ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart43e12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein 343 2e-91
2gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence 96 6e-17
3gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence 96 6e-17
4gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker 96 6e-17
5gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker 96 6e-17
6gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-... 96 6e-17
7emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein 96 6e-17
8gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein... 96 6e-17
9gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein... 96 6e-17
10gb|AY103580.1| Zea mays PCO072544 mRNA sequence 96 6e-17
11gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN... 88 1e-14
12emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for p... 80 4e-12
13emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet... 74 2e-10
14dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 74 2e-10
15dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D... 74 2e-10
16dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic D... 74 2e-10
17dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 2e-10
18dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 2e-10
19dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 2e-10
20gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ... 74 2e-10
21dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ... 74 2e-10
22ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic... 72 9e-10
23emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,... 72 9e-10
24dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 72 9e-10
25gb|AY170841.1| Axonopus compressus plasma membrane MIP protein m... 72 9e-10
26dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 9e-10
27dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 9e-10
28dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 9e-10
29dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 9e-10
30gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein ... 70 3e-09
31dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds 68 1e-08
32dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 64 2e-07
33gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putat... 54 2e-04
34gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma... 54 2e-04
35gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, c... 48 0.012
36gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mR... 46 0.049
37emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein 46 0.049
38emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative pl... 46 0.049
39emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp... 46 0.049
40gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds 46 0.049
41gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, co... 46 0.049
42dbj|AB002149.1| Nicotiana excelsior mRNA for water channel prote... 46 0.049
43gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 44 0.19
44emb|AJ699398.2| Chenopodium rubrum mRNA for aquaporin PIP1 (PIP1... 44 0.19
45emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intri... 42 0.77
46gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein... 42 0.77
47gb|AY107675.1| Zea mays PCO112712 mRNA sequence 42 0.77
48ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G4... 40 3.0
49gb|AF499725.1| Thellungiella halophila plasma membrane intrinsic... 40 3.0
50emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein 40 3.0
51emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel... 40 3.0
52emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel... 40 3.0
53gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (... 40 3.0
54emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A 40 3.0
55gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma m... 40 3.0
56gb|AC182472.3| Pan troglodytes BAC clone CH251-394C9 from chromo... 40 3.0
57gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 40 3.0
58gb|AC091691.7| Homo sapiens chromosome 18, clone RP11-47G4, comp... 40 3.0
59gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map... 40 3.0
60gb|AC016493.14| Homo sapiens chromosome 18, clone RP11-58G13, co... 40 3.0
61gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putat... 40 3.0
62gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putat... 40 3.0
63gb|AC023577.6| Homo sapiens chromosome 18, clone RP11-645D5, com... 40 3.0
64dbj|AK222086.1| Arabidopsis thaliana mRNA for aquaporin, partial... 40 3.0
65gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205),... 40 3.0
66gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, ... 40 3.0
67gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, ... 40 3.0
68emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Co... 40 3.0
69emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Co... 40 3.0
70emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Co... 40 3.0
71emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Co... 40 3.0
72gb|AC011500.7| Homo sapiens chromosome 19 clone CTB-60E11, compl... 40 3.0
73gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, comp... 40 3.0
74gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma... 40 3.0
75emb|AJ243257.1|SNA243257 Streptomyces natalensis plasmid pSNA1 i... 40 3.0
76emb|Z17399.1|ATORFB Arabidopsis thaliana PIP1b gene 40 3.0
77gb|AF004293.1|AF004293 Brassica rapa aquaporin (MOD) mRNA, compl... 40 3.0
78gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, com... 40 3.0
79dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane ... 40 3.0 
>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score =  343 bits (173), Expect = 2e-91
 Identities = 210/225 (93%)
 Strand = Plus / Minus

                                                                        
Query: 11   caaacttggaagacaaattggaattccacggtaacacggacgatgggaaaagagggnnnn 70
            |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||    
Sbjct: 1075 caaacttggaagacaaattggaattccacggtaacagggacgatgggaagagagggccgc 1016

