgccgggtt 728



to top

>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence
          Length = 698

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 87/106 (82%)
 Strand = Plus / Minus

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           |||||||| || || |||||||| |||||||||||| ||||||| |  |  | |||||| 
Sbjct: 369 ccgatgaaggggccgacccagaagatccagtggtcagcccaggcatggtgctggttgtaa 310

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           || ||||| || || | ||||| ||| |||||||||||||||||||
Sbjct: 309 attacggcggcgccaaggctccgcgcggggttgatgccggtgccgg 264



to top

>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 87/106 (82%)
 Strand = Plus / Minus

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           |||||||| || || |||||||| |||||||||||| ||||||| |  |  | |||||| 
Sbjct: 800 ccgatgaaggggccgacccagaagatccagtggtcagcccaggcatggtgctggttgtaa 741

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           || ||||| || || | ||||| ||| |||||||||||||||||||
Sbjct: 740 attacggcggcgccaaggctccgcgcggggttgatgccggtgccgg 695



to top

>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 87/106 (82%)
 Strand = Plus / Minus

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           |||||||| || || |||||||| |||||||||||| ||||||| |  |  | |||||| 
Sbjct: 857 ccgatgaaggggccgacccagaagatccagtggtcagcccaggcatggtgctggttgtaa 798

                                                         
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           || ||||| || || | ||||| ||| |||||||||||||||||||
Sbjct: 797 attacggcggcgccaaggctccgcgcggggttgatgccggtgccgg 752



to top

>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                   
Query: 423   tgttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
             |||||||||| | |||||| || | ||||||||| |||||||||||||||||||
Sbjct: 28000 tgttgtagatgatggcagcgccaaggctcctcgctgggttgatgccggtgccgg 27947



to top

>dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane intrinsic protein
           2;5, complete cds
          Length = 1126

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                       
Query: 377 aatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacg 436
           ||||||||||||||||| ||||| ||||||||||| |||||  | |||||||| || || 
Sbjct: 795 aatggccccacccagaagatccaatggtcatcccaagccttgccattgttgtaaataaca 736

                                     
Query: 437 gcagctccgaagctcctcgccgggtt 462
           || || || || ||||| ||||||||
Sbjct: 735 gccgcaccaaaactcctagccgggtt 710



to top

>emb|AJ605568.1| Ricinus communis partial mRNA for putative aquaporin (Pip2-3 gene),
           clone pR450-4
          Length = 452

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 401 tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccggg 460
           ||||||||||||||||| || | |||||| || || |||||||| || ||||| || |||
Sbjct: 431 tggtcatcccaggccttgtcctggttgtaaataacagcagctcctaaactccttgctggg 372

                         
Query: 461 ttgatgccggtgcc 474
           |||||||| |||||
Sbjct: 371 ttgatgccagtgcc 358



to top

>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1260

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 368 gccccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttg 427
           ||||| ||||| || || |||||||| |||||||||||||||||||| | ||  ||||||
Sbjct: 896 gccccaatgaacggtccaacccagaatatccagtggtcatcccaggcatgcttcttgttg 837

                         
Query: 428 tagatcacggcagc 441
           ||||| | ||||||
Sbjct: 836 tagatgatggcagc 823



to top

>dbj|AB002149.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1064

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 433
           |||||||| || |||||||| |||||||| |||||||| ||||  |||| |||| |||| 
Sbjct: 827 atgaatggtccaacccagaagatccagtgatcatcccatgcctggtcgtggttgaagatg 768

                                                 
Query: 434 acggcagctccgaagctcctcgccgggttgatgccggt 471
           |  |||||||| | |||||  || ||||||||||||||
Sbjct: 767 atagcagctccaaggctccgggcggggttgatgccggt 730



to top

>gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (pip1) mRNA,
           complete cds
          Length = 1152

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 368 gccccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttg 427
           ||||| ||||| || || |||||||| |||||||| |||||||| ||||| || ||||||
Sbjct: 817 gccccaatgaacggtccaacccagaatatccagtgatcatcccatgccttgtctttgttg 758

                
Query: 428 tagat 432
           |||||
Sbjct: 757 tagat 753



to top

>ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative aquaporin
           (OSJNBa0093B11.9), mRNA
          Length = 729

