ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart43b10
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 107 2e-20
2gb|AC146702.1| Genomic sequence for Oryza sativa, Nipponbare str... 107 2e-20
3dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 107 2e-20
4dbj|AK070827.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 2e-20
5gb|AC104429.2| Oryza sativa (japonica cultivar-group) chromosome... 92 1e-15
6gb|AC171737.2| Monodelphis domestica clone VMRC6-60O3 map human ... 44 0.25
7gb|AC108413.4| Mus musculus chromosome 8, clone RP23-472M11, com... 42 0.99
8gb|AC010799.15| Homo sapiens chromosome 15, clone RP11-40J8, com... 42 0.99
9gb|AC163225.4| Mus musculus chromosome 8, clone RP23-319L22, com... 42 0.99
10gb|AC120838.10| Pan troglodytes clone ch251-239a19, complete seq... 42 0.99
11gb|AC019322.8| Homo sapiens chromosome 15, clone RP11-382B18, co... 42 0.99
12gb|AC111169.7| Homo sapiens chromosome 15, clone RP11-20D7, comp... 42 0.99
13gb|AC068448.10| Homo sapiens chromosome 15, clone RP11-624A21, c... 42 0.99
14gb|AC021413.16| Homo sapiens chromosome 15, clone RP11-30N16, co... 42 0.99
15emb|CT571256.7| Mouse DNA sequence from clone RP24-135B13 on chr... 42 0.99
16ref|XM_479459.1| Oryza sativa (japonica cultivar-group), mRNA 40 3.9
17gb|AE001387.1| Plasmodium falciparum 3D7 chromosome 2 section 24... 40 3.9
18gb|AC004760.1| Homo sapiens chromosome 16, cosmid clone 316H7 (L... 40 3.9
19gb|AC183804.3| Pan troglodytes BAC clone CH251-67P16 from chromo... 40 3.9
20gb|AC148022.2| Homo sapiens BAC clone RP11-1383G16 from 2, compl... 40 3.9
21gb|AC117627.16| Mus musculus chromosome 1, clone RP23-116N6, com... 40 3.9
22gb|AC100727.10| Mus musculus chromosome 1, clone RP24-278K16, co... 40 3.9
23gb|AY242112.1| Sus scrofa EWB tyrosine hydroxylase (TH) gene, ex... 40 3.9
24gb|AY242111.1| Sus scrofa H205 tyrosine hydroxylase (TH) gene, e... 40 3.9
25gb|AY242110.1| Sus scrofa H254 tyrosine hydroxylase (TH) gene, e... 40 3.9
26gb|AY242109.1| Sus scrofa JWB tyrosine hydroxylase (TH) gene, ex... 40 3.9
27gb|AY242108.1| Sus scrofa LRJ tyrosine hydroxylase (TH) gene, ex... 40 3.9
28gb|AY242107.1| Sus scrofa LW1224 tyrosine hydroxylase (TH) gene,... 40 3.9
29gb|AY242106.1| Sus scrofa LW1461 tyrosine hydroxylase (TH) gene,... 40 3.9
30gb|AY242105.1| Sus scrofa LW197 tyrosine hydroxylase (TH) gene, ... 40 3.9
31gb|AY242104.1| Sus scrofa LW209 tyrosine hydroxylase (TH) gene, ... 40 3.9
32gb|AY242103.1| Sus scrofa LW3 tyrosine hydroxylase (TH) gene, ex... 40 3.9
33gb|AY242102.1| Sus scrofa LW33361 tyrosine hydroxylase (TH) gene... 40 3.9
34gb|AY242101.1| Sus scrofa LW419 tyrosine hydroxylase (TH) gene, ... 40 3.9
35gb|AY242100.1| Sus scrofa LW463 tyrosine hydroxylase (TH) gene, ... 40 3.9
36gb|AY242099.1| Sus scrofa M220 tyrosine hydroxylase (TH) gene, e... 40 3.9
37gb|AY242098.1| Sus scrofa P208 tyrosine hydroxylase (TH) gene, e... 40 3.9
38gb|AC073349.11| Homo sapiens BAC clone RP11-797H7 from 7, comple... 40 3.9
39emb|AL445195.4| Human DNA sequence from clone RP11-427O13 on chr... 40 3.9
40emb|AL354862.11| Human DNA sequence from clone RP11-83L6 on chro... 40 3.9
41gb|AC159540.1| Homo sapiens BAC clone RP11-474M15 from 2, comple... 40 3.9
42emb|AL161517.2|ATCHRIV29 Arabidopsis thaliana DNA chromosome 4, ... 40 3.9
43emb|AL049524.1|ATF7L13 Arabidopsis thaliana DNA chromosome 4, BA... 40 3.9
44emb|CR937046.1|PT147K15 Pan troglodytes chromosome 11 BAC PTB-14... 40 3.9
45gb|AC104411.5| Homo sapiens 3 BAC RP11-555M1 (Roswell Park Cance... 40 3.9
46gb|AC098642.5| Genomic sequence for Mus musculus, clone RP23-270... 40 3.9
47gb|AC011333.7| Homo sapiens chromosome 5 clone CTC-229L21, compl... 40 3.9
48gb|AC021581.10| Homo sapiens chromosome 17, clone RP11-956N15, c... 40 3.9
49gb|AC010612.8| Homo sapiens chromosome 5 clone CTB-91C24, comple... 40 3.9
50dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 3.9
51gb|AC006111.4| Homo sapiens chromosome 16 clone RP11-461A8, comp... 40 3.9
52gb|AC092683.3| Homo sapiens BAC clone RP11-734K23 from 2, comple... 40 3.9
53gb|AC112907.7| Homo sapiens 3 BAC RP11-573D15 (Roswell Park Canc... 40 3.9
54gb|AC148032.2| Homo sapiens BAC clone RP13-809J14 from 2, comple... 40 3.9
55gb|AC025752.8| Homo sapiens chromosome 5 clone CTC-430J12, compl... 40 3.9
56dbj|AP004300.3| Oryza sativa (japonica cultivar-group) genomic D... 40 3.9
57emb|AL845273.7| Mouse DNA sequence from clone RP23-334D15 on chr... 40 3.9
58emb|AL603682.36| Mouse DNA sequence from clone RP23-235J5 on chr... 40 3.9
59emb|AL663072.12| Mouse DNA sequence from clone RP23-22J3 on chro... 40 3.9 
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  107 bits (54), Expect = 2e-20
 Identities = 66/70 (94%)
 Strand = Plus / Minus