                                                                        
Query: 71   nnnnatcaaaaagaaattccctcaaaacacgcagtttgctcttcgggttgggatggcatc 130
                |||| |||||||||| |||| |||||||||||||||||||||||||||||||||||
Sbjct: 1015 ccccatcagaaagaaattcactcagaacacgcagtttgctcttcgggttgggatggcatc 956

                                                                        
Query: 131  tttctttgtagcagcagcttaggacttggtcttgaatgggatcgctctgatgaccacctg 190
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 955  tttctttgtagcagcagcttaggacttggtcttgaatgggatcgctctgatgaccacctg 896

                                                         
Query: 191  gtggtaaatggcggccagcgcggcgccgatgaaggggcccaccca 235
            |||||| |||||||||||||||||||||||||||||||| |||||
Sbjct: 895  gtggtagatggcggccagcgcggcgccgatgaaggggccgaccca 851
to top
>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence
          Length = 1154

 Score = 95.6 bits (48), Expect = 6e-17
 Identities = 81/92 (88%)
 Strand = Plus / Minus

                                                                       
Query: 144 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcg 203
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||| ||||| 
Sbjct: 834 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 775

                                           
Query: 204 gccagcgcggcgccgatgaaggggcccaccca 235
           ||||| |||||||||||||||||||| |||||
Sbjct: 774 gccagggcggcgccgatgaaggggccgaccca 743
to top
>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence
          Length = 698

 Score = 95.6 bits (48), Expect = 6e-17
 Identities = 69/76 (90%)
 Strand = Plus / Minus

                                                                       
Query: 160 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccga 219
           ||||||| |||||||| ||||||| |||||||||||| ||||| |||||||| |||||||
Sbjct: 425 tcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccga 366

                           
Query: 220 tgaaggggcccaccca 235
           |||||||||| |||||
Sbjct: 365 tgaaggggccgaccca 350
to top
>gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker
          Length = 824

 Score = 95.6 bits (48), Expect = 6e-17
 Identities = 81/92 (88%)
 Strand = Plus / Plus

                                                                       
Query: 144 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcg 203
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||| ||||| 
Sbjct: 244 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 303

                                           
Query: 204 gccagcgcggcgccgatgaaggggcccaccca 235
           ||||| |||||||||||||||||||| |||||
Sbjct: 304 gccagggcggcgccgatgaaggggccgaccca 335
to top
>gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker
          Length = 763

 Score = 95.6 bits (48), Expect = 6e-17
 Identities = 81/92 (88%)
 Strand = Plus / Minus

                                                                       
Query: 144 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcg 203
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||| ||||| 
Sbjct: 533 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 474

                                           
Query: 204 gccagcgcggcgccgatgaaggggcccaccca 235
           ||||| |||||||||||||||||||| |||||
Sbjct: 473 gccagggcggcgccgatgaaggggccgaccca 442
to top
>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score = 95.6 bits (48), Expect = 6e-17
 Identities = 69/76 (90%)
 Strand = Plus / Minus

                                                                       
Query: 160 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccga 219
           ||||||| |||||||| ||||||| |||||||||||| ||||| |||||||| |||||||
Sbjct: 856 tcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccga 797

                           
Query: 220 tgaaggggcccaccca 235
           |||||||||| |||||
Sbjct: 796 tgaaggggccgaccca 781
to top
>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score = 95.6 bits (48), Expect = 6e-17
 Identities = 69/76 (90%)
 Strand = Plus / Minus

                                                                       
Query: 160 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccga 219
           ||||||| |||||||| ||||||| |||||||||||| ||||| |||||||| |||||||
Sbjct: 913 tcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccga 854

                           
Query: 220 tgaaggggcccaccca 235
           |||||||||| |||||
Sbjct: 853 tgaaggggccgaccca 838
to top
>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete
           cds
          Length = 1153

 Score = 95.6 bits (48), Expect = 6e-17
 Identities = 81/92 (88%)
 Strand = Plus / Minus

                                                                       
Query: 144 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcg 203
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||| ||||| 
Sbjct: 984 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 925