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 424 gttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           ||||||||  ||||| || ||||||||||||||||| |||||||| |||||||
Sbjct: 588 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccgg 536



to top

>gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mRNA, partial cds
          Length = 502

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                       
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 430
           |||||||||||||| |||||||| ||||| ||||||||||| || |      ||||||||
Sbjct: 122 ccgatgaatggcccaacccagaaaatccaatggtcatcccatgcatgacttctgttgtag 63

                                                    
Query: 431 atcacggcagctccgaagctcctcgccgggttgatgccggt 471
           || |  |||||||||| |||||  || ||||||||||||||
Sbjct: 62  atgatagcagctccgaggctccgagcagggttgatgccggt 22



to top

>gb|AY189973.1| Juglans regia plasma intrinsic protein 2,1 mRNA, complete cds
          Length = 1278

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 433
           |||||||| || |||||||| ||||| ||||||| ||| ||||| || |||  |||||| 
Sbjct: 850 atgaatggtccaacccagaaaatccattggtcattccatgccttgtccttgccgtagatg 791

                            
Query: 434 acggcagctccgaagct 450
           || ||||||||||||||
Sbjct: 790 acagcagctccgaagct 774



to top

>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggc 414
           |||||||| || |||||||| ||||||||||||||||||||
Sbjct: 782 atgaatggtccaacccagaagatccagtggtcatcccaggc 742



to top

>gb|AF367457.1| Prunus persica clone Mip1 membrane intrinsic protein (mip1) mRNA,
           partial cds
          Length = 495

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                       
Query: 397 ccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgc 456
           |||||||||||||||||| || ||||||||| | ||||| ||||  || |||||||| ||
Sbjct: 495 ccagtggtcatcccaggctttttcgttgttgaaaatcacagcaggaccaaagctccttgc 436

                    
Query: 457 cgggttgat 465
            ||||||||
Sbjct: 435 tgggttgat 427



to top

>gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 genomic sequence, complete
             sequence
          Length = 178692

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                  
Query: 424   gttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
             ||||||||  ||||| || ||||||||||||||||| |||||||| |||||||
Sbjct: 47653 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccgg 47705



to top

>gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds
          Length = 534

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                       
Query: 344 tggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtgg 403
           ||||||||||| || ||||  || || |||||||| || ||||||||||| ||||| || 
Sbjct: 500 tggtggtacaaagctgcgagagctgcaccgatgaagggtcccacccagaatatccaatgt 441

                                        
Query: 404 tcatcccaggccttctcgttgttgtagat 432
           ||||||||||| |  || |||||||||||
Sbjct: 440 tcatcccaggcttgatccttgttgtagat 412



to top

>gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, complete cds
          Length = 867

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                       
Query: 344 tggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtgg 403
           ||||||||||| || ||||  || || |||||||| || ||||||||||| ||||| || 
Sbjct: 830 tggtggtacaaagctgcgagagctgcaccgatgaagggtcccacccagaatatccaatgt 771

                                        
Query: 404 tcatcccaggccttctcgttgttgtagat 432
           ||||||||||| |  || |||||||||||
Sbjct: 770 tcatcccaggcttgatccttgttgtagat 742



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                     
Query: 424      gttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
                ||||||||  ||||| || ||||||||||||||||| |||||||| |||||||
Sbjct: 17626978 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccgg 17626926



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                     
Query: 424      gttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
                |||||| | |||||| || |||| ||||||||||||||||||||| |||||||
Sbjct: 21009498 gttgtacagcacggcggcgccgaggctcctcgccgggttgatgcccgtgccgg 21009446



to top

>dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:B1274F11
          Length = 171257

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                   
Query: 424    gttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
              |||||| | |||||| || |||| ||||||||||||||||||||| |||||||
Sbjct: 101587 gttgtacagcacggcggcgccgaggctcctcgccgggttgatgcccgtgccgg 101535



to top

>emb|AJ605575.1| Ricinus communis mRNA for aquaporin (Pip2-1 gene), clone pP5L
          Length = 1157

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           |||||||| ||||| |||||||||||  | || || ||||||||||| || |||||||| 
Sbjct: 819 acccagaaaatccaatggtcatcccacactttgtcattgttgtagatgacagcagctcca 760