                                                                           
Query: 208     accgggcgagcgcccggcggaacacctgggcgaggaggctgggggcgctgaggtggggga 267
               |||||||||| || ||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 5391729 accgggcgagagcgcggcggagcacctgggcgaggaggctgggggcgctgaggtggggga 5391670

                         
Query: 268     ggtggccctc 277
               |||| |||||
Sbjct: 5391669 ggtgaccctc 5391660
to top
>gb|AC146702.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0009J13, from chromosome 3, complete sequence
          Length = 147205

 Score =  107 bits (54), Expect = 2e-20
 Identities = 66/70 (94%)
 Strand = Plus / Minus

                                                                         
Query: 208   accgggcgagcgcccggcggaacacctgggcgaggaggctgggggcgctgaggtggggga 267
             |||||||||| || ||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 97897 accgggcgagagcgcggcggagcacctgggcgaggaggctgggggcgctgaggtggggga 97838

                       
Query: 268   ggtggccctc 277
             |||| |||||
Sbjct: 97837 ggtgaccctc 97828
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  107 bits (54), Expect = 2e-20
 Identities = 66/70 (94%)
 Strand = Plus / Minus

                                                                           
Query: 208     accgggcgagcgcccggcggaacacctgggcgaggaggctgggggcgctgaggtggggga 267
               |||||||||| || ||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 5390944 accgggcgagagcgcggcggagcacctgggcgaggaggctgggggcgctgaggtggggga 5390885

                         
Query: 268     ggtggccctc 277
               |||| |||||
Sbjct: 5390884 ggtgaccctc 5390875
to top
>dbj|AK070827.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023064N24, full
            insert sequence
          Length = 1487