                                           
Query: 204 gccagcgcggcgccgatgaaggggcccaccca 235
           ||||| |||||||||||||||||||| |||||
Sbjct: 924 gccagggcggcgccgatgaaggggccgaccca 893
to top
>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete
           cds
          Length = 1296

 Score = 95.6 bits (48), Expect = 6e-17
 Identities = 81/92 (88%)
 Strand = Plus / Minus

                                                                       
Query: 144 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcg 203
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||| ||||| 
Sbjct: 979 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 920

                                           
Query: 204 gccagcgcggcgccgatgaaggggcccaccca 235
           ||||| |||||||||||||||||||| |||||
Sbjct: 919 gccagggcggcgccgatgaaggggccgaccca 888
to top
>gb|AY103580.1| Zea mays PCO072544 mRNA sequence
          Length = 1633

 Score = 95.6 bits (48), Expect = 6e-17
 Identities = 81/92 (88%)
 Strand = Plus / Minus

                                                                        
Query: 144  gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcg 203
            |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||| ||||| 
Sbjct: 1308 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 1249

                                            
Query: 204  gccagcgcggcgccgatgaaggggcccaccca 235
            ||||| |||||||||||||||||||| |||||
Sbjct: 1248 gccagggcggcgccgatgaaggggccgaccca 1217
to top
>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds
          Length = 1280

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcg 203
           |||||||| ||| || ||||||| ||||| |||||||||| |||||||||||| ||||| 
Sbjct: 935 gcagcttaagacctgctcttgaacgggatggctctgatgatcacctggtggtagatggca 876

                                           
Query: 204 gccagcgcggcgccgatgaaggggcccaccca 235
           ||||| || ||||| ||||||||||| |||||
Sbjct: 875 gccagggcagcgccaatgaaggggccgaccca 844
to top
>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin
          Length = 1291

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 46/48 (95%)
 Strand = Plus / Minus

                                                            
Query: 188  ctggtggtaaatggcggccagcgcggcgccgatgaaggggcccaccca 235
            ||||||||| |||||||||||||||||||||||||||||||| |||||
Sbjct: 1291 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgaccca 1244
to top
>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 147 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggcc 206
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||| ||||| |||
Sbjct: 896 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 837

                                        
Query: 207 agcgcggcgccgatgaaggggcccaccca 235
           || || ||||| | |||||| || |||||
Sbjct: 836 agggcagcgccaacgaagggaccaaccca 808
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                            
Query: 147      gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggcc 206
                ||||| ||| || |||||||||||||||| ||||||| |||||||||||| ||||| |||
Sbjct: 27065653 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 27065594

                                             
Query: 207      agcgcggcgccgatgaaggggcccaccca 235
                || || ||||| | |||||| || |||||
Sbjct: 27065593 agggcagcgccaacgaagggaccaaccca 27065565
to top
>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1486_E07
          Length = 110494

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                         
Query: 147   gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggcc 206
             ||||| ||| || |||||||||||||||| ||||||| |||||||||||| ||||| |||
Sbjct: 37302 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 37243

                                          
Query: 207   agcgcggcgccgatgaaggggcccaccca 235
             || || ||||| | |||||| || |||||
Sbjct: 37242 agggcagcgccaacgaagggaccaaccca 37214
to top
>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0461B08
          Length = 153743

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                          
Query: 147    gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggcc 206
              ||||| ||| || |||||||||||||||| ||||||| |||||||||||| ||||| |||
Sbjct: 118855 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 118796

                                           
Query: 207    agcgcggcgccgatgaaggggcccaccca 235
              || || ||||| | |||||| || |||||
Sbjct: 118795 agggcagcgccaacgaagggaccaaccca 118767
to top
>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 147 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggcc 206
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||| ||||| |||
Sbjct: 929 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 870

                                        
Query: 207 agcgcggcgccgatgaaggggcccaccca 235
           || || ||||| | |||||| || |||||
Sbjct: 869 agggcagcgccaacgaagggaccaaccca 841
to top
>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 147 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggcc 206
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||| ||||| |||
Sbjct: 984 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 925