                            
Query: 446 aagctcctcgccgggtt 462
           |||||||| || |||||
Sbjct: 759 aagctcctggctgggtt 743



to top

>dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-H08, full
           insert sequence
          Length = 1247

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 80/97 (82%)
 Strand = Plus / Minus

                                                                       
Query: 380 ggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggca 439
           |||||||||||||| ||||||||||| | ||| ||    |  | |||||| | |||||| 
Sbjct: 804 ggccccacccagaagatccagtggtctttccaagctgcgtgctggttgtacagcacggcg 745

                                                
Query: 440 gctccgaagctcctcgccgggttgatgccggtgccgg 476
           || |||| ||||||||||||||||||||| |||||||
Sbjct: 744 gcgccgaggctcctcgccgggttgatgcccgtgccgg 708



to top

>dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-G06, full
           insert sequence
          Length = 1066

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 424 gttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           |||||| | |||||| || |||| ||||||||||||||||||||| |||||||
Sbjct: 658 gttgtacagcacggcggcgccgaggctcctcgccgggttgatgcccgtgccgg 606



to top

>dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-C02, full
           insert sequence
          Length = 1232

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 424 gttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           ||||||||  ||||| || ||||||||||||||||| |||||||| |||||||
Sbjct: 770 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccgg 718



to top

>dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D11, full
           insert sequence
          Length = 1249

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 80/97 (82%)
 Strand = Plus / Minus

                                                                       
Query: 380 ggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggca 439
           |||||||||||||| ||||||||||| | ||| ||    |  | |||||| | |||||| 
Sbjct: 802 ggccccacccagaagatccagtggtctttccaagctgcgtgctggttgtacagcacggcg 743

                                                
Query: 440 gctccgaagctcctcgccgggttgatgccggtgccgg 476
           || |||| ||||||||||||||||||||| |||||||
Sbjct: 742 gcgccgaggctcctcgccgggttgatgcccgtgccgg 706



to top

>dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013118N06, full
           insert sequence
          Length = 1302

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 80/97 (82%)
 Strand = Plus / Minus

                                                                       
Query: 380 ggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggca 439
           |||||||||||||| ||||||||||| | ||| ||    |  | |||||| | |||||| 
Sbjct: 797 ggccccacccagaagatccagtggtctttccaagctgcgtgctggttgtacagcacggcg 738

                                                
Query: 440 gctccgaagctcctcgccgggttgatgccggtgccgg 476
           || |||| ||||||||||||||||||||| |||||||
Sbjct: 737 gcgccgaggctcctcgccgggttgatgcccgtgccgg 701



to top

>dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone: P0478E02
          Length = 140715

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                  
Query: 424   gttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
             |||||| | |||||| || |||| ||||||||||||||||||||| |||||||
Sbjct: 30798 gttgtacagcacggcggcgccgaggctcctcgccgggttgatgcccgtgccgg 30746



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                     
Query: 424      gttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
                ||||||||  ||||| || ||||||||||||||||| |||||||| |||||||
Sbjct: 17636018 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccgg 17635966



to top

>dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membrane intrinsic protein
            1-1, complete cds
          Length = 1351

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                        
Query: 368  gccccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttg 427
            ||||| ||||| || || |||||||| | |||||||||||||||||| | ||  ||||||
Sbjct: 1033 gccccaatgaacggtccaacccagaaaacccagtggtcatcccaggcatgctgcttgttg 974

                                                     
Query: 428  tagatcacggcagctccgaagctcctcgccgggttgatgcc 468
            ||||| | |||||| || |  ||||| || |||||||||||
Sbjct: 973  tagatgatggcagcgccaagactcctggctgggttgatgcc 933



to top

>gb|AY856055.1| Notomys alexis aquaporin 1 mRNA, partial cds
          Length = 654

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 369 ccccgatgaatggccccacccagaacatccagtggt 404
           |||| |||||||||||||||||||| ||||||||||
Sbjct: 541 ccccaatgaatggccccacccagaaaatccagtggt 506



to top

>gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1153

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 433
           |||||||| || |||||||| ||||||||||||| ||| ||||  || ||||||||||| 
Sbjct: 837 atgaatggtccaacccagaagatccagtggtcattccatgcctcgtctttgttgtagatg 778