 Score =  107 bits (54), Expect = 2e-20
 Identities = 66/70 (94%)
 Strand = Plus / Minus

                                                                        
Query: 208  accgggcgagcgcccggcggaacacctgggcgaggaggctgggggcgctgaggtggggga 267
            |||||||||| || ||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1154 accgggcgagagcgcggcggagcacctgggcgaggaggctgggggcgctgaggtggggga 1095

                      
Query: 268  ggtggccctc 277
            |||| |||||
Sbjct: 1094 ggtgaccctc 1085
to top
>gb|AC104429.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0006P09,
              complete sequence
          Length = 153950

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                          
Query: 208    accgggcgagcgcccggcggaacacctgggcgaggaggctgggggcgctgaggtggggga 267
              |||||||||| || ||||||| |||||| || ||||||||||||||||||||||||||||
Sbjct: 121620 accgggcgagagcgcggcggagcacctgagctaggaggctgggggcgctgaggtggggga 121561

                        
Query: 268    ggtggccctc 277
              |||| |||||
Sbjct: 121560 ggtgaccctc 121551
to top
>gb|AC171737.2| Monodelphis domestica clone VMRC6-60O3 map human ortholog 11q13.4,
             complete sequence
          Length = 131794

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 230   cacctgggcgaggaggctgggg 251
             ||||||||||||||||||||||
Sbjct: 14530 cacctgggcgaggaggctgggg 14509
to top
>gb|AC108413.4| Mus musculus chromosome 8, clone RP23-472M11, complete sequence
          Length = 174540

 Score = 42.1 bits (21), Expect = 0.99
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 166   tttcttccctctctctttttt 186
             |||||||||||||||||||||
Sbjct: 17804 tttcttccctctctctttttt 17784
to top
>gb|AC010799.15| Homo sapiens chromosome 15, clone RP11-40J8, complete sequence
          Length = 179508

 Score = 42.1 bits (21), Expect = 0.99
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 166   tttcttccctctctctttttt 186
             |||||||||||||||||||||
Sbjct: 69154 tttcttccctctctctttttt 69174
to top
>gb|AC163225.4| Mus musculus chromosome 8, clone RP23-319L22, complete sequence
          Length = 192661

 Score = 42.1 bits (21), Expect = 0.99
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 166   tttcttccctctctctttttt 186
             |||||||||||||||||||||
Sbjct: 86560 tttcttccctctctctttttt 86540
to top
>gb|AC120838.10| Pan troglodytes clone ch251-239a19, complete sequence
          Length = 150256

 Score = 42.1 bits (21), Expect = 0.99
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 166   tttcttccctctctctttttt 186
             |||||||||||||||||||||
Sbjct: 17813 tttcttccctctctctttttt 17833
to top
>gb|AC019322.8| Homo sapiens chromosome 15, clone RP11-382B18, complete sequence
          Length = 175205

 Score = 42.1 bits (21), Expect = 0.99
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 166   tttcttccctctctctttttt 186
             |||||||||||||||||||||
Sbjct: 20122 tttcttccctctctctttttt 20142
to top
>gb|AC111169.7| Homo sapiens chromosome 15, clone RP11-20D7, complete sequence
          Length = 129543

 Score = 42.1 bits (21), Expect = 0.99
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 166   tttcttccctctctctttttt 186
             |||||||||||||||||||||
Sbjct: 33085 tttcttccctctctctttttt 33105
to top
>gb|AC068448.10| Homo sapiens chromosome 15, clone RP11-624A21, complete sequence
          Length = 165208

 Score = 42.1 bits (21), Expect = 0.99
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 166    tttcttccctctctctttttt 186
              |||||||||||||||||||||
Sbjct: 147646 tttcttccctctctctttttt 147626
to top
>gb|AC021413.16| Homo sapiens chromosome 15, clone RP11-30N16, complete sequence
          Length = 199198