                                        
Query: 207 agcgcggcgccgatgaaggggcccaccca 235
           || || ||||| | |||||| || |||||
Sbjct: 924 agggcagcgccaacgaagggaccaaccca 896
to top
>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 147 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggcc 206
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||| ||||| |||
Sbjct: 929 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 870

                                        
Query: 207 agcgcggcgccgatgaaggggcccaccca 235
           || || ||||| | |||||| || |||||
Sbjct: 869 agggcagcgccaacgaagggaccaaccca 841
to top
>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1140

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 147 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggcc 206
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||| ||||| |||
Sbjct: 924 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 865

                                        
Query: 207 agcgcggcgccgatgaaggggcccaccca 235
           || || ||||| | |||||| || |||||
Sbjct: 864 agggcagcgccaacgaagggaccaaccca 836
to top
>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 147 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggcc 206
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||| ||||| |||
Sbjct: 927 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 868

                                        
Query: 207 agcgcggcgccgatgaaggggcccaccca 235
           || || ||||| | |||||| || |||||
Sbjct: 867 agggcagcgccaacgaagggaccaaccca 839
to top
>ref|XM_473480.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 71.9 bits (36), Expect = 9e-10
 Identities = 66/76 (86%)
 Strand = Plus / Minus

                                                                       
Query: 160 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccga 219
           |||||||||| || || |||||||||||||||||||| ||||| || || || ||||| |
Sbjct: 838 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 779

                           
Query: 220 tgaaggggcccaccca 235
           |||||||||| |||||
Sbjct: 778 tgaaggggccaaccca 763
to top
>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score = 71.9 bits (36), Expect = 9e-10
 Identities = 66/76 (86%)
 Strand = Plus / Minus

                                                                         
Query: 160   tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccga 219
             |||||||||| || || |||||||||||||||||||| ||||| || || || ||||| |
Sbjct: 28669 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 28610

                             
Query: 220   tgaaggggcccaccca 235
             |||||||||| |||||
Sbjct: 28609 tgaaggggccaaccca 28594
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 71.9 bits (36), Expect = 9e-10
 Identities = 66/76 (86%)
 Strand = Plus / Minus

                                                                            
Query: 160      tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccga 219
                |||||||||| || || |||||||||||||||||||| ||||| || || || ||||| |
Sbjct: 28021443 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 28021384

                                
Query: 220      tgaaggggcccaccca 235
                |||||||||| |||||
Sbjct: 28021383 tgaaggggccaaccca 28021368
to top
>gb|AY170841.1| Axonopus compressus plasma membrane MIP protein mRNA, partial cds
          Length = 423

 Score = 71.9 bits (36), Expect = 9e-10
 Identities = 66/76 (86%)
 Strand = Plus / Minus

                                                                       
Query: 160 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccga 219
           ||||||| ||||| || ||||||| |||||||||||| |||||||| || || ||||| |
Sbjct: 412 tcttgaacgggatggccctgatgatcacctggtggtagatggcggctagggcagcgccaa 353

                           
Query: 220 tgaaggggcccaccca 235
           |||||||||| |||||
Sbjct: 352 tgaaggggccgaccca 337
to top
>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score = 71.9 bits (36), Expect = 9e-10
 Identities = 66/76 (86%)
 Strand = Plus / Minus

                                                                       
Query: 160 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccga 219
           |||||||||| || || |||||||||||||||||||| ||||| || || || ||||| |
Sbjct: 915 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 856

                           
Query: 220 tgaaggggcccaccca 235
           |||||||||| |||||
Sbjct: 855 tgaaggggccaaccca 840
to top
>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score = 71.9 bits (36), Expect = 9e-10
 Identities = 66/76 (86%)
 Strand = Plus / Minus

                                                                       
Query: 160 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccga 219
           |||||||||| || || |||||||||||||||||||| ||||| || || || ||||| |
Sbjct: 916 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 857

                           
Query: 220 tgaaggggcccaccca 235
           |||||||||| |||||
Sbjct: 856 tgaaggggccaaccca 841
to top
>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full
           insert sequence
          Length = 1167

 Score = 71.9 bits (36), Expect = 9e-10
 Identities = 66/76 (86%)
 Strand = Plus / Minus