                                           
Query: 434 acggcagctccgaagctcctcgccgggttgat 465
           |  |||||||| |  ||||| || ||||||||
Sbjct: 777 atagcagctccaagactcctggcagggttgat 746



to top

>ref|NM_001009194.1| Ovis aries aquaporin 1 (AQP1), mRNA
          Length = 823

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 371 ccgatgaatggccccacccagaacatccagtggtc 405
           |||||||| |||||||||||||| |||||||||||
Sbjct: 669 ccgatgaacggccccacccagaagatccagtggtc 635



to top

>gb|BT025412.1| Bos taurus aquaporin 1 (Colton blood group) (AQP1), mRNA, complete
           cds
          Length = 2695

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 371 ccgatgaatggccccacccagaacatccagtggtc 405
           |||||||| |||||||||||||| |||||||||||
Sbjct: 704 ccgatgaacggccccacccagaagatccagtggtc 670



to top

>gb|BT014251.1| Lycopersicon esculentum clone 133453R, mRNA sequence
          Length = 1084

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcct 416
           |||||||| || |||||||| ||||||||||||||||| ||||
Sbjct: 831 atgaatggtccaacccagaaaatccagtggtcatcccatgcct 789



to top

>gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence
          Length = 1159

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           |||||||| ||||||||||||| ||| || | ||||| ||||||||| |  |||||||| 
Sbjct: 854 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 795

                                  
Query: 446 aagctcctcgccgggttgatgcc 468
           |  ||||| || |||||||||||
Sbjct: 794 agactcctggcggggttgatgcc 772



to top

>gb|AY496102.1| Capsicum annuum Vip2 protein mRNA, complete cds
          Length = 358

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 78/95 (82%)
 Strand = Plus / Minus

                                                                       
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatc 433
           |||||||| || |||||||| ||||||||||||||||| ||    ||| |||||||||| 
Sbjct: 103 atgaatggtccaacccagaagatccagtggtcatcccatgctgcatcggtgttgtagatg 44

                                              
Query: 434 acggcagctccgaagctcctcgccgggttgatgcc 468
           |  |||||||| |  ||||| || |||||||||||
Sbjct: 43  atagcagctcctagactcctggcggggttgatgcc 9



to top

>emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic protein 1
          Length = 1108

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggcct 416
           |||||||| || |||||||| ||||||||||||||||| ||||
Sbjct: 875 atgaatggtccaacccagaagatccagtggtcatcccatgcct 833



to top

>emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening membrane protein, clone
           pNY507
          Length = 1107

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           |||||||| ||||||||||||| ||| || | ||||| ||||||||| |  |||||||| 
Sbjct: 794 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 735

                                  
Query: 446 aagctcctcgccgggttgatgcc 468
           |  ||||| || |||||||||||
Sbjct: 734 agactcctggcggggttgatgcc 712



to top

>emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening membrane protein, clone
           pTOM75
          Length = 859

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           |||||||| ||||||||||||| ||| || | ||||| ||||||||| |  |||||||| 
Sbjct: 605 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 546

                                  
Query: 446 aagctcctcgccgggttgatgcc 468
           |  ||||| || |||||||||||
Sbjct: 545 agactcctggcggggttgatgcc 523



to top

>emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.4 gene)
          Length = 1135

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           |||||||| ||||||||||  ||||||||||| || | ||||||||| || || ||||| 
Sbjct: 771 acccagaagatccagtggtggtcccaggccttgtcttggttgtagataacagcggctccc 712

                                  
Query: 446 aagctcctcgccgggttgatgcc 468
           |  ||||| || |||||||||||
Sbjct: 711 agactcctagcagggttgatgcc 689



to top

>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           |||||||| ||||| ||||||| |||||| |  || ||||||||||| | |||||| || 
Sbjct: 812 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 753

                                  
Query: 446 aagctcctcgccgggttgatgcc 468
           | |||||| || |||||||||||
Sbjct: 752 aggctcctggctgggttgatgcc 730



to top

>ref|NM_174702.3| Bos taurus aquaporin 1 (Aqp1), mRNA
          Length = 2703

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 371 ccgatgaatggccccacccagaacatccagtggtc 405
           |||||||| |||||||||||||| |||||||||||
Sbjct: 678 ccgatgaacggccccacccagaagatccagtggtc 644



to top

>gb|AF452014.1|AF452014 Petunia x hybrida aquaporin-like protein (PIP2;3) mRNA, complete
           cds
          Length = 1279