 Score = 42.1 bits (21), Expect = 0.99
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 166   tttcttccctctctctttttt 186
             |||||||||||||||||||||
Sbjct: 74572 tttcttccctctctctttttt 74552
to top
>emb|CT571256.7| Mouse DNA sequence from clone RP24-135B13 on chromosome 13, complete
              sequence
          Length = 183340

 Score = 42.1 bits (21), Expect = 0.99
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 67     taaaaatacagaaaagaaata 87
              |||||||||||||||||||||
Sbjct: 170520 taaaaatacagaaaagaaata 170540
to top
>ref|XM_479459.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 321

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 241 ggaggctgggggcgctgaggtggg 264
           ||||||||||||||||| ||||||
Sbjct: 131 ggaggctgggggcgctggggtggg 154
to top
>gb|AE001387.1| Plasmodium falciparum 3D7 chromosome 2 section 24 of 73 of the
           complete sequence
          Length = 15540

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 69  aaaatacagaaaagaaatac 88
           ||||||||||||||||||||
Sbjct: 540 aaaatacagaaaagaaatac 521
to top
>gb|AC004760.1| Homo sapiens chromosome 16, cosmid clone 316H7 (LANL), complete
             sequence
          Length = 44496

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 252   gcgctgaggtgggggaggtggccc 275
             |||| |||||||||||||||||||
Sbjct: 19763 gcgcggaggtgggggaggtggccc 19740
to top
>gb|AC183804.3| Pan troglodytes BAC clone CH251-67P16 from chromosome 2, complete
             sequence
          Length = 169437

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 171   tccctctctcttttttaggggatt 194
             ||||||||||||||| ||||||||
Sbjct: 22673 tccctctctctttttgaggggatt 22696
to top
>gb|AC148022.2| Homo sapiens BAC clone RP11-1383G16 from 2, complete sequence
          Length = 181750

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 171   tccctctctcttttttaggggatt 194
             ||||||||||||||| ||||||||
Sbjct: 64784 tccctctctctttttgaggggatt 64761
to top
>gb|AC117627.16| Mus musculus chromosome 1, clone RP23-116N6, complete sequence
          Length = 201995

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 166   tttcttccctctctcttttt 185
             ||||||||||||||||||||
Sbjct: 76620 tttcttccctctctcttttt 76601
to top
>gb|AC100727.10| Mus musculus chromosome 1, clone RP24-278K16, complete sequence
          Length = 170056

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 166    tttcttccctctctcttttt 185
              ||||||||||||||||||||
Sbjct: 106131 tttcttccctctctcttttt 106150
to top
>gb|AY242112.1| Sus scrofa EWB tyrosine hydroxylase (TH) gene, exon 14 and partial cds;
             preproinsulin (INS) gene, complete cds; and insulin-like
             growth factor 2 preproprotein (IGF2) gene, complete cds,
             alternatively spliced
          Length = 28397

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 244   ggctgggggcgctgaggtgggggaggtggccctccg 279
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23410 ggctgggggggaggaggtgagggaggtggccctccg 23445
to top
>gb|AY242111.1| Sus scrofa H205 tyrosine hydroxylase (TH) gene, exon 14; preproinsulin
             (INS) gene, complete cds; and insulin-like growth factor 2
             preproprotein (IGF2) gene, complete cds, alternatively
             spliced
          Length = 28190

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 244   ggctgggggcgctgaggtgggggaggtggccctccg 279
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23238 ggctgggggggaggaggtgagggaggtggccctccg 23273
to top
>gb|AY242110.1| Sus scrofa H254 tyrosine hydroxylase (TH) gene, exon 14; preproinsulin
             (INS) gene, complete cds; and insulin-like growth factor 2
             preproprotein (IGF2) gene, complete cds, alternatively
             spliced
          Length = 28177

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 244   ggctgggggcgctgaggtgggggaggtggccctccg 279
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23241 ggctgggggggaggaggtgagggaggtggccctccg 23276
to top
>gb|AY242109.1| Sus scrofa JWB tyrosine hydroxylase (TH) gene, exon 14; preproinsulin
             (INS) gene, complete cds; and insulin-like growth factor 2
             preproprotein (IGF2) gene, complete cds, alternatively
             spliced
          Length = 28188