                                                                       
Query: 160 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccga 219
           |||||||||| || || |||||||||||||||||||| ||||| || || || ||||| |
Sbjct: 918 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 859

                           
Query: 220 tgaaggggcccaccca 235
           |||||||||| |||||
Sbjct: 858 tgaaggggccaaccca 843
to top
>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
            insert sequence
          Length = 1462

 Score = 71.9 bits (36), Expect = 9e-10
 Identities = 66/76 (86%)
 Strand = Plus / Minus

                                                                        
Query: 160  tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccga 219
            |||||||||| || || |||||||||||||||||||| ||||| || || || ||||| |
Sbjct: 1214 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 1155

                            
Query: 220  tgaaggggcccaccca 235
            |||||||||| |||||
Sbjct: 1154 tgaaggggccaaccca 1139
to top
>gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein (Mip1) mRNA, partial cds
          Length = 539

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                       
Query: 145 cagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcgg 204
           ||||||| ||| || ||||||| ||||| || ||||||| |||||||||||| ||||| |
Sbjct: 359 cagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggcag 300

                                          
Query: 205 ccagcgcggcgccgatgaaggggcccaccca 235
           |||| || || || ||||||||||| |||||
Sbjct: 299 ccagggcagcaccaatgaaggggccgaccca 269
to top
>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 174 gctctgatgaccacctggtggtaaatggcggccagcgcggcgccgatgaaggggcccacc 233
           |||||||||| |||||||||||| | ||| ||||| |||||||| | |||||||||||||
Sbjct: 927 gctctgatgatcacctggtggtagacggctgccagggcggcgccaacgaaggggcccacc 868

             
Query: 234 ca 235
           ||
Sbjct: 867 ca 866
to top
>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 160 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccga 219
           ||||||| |||||||| ||||| ||||||  |||||| || || |||||||| |||||||
Sbjct: 945 tcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccga 886

                           
Query: 220 tgaaggggcccaccca 235
           |||| || ||||||||
Sbjct: 885 tgaacggtcccaccca 870
to top
>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1
           (PIP1-1) mRNA, complete cds
          Length = 1115

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 154 acttggtcttgaatgggatcgctctgatgaccacctggtggta 196
           |||||| |||||| || || |||||||||||||||||||||||
Sbjct: 887 acttggacttgaagggaatggctctgatgaccacctggtggta 845
to top
>gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1a) mRNA, complete cds
          Length = 1129

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 66/79 (83%)
 Strand = Plus / Minus

                                                                       
Query: 157 tggtcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgc 216
           |||||||||||||||| |||||||| || | ||||||||| | ||| || || || || |
Sbjct: 907 tggtcttgaatgggatggctctgattactatctggtggtacaaggcagcaagagcagctc 848

                              
Query: 217 cgatgaaggggcccaccca 235
           | |||||||| ||||||||
Sbjct: 847 caatgaagggtcccaccca 829
to top
>gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, complete cds
          Length = 1189

 Score = 48.1 bits (24), Expect = 0.012
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 161 cttgaatgggatcgctctgatgaccacctggtggta 196
           |||||||||||| |||||||| || |||||||||||
Sbjct: 937 cttgaatgggatggctctgatcacaacctggtggta 902
to top
>gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mRNA, partial cds
          Length = 502

 Score = 46.1 bits (23), Expect = 0.049
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 162 ttgaatgggatcgctctgatgaccacctggtggta 196
           ||||| ||||| ||||||||||| |||||||||||
Sbjct: 176 ttgaaggggattgctctgatgacgacctggtggta 142
to top
>emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein
          Length = 1179

 Score = 46.1 bits (23), Expect = 0.049
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 160 tcttgaatgggatcgctctgatgaccacctggtggtaaatggc 202
           |||||||||| || || ||||| ||| ||||||||||||||||
Sbjct: 930 tcttgaatggaattgccctgataaccccctggtggtaaatggc 888
to top
>emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative plasma membrane intrinsic
           protein (pip1a gene)
          Length = 1139