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 93/115 (80%)
 Strand = Plus / Minus

                                                                       
Query: 362 atggcggccccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcg 421
           ||||| ||||| ||||| || || ||||| || ||||| ||||| | ||| || || || 
Sbjct: 821 atggctgccccaatgaaaggtcctacccaaaagatccaatggtctttccaagctttgtct 762

                                                                  
Query: 422 ttgttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtgccgg 476
           | |||| |||| ||||||||||| |  ||||| || |||||||||||||||||||
Sbjct: 761 tggttgaagataacggcagctccaagactccttgctgggttgatgccggtgccgg 707



to top

>gb|AF009037.1|AF009037 Ovis aries aquaporin 1 (aqp1) mRNA, complete cds
          Length = 823

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 371 ccgatgaatggccccacccagaacatccagtggtc 405
           |||||||| |||||||||||||| |||||||||||
Sbjct: 669 ccgatgaacggccccacccagaagatccagtggtc 635



to top

>gb|BC105525.1| Bos taurus aquaporin 1, mRNA (cDNA clone MGC:129064 IMAGE:8121557),
           complete cds
          Length = 2703

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 371 ccgatgaatggccccacccagaacatccagtggtc 405
           |||||||| |||||||||||||| |||||||||||
Sbjct: 678 ccgatgaacggccccacccagaagatccagtggtc 644



to top

>gb|S74759.1|S74759S1 water channel protein CHIP29 [cattle, ocular ciliary epithelium,
           mRNA, 1211 nt, segment 1 of 2]
          Length = 1211

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 371 ccgatgaatggccccacccagaacatccagtggtc 405
           |||||||| |||||||||||||| |||||||||||
Sbjct: 694 ccgatgaacggccccacccagaagatccagtggtc 660



to top

>gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds
          Length = 740

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 102/127 (80%)
 Strand = Plus / Minus

                                                                       
Query: 342 actggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagt 401
           |||||||||| ||||| || ||||  || || ||||| || ||| ||||||| ||||| |
Sbjct: 526 actggtggtagaaggccgcaatgggtgctccaatgaacggtcccccccagaaaatccact 467

                                                                       
Query: 402 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggt 461
           | |||||||| | ||| |  |||||||||||||| || ||||| ||||| |  |||||||
Sbjct: 466 gatcatcccatgtcttttttttgttgtagatcacagcggctcccaagctacgggccgggt 407

                  
Query: 462 tgatgcc 468
           | |||||
Sbjct: 406 taatgcc 400



to top

>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           |||||||| ||||| ||||||| |||||| |  || ||||||||||| | |||||| || 
Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786

                                  
Query: 446 aagctcctcgccgggttgatgcc 468
           | |||||| || |||||||||||
Sbjct: 785 aggctcctggctgggttgatgcc 763



to top

>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           |||||||| ||||| ||||||| |||||| |  || ||||||||||| | |||||| || 
Sbjct: 900 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 841

                                  
Query: 446 aagctcctcgccgggttgatgcc 468
           | |||||| || |||||||||||
Sbjct: 840 aggctcctggctgggttgatgcc 818



to top

>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           |||||||| ||||| ||||||| |||||| |  || ||||||||||| | |||||| || 
Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786

                                  
Query: 446 aagctcctcgccgggttgatgcc 468
           | |||||| || |||||||||||
Sbjct: 785 aggctcctggctgggttgatgcc 763



to top

>gb|AF028005.1|AF028005 Bos taurus water channel protein CHIP29 mRNA, complete cds
          Length = 826

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 371 ccgatgaatggccccacccagaacatccagtggtc 405
           |||||||| |||||||||||||| |||||||||||
Sbjct: 672 ccgatgaacggccccacccagaagatccagtggtc 638



to top

>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1140

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           |||||||| ||||| ||||||| |||||| |  || ||||||||||| | |||||| || 
Sbjct: 840 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 781

                                  
Query: 446 aagctcctcgccgggttgatgcc 468
           | |||||| || |||||||||||
Sbjct: 780 aggctcctggctgggttgatgcc 758



to top

>gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel protein-like mRNA,
           complete cds
          Length = 1172