 Score = 46.1 bits (23), Expect = 0.049
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 158 ggtcttgaatgggatcgctctgatgaccacctggtggta 196
           |||||||||||| || ||||||||||| | |||||||||
Sbjct: 874 ggtcttgaatggaattgctctgatgactatctggtggta 836
to top
>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 46.1 bits (23), Expect = 0.049
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 154 acttggtcttgaatgggatcgctctgatgaccacc 188
           ||||| ||||||||||||| |||||||| ||||||
Sbjct: 847 acttgttcttgaatgggatagctctgatcaccacc 813
to top
>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 46.1 bits (23), Expect = 0.049
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 162 ttgaatgggatcgctctgatgaccacctggtggta 196
           ||||| ||||| ||||||||||| |||||||||||
Sbjct: 936 ttgaaggggattgctctgatgacgacctggtggta 902
to top
>gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1179

 Score = 46.1 bits (23), Expect = 0.049
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 160 tcttgaatgggatcgctctgatgaccacctggtggtaaatggc 202
           |||||||||| || || ||||| ||| ||||||||||||||||
Sbjct: 930 tcttgaatggaattgccctgataaccccctggtggtaaatggc 888
to top
>dbj|AB002149.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1064

 Score = 46.1 bits (23), Expect = 0.049
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 156 ttggtcttgaatgggatcgctctgatgaccacctggtggtaaa 198
           |||||||||||||| || ||||||||||  | |||||||||||
Sbjct: 890 ttggtcttgaatggaatggctctgatgattatctggtggtaaa 848
to top
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 198    atggcggccagcgcggcgccga 219
              ||||||||||||||||||||||
Sbjct: 310344 atggcggccagcgcggcgccga 310365
to top
>emb|AJ699398.2| Chenopodium rubrum mRNA for aquaporin PIP1 (PIP1 gene)
          Length = 1163

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 155 cttggtcttgaatgggatcgctctgatgaccacctggtggta 196
           ||||| |||||||||||| |||||||| || | |||||||||
Sbjct: 969 cttggacttgaatgggatggctctgataacaatctggtggta 928
to top
>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene)
          Length = 1364

 Score = 42.1 bits (21), Expect = 0.77
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 191 gtggtaaatggcggccagcgcggcgccgatgaaggggcccaccca 235
           |||||| |||||||| || || || |||||||||||||| |||||
Sbjct: 906 gtggtagatggcggcaagagcagcaccgatgaaggggccaaccca 862
to top
>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete
           cds
          Length = 1338

 Score = 42.1 bits (21), Expect = 0.77
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 191 gtggtaaatggcggccagcgcggcgccgatgaaggggcccaccca 235
           |||||| |||||||| || || || |||||||||||||| |||||
Sbjct: 897 gtggtagatggcggcaagagcagcaccgatgaaggggccaaccca 853
to top
>gb|AY107675.1| Zea mays PCO112712 mRNA sequence
          Length = 791

 Score = 42.1 bits (21), Expect = 0.77
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 191 gtggtaaatggcggccagcgcggcgccgatgaaggggcccaccca 235
           |||||| |||||||| || || || |||||||||||||| |||||
Sbjct: 330 gtggtagatggcggcaagagcagcaccgatgaaggggccaaccca 286
to top
>ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G45960 (PIP1B) mRNA,
           complete cds
          Length = 1259

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 161 cttgaatgggatcgctctgatgac 184
           |||||||||||| |||||||||||
Sbjct: 988 cttgaatgggatggctctgatgac 965
to top
>gb|AF499725.1| Thellungiella halophila plasma membrane intrinsic protein 1B-like
           protein mRNA, complete cds
          Length = 833

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 161 cttgaatgggatcgctctgatgac 184
           |||||||||||| |||||||||||
Sbjct: 671 cttgaatgggattgctctgatgac 648
to top
>emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein
          Length = 1064

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 161 cttgaatgggatcgctctgatgac 184
           |||||||||||| |||||||||||
Sbjct: 908 cttgaatgggatggctctgatgac 885
to top
>emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel protein (mipB)
          Length = 1114

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 161 cttgaatgggatcgctctgatgac 184
           |||||||||||| |||||||||||
Sbjct: 867 cttgaatgggatggctctgatgac 844
to top
>emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel protein (mipA)
          Length = 1104

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 161 cttgaatgggatcgctctgatgac 184
           |||||||||||| |||||||||||
Sbjct: 886 cttgaatgggatggctctgatgac 863
to top
>gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (At2g45960) mRNA,
           complete cds
          Length = 892

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 161 cttgaatgggatcgctctgatgac 184
           |||||||||||| |||||||||||
Sbjct: 849 cttgaatgggatggctctgatgac 826
to top
>emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A
          Length = 1105

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 161 cttgaatgggatcgctctgatgac 184
           |||||||||||| |||||||||||
Sbjct: 903 cttgaatgggatggctctgatgac 880
to top
>gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic
           protein 1B (At2g45960) mRNA, complete cds
          Length = 1077

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 161 cttgaatgggatcgctctgatgac 184
           |||||||||||| |||||||||||
Sbjct: 909 cttgaatgggatggctctgatgac 886
to top
>gb|AC182472.3| Pan troglodytes BAC clone CH251-394C9 from chromosome 19, complete
              sequence
          Length = 165954

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 127    catctttctttgtagcagcagctt 150
              |||||||| |||||||||||||||
Sbjct: 108793 catctttcattgtagcagcagctt 108770
to top
>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 199     tggcggccagcgcggcgccg 218
               ||||||||||||||||||||
Sbjct: 4507898 tggcggccagcgcggcgccg 4507879
to top
>gb|AC091691.7| Homo sapiens chromosome 18, clone RP11-47G4, complete sequence
          Length = 164314

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 78     aaaaagaaattccctcaaaa 97
              ||||||||||||||||||||
Sbjct: 105502 aaaaagaaattccctcaaaa 105483
to top
>gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map CIC02E07, complete
             sequence
          Length = 101647

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 161   cttgaatgggatcgctctgatgac 184
             |||||||||||| |||||||||||
Sbjct: 15226 cttgaatgggatggctctgatgac 15249
to top
>gb|AC016493.14| Homo sapiens chromosome 18, clone RP11-58G13, complete sequence
          Length = 163936

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 16     ttggaagacaaattggaatt 35
              ||||||||||||||||||||
Sbjct: 159892 ttggaagacaaattggaatt 159873
to top
>gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-3
           (PIP1-3) mRNA, complete cds
          Length = 1159

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 62/76 (81%)
 Strand = Plus / Minus

                                                                       
Query: 160 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccga 219
           |||||||||| || ||||||||||| | ||| ||||| ||||| || || || || || |
Sbjct: 909 tcttgaatggaatggctctgatgactatctgatggtacatggcagcaagagcagctccaa 850

                           
Query: 220 tgaaggggcccaccca 235
           |||| || ||||||||
Sbjct: 849 tgaaaggtcccaccca 834
to top
>gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-2
           (PIP1-2) mRNA, complete cds
          Length = 1154

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 161 cttgaatgggatcgctctgatgaccacctggtggta 196
           |||||||||||| |||||||| || | |||||||||
Sbjct: 911 cttgaatgggatggctctgattactatctggtggta 876
to top
>gb|AC023577.6| Homo sapiens chromosome 18, clone RP11-645D5, complete sequence
          Length = 166503

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 16    ttggaagacaaattggaatt 35
             ||||||||||||||||||||
Sbjct: 50150 ttggaagacaaattggaatt 50131
to top
>dbj|AK222086.1| Arabidopsis thaliana mRNA for aquaporin, partial cds, clone:
           RAFL22-84-C08
          Length = 318

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 161 cttgaatgggatcgctctgatgac 184
           |||||||||||| |||||||||||
Sbjct: 111 cttgaatgggatggctctgatgac 88
to top
>gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205), mRNA sequence
          Length = 1913

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 161 cttgaatgggatcgctctgatgac 184
           |||||||||||| |||||||||||
Sbjct: 909 cttgaatgggatggctctgatgac 886
to top
>gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, complete cds
          Length = 1101