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagat 432
           |||||||| || |||||||| ||||||||||||| ||| ||||  || |||||||||||
Sbjct: 827 atgaatggtccaacccagaagatccagtggtcattccatgcctcgtctttgttgtagat 769



to top

>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           |||||||| ||||| ||||||| |||||| |  || ||||||||||| | |||||| || 
Sbjct: 843 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 784

                                  
Query: 446 aagctcctcgccgggttgatgcc 468
           | |||||| || |||||||||||
Sbjct: 783 aggctcctggctgggttgatgcc 761



to top

>gb|AF452012.1|AF452012 Petunia x hybrida aquaporin-like protein (PIP2;1) mRNA, complete
           cds
          Length = 1168

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 71/86 (82%)
 Strand = Plus / Minus

                                                                       
Query: 377 aatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacg 436
           ||||| || ||||| || ||||| |||||||||||| | || || |||||||| || || 
Sbjct: 797 aatggtccaacccaaaagatccaatggtcatcccagactttgtcattgttgtaaatgaca 738

                                     
Query: 437 gcagctccgaagctcctcgccgggtt 462
           |||||||| |||||||| || |||||
Sbjct: 737 gcagctccaaagctcctagcagggtt 712



to top

>gb|AY059380.1| Medicago truncatula aquaporin (PIP2-1) mRNA, complete cds
          Length = 973

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 395 atccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctc 454
           ||||| || ||||||||||| |||||||| ||| |||| ||||| | |||||| ||||| 
Sbjct: 775 atccactgatcatcccaggctttctcgttattgaagataacggctggtccgaaactccta 716

                         
Query: 455 gccgggttgatgcc 468
           || ||||| |||||
Sbjct: 715 gcggggttaatgcc 702



to top

>gb|AC148995.2| Medicago truncatula chromosome 7 BAC clone mth2-49l23, complete
             sequence
          Length = 128239

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 401   tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagct 450
             ||||||||||| || ||||| |||||||| ||||| |||||||| |||||
Sbjct: 91309 tggtcatcccatgctttctcattgttgtaaatcacagcagctccaaagct 91260



to top

>gb|AF154641.1| Nicotiana tabacum clone PR16 mRNA sequence
          Length = 1100

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                       
Query: 342 actggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagt 401
           |||||||||| | |||||||  |  ||| |||||||| || ||||||||||| |||||||
Sbjct: 851 actggtggtagacggcggcggcgaaggctccgatgaagggacccacccagaaaatccagt 792

                     
Query: 402 ggtcatccca 411
           | ||||||||
Sbjct: 791 gttcatccca 782



to top

>gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1a) mRNA, complete cds
          Length = 1129

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 107/134 (79%)
 Strand = Plus / Minus

                                                                       
Query: 343 ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtg 402
           ||||||||||||||| || |  || || || ||||| || ||||||||||| |||||   
Sbjct: 876 ctggtggtacaaggcagcaagagcagctccaatgaagggtcccacccagaaaatccacat 817

                                                                       
Query: 403 gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggtt 462
           |||||||||||| | |||  |||||||||| | ||| || || |  ||||| || |||||
Sbjct: 816 gtcatcccaggcatgctctctgttgtagatgatggcggcccccagactcctagcagggtt 757

                         
Query: 463 gatgccggtgccgg 476
           ||||||||| ||||
Sbjct: 756 gatgccggttccgg 743



to top

>gb|U97023.1|PVU97023 Phaseolus vulgaris putative aquaporin-1 (Mip-1) mRNA, complete cds
          Length = 1213

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 371 ccgatgaatggccccacccagaacatccagtggtcatcccag 412
           ||||||||||| ||||||||||| |||||||| || ||||||
Sbjct: 837 ccgatgaatggtcccacccagaagatccagtgatcgtcccag 796



to top

>gb|U18403.1|ACU18403 Atriplex canescens aquaporin mRNA, complete cds
          Length = 1029

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 71/86 (82%)
 Strand = Plus / Minus

                                                                       
Query: 377 aatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacg 436
           ||||| || |||||||| |||||||||||||||||| |  |||  ||||||||||| || 
Sbjct: 873 aatggtccgacccagaatatccagtggtcatcccagactctcttcttgttgtagataaca 814