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 161 cttgaatgggatcgctctgatgac 184
           |||||||||||| |||||||||||
Sbjct: 868 cttgaatgggatggctctgatgac 845
to top
>gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, complete cds
          Length = 1084

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 161 cttgaatgggatcgctctgatgac 184
           |||||||||||| |||||||||||
Sbjct: 885 cttgaatgggatggctctgatgac 862
to top
>emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS86ZH06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1084

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 161 cttgaatgggatcgctctgatgac 184
           |||||||||||| |||||||||||
Sbjct: 889 cttgaatgggatggctctgatgac 866
to top
>emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS13ZG09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 679

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 161 cttgaatgggatcgctctgatgac 184
           |||||||||||| |||||||||||
Sbjct: 522 cttgaatgggatggctctgatgac 499
to top
>emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH87ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1036

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 161 cttgaatgggatcgctctgatgac 184
           |||||||||||| |||||||||||
Sbjct: 894 cttgaatgggatggctctgatgac 871
to top
>emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS2ZA01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1060

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 161 cttgaatgggatcgctctgatgac 184
           |||||||||||| |||||||||||
Sbjct: 881 cttgaatgggatggctctgatgac 858
to top
>gb|AC011500.7| Homo sapiens chromosome 19 clone CTB-60E11, complete sequence
          Length = 200430

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 127    catctttctttgtagcagcagctt 150
              |||||||| |||||||||||||||
Sbjct: 139931 catctttcattgtagcagcagctt 139908
to top
>gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, complete cds
          Length = 1052

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 161 cttgaatgggatcgctctgatgac 184
           |||||||||||| |||||||||||
Sbjct: 909 cttgaatgggatggctctgatgac 886
to top
>gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1b) mRNA, complete cds
          Length = 1119

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 62/76 (81%)
 Strand = Plus / Minus

                                                                       
Query: 160 tcttgaatgggatcgctctgatgaccacctggtggtaaatggcggccagcgcggcgccga 219
           |||||||||| || ||||||||||| | ||| ||||| ||||| || || || || || |
Sbjct: 910 tcttgaatggaatggctctgatgactatctgctggtacatggcagcaagagcagctccaa 851

                           
Query: 220 tgaaggggcccaccca 235
           |||| || ||||||||
Sbjct: 850 tgaacggtcccaccca 835
to top
>emb|AJ243257.1|SNA243257 Streptomyces natalensis plasmid pSNA1 including spda, kora, spdb2 and
            rep genes
          Length = 9367

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 199  tggcggccagcgcggcgccg 218
            ||||||||||||||||||||
Sbjct: 4015 tggcggccagcgcggcgccg 3996
to top
>emb|Z17399.1|ATORFB Arabidopsis thaliana PIP1b gene
          Length = 2773

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 161  cttgaatgggatcgctctgatgac 184
            |||||||||||| |||||||||||
Sbjct: 1547 cttgaatgggatggctctgatgac 1524
to top
>gb|AF004293.1|AF004293 Brassica rapa aquaporin (MOD) mRNA, complete cds
          Length = 900

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 161 cttgaatgggatcgctctgatgac 184
           |||||||||||| |||||||||||
Sbjct: 867 cttgaatgggatggctctgatgac 844
to top
>gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, complete cds
          Length = 1071

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 188 ctggtggtaaatggcggccagcgcggcgccgatgaaggggcccaccca 235
           |||||||||||  | |||||  |||||||||||||| ||||| |||||
Sbjct: 814 ctggtggtaaaccgtggccacggcggcgccgatgaacgggccaaccca 767
to top
>dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane aquaporin 1b,
           complete cds
          Length = 1053

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 161 cttgaatgggatcgctctgatgac 184
           |||||||||||| |||||||||||
Sbjct: 870 cttgaatgggatggctctgatgac 847


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,103,700
Number of Sequences: 3902068
Number of extensions: 2103700
Number of successful extensions: 35959
Number of sequences better than 10.0: 79
Number of HSP's better than 10.0 without gapping: 79
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 35743
Number of HSP's gapped (non-prelim): 216
length of query: 236
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 214
effective length of database: 17,147,199,772
effective search space: 3669500751208
effective search space used: 3669500751208
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top