                                     
Query: 437 gcagctccgaagctcctcgccgggtt 462
           ||||| || || ||||| || |||||
Sbjct: 813 gcagcaccaaaactcctagcagggtt 788



to top

>ref|NM_116008.2| Arabidopsis thaliana PIP1A; water channel AT3G61430 (PIP1A) mRNA,
           complete cds
          Length = 1254

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           ||||| |||| |||||||||||||||||  |  || ||||||||||| |  |||||||| 
Sbjct: 962 acccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgcagctcca 903

                                        
Query: 446 aagctcctcgccgggttgatgccggtgcc 474
           | ||| || || ||||||||||| |||||
Sbjct: 902 aggcttctagctgggttgatgcctgtgcc 874



to top

>ref|NM_001003130.1| Canis familiaris aquaporin 1 (Colton blood group) (AQP1), mRNA
          Length = 945

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 369 ccccgatgaatggccccacccagaacatccagtggtc 405
           |||||||||| ||||| |||||||| |||||||||||
Sbjct: 695 ccccgatgaacggcccgacccagaaaatccagtggtc 659



to top

>gb|AC146187.2| Pan troglodytes BAC clone RP43-25A10 from 7, complete sequence
          Length = 156796

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 369   ccccgatgaatggccccacccagaa 393
             |||||||||||||||||||||||||
Sbjct: 53287 ccccgatgaatggccccacccagaa 53311



to top

>ref|XM_850474.1| PREDICTED: Canis familiaris aquaporin 1 (AQP1), mRNA
          Length = 945

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 369 ccccgatgaatggccccacccagaacatccagtggtc 405
           |||||||||| ||||| |||||||| |||||||||||
Sbjct: 695 ccccgatgaacggcccgacccagaaaatccagtggtc 659



to top

>gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic protein 1-like
           protein mRNA, partial cds
          Length = 474

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 374 atgaatggccccacccagaacatccagtggtcatcccaggc 414
           ||||| || |||||||| || ||||||||||||||||||||
Sbjct: 452 atgaaaggtcccacccaaaagatccagtggtcatcccaggc 412



to top

>emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0093G06,
             complete sequence
          Length = 127420

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                         
Query: 400   gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgg 459
             |||||| ||||| |||||||  | ||||||||| ||||| || |||| |||||  || ||
Sbjct: 91203 gtggtcgtcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagg 91262

                              
Query: 460   gttgatgccggtgccgg 476
             ||||||||| |||||||
Sbjct: 91263 gttgatgcccgtgccgg 91279



to top

>emb|AJ289701.1|VFA289701 Vicia faba mRNA for aquaporin (aq1 gene)
          Length = 995

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           ||||| |||| |||||||||||||||||  |  || ||||||||||| |  |||||||| 
Sbjct: 866 acccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgcagctcca 807

                                        
Query: 446 aagctcctcgccgggttgatgccggtgcc 474
           | ||| || || ||||||||||| |||||
Sbjct: 806 aggcttctagctgggttgatgcctgtgcc 778



to top

>gb|AY097398.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, complete cds
          Length = 861

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           ||||| |||| |||||||||||||||||  |  || ||||||||||| |  |||||||| 
Sbjct: 779 acccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgcagctcca 720

                                        
Query: 446 aagctcctcgccgggttgatgccggtgcc 474
           | ||| || || ||||||||||| |||||
Sbjct: 719 aggcttctagctgggttgatgcctgtgcc 691



to top

>gb|AY058113.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, complete cds
          Length = 1092

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 386 acccagaacatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 445
           ||||| |||| |||||||||||||||||  |  || ||||||||||| |  |||||||| 
Sbjct: 846 acccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgcagctcca 787

                                        
Query: 446 aagctcctcgccgggttgatgccggtgcc 474
           | ||| || || ||||||||||| |||||
Sbjct: 786 aggcttctagctgggttgatgcctgtgcc 758


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,561,721
Number of Sequences: 3902068
Number of extensions: 3561721
Number of successful extensions: 79516
Number of sequences better than 10.0: 388
Number of HSP's better than 10.0 without gapping: 384
Number of HSP's successfully gapped in prelim test: 5
Number of HSP's that attempted gapping in prelim test: 78565
Number of HSP's gapped (non-prelim): 898
length of query: 476
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 454
effective length of database: 17,147,199,772
effective search space: 7784828696488
effective search space used: 7784828696488
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top