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 244   ggctgggggcgctgaggtgggggaggtggccctccg 279
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23269 ggctgggggggaggaggtgagggaggtggccctccg 23304
to top
>gb|AY242108.1| Sus scrofa LRJ tyrosine hydroxylase (TH) gene, exon 14 and partial cds;
             preproinsulin (INS) gene, complete cds; and insulin-like
             growth factor 2 preproprotein (IGF2) gene, complete cds,
             alternatively spliced
          Length = 28209

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 244   ggctgggggcgctgaggtgggggaggtggccctccg 279
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23290 ggctgggggggaggaggtgagggaggtggccctccg 23325
to top
>gb|AY242107.1| Sus scrofa LW1224 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28658

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 244   ggctgggggcgctgaggtgggggaggtggccctccg 279
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23538 ggctgggggggaggaggtgagggaggtggccctccg 23573
to top
>gb|AY242106.1| Sus scrofa LW1461 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28658

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 244   ggctgggggcgctgaggtgggggaggtggccctccg 279
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23538 ggctgggggggaggaggtgagggaggtggccctccg 23573
to top
>gb|AY242105.1| Sus scrofa LW197 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28267

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 244   ggctgggggcgctgaggtgggggaggtggccctccg 279
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23321 ggctgggggggaggaggtgagggaggtggccctccg 23356
to top
>gb|AY242104.1| Sus scrofa LW209 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28684

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 244   ggctgggggcgctgaggtgggggaggtggccctccg 279
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23564 ggctgggggggaggaggtgagggaggtggccctccg 23599
to top
>gb|AY242103.1| Sus scrofa LW3 tyrosine hydroxylase (TH) gene, exon 14 and partial cds;
             preproinsulin (INS) gene, complete cds; and insulin-like
             growth factor 2 preproprotein (IGF2) gene, complete cds,
             alternatively spliced
          Length = 28376

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 244   ggctgggggcgctgaggtgggggaggtggccctccg 279
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23390 ggctgggggggaggaggtgagggaggtggccctccg 23425
to top
>gb|AY242102.1| Sus scrofa LW33361 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28661

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 244   ggctgggggcgctgaggtgggggaggtggccctccg 279
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23541 ggctgggggggaggaggtgagggaggtggccctccg 23576
to top
>gb|AY242101.1| Sus scrofa LW419 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28659

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 244   ggctgggggcgctgaggtgggggaggtggccctccg 279
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23539 ggctgggggggaggaggtgagggaggtggccctccg 23574
to top
>gb|AY242100.1| Sus scrofa LW463 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28649

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 244   ggctgggggcgctgaggtgggggaggtggccctccg 279
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23528 ggctgggggggaggaggtgagggaggtggccctccg 23563
to top
>gb|AY242099.1| Sus scrofa M220 tyrosine hydroxylase (TH) gene, exon 14; preproinsulin
             (INS) gene, complete cds; and insulin-like growth factor 2
             preproprotein (IGF2) gene, complete cds, alternatively
             spliced
          Length = 28219

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 244   ggctgggggcgctgaggtgggggaggtggccctccg 279
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23266 ggctgggggggaggaggtgagggaggtggccctccg 23301
to top
>gb|AY242098.1| Sus scrofa P208 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28593

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 244   ggctgggggcgctgaggtgggggaggtggccctccg 279
             ||||||||| |  |||||| ||||||||||||||||
Sbjct: 23474 ggctgggggggaggaggtgagggaggtggccctccg 23509
to top
>gb|AC073349.11| Homo sapiens BAC clone RP11-797H7 from 7, complete sequence
          Length = 140861

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 168   tcttccctctctctttttta 187
             ||||||||||||||||||||
Sbjct: 29259 tcttccctctctctttttta 29278
to top
>emb|AL445195.4| Human DNA sequence from clone RP11-427O13 on chromosome 13 Contains 2
             NADH dehydrogenase pseudogenes and a novel gene, complete
             sequence
          Length = 172064

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 28    tttcttcctagtcttttgag 47
             ||||||||||||||||||||
Sbjct: 53546 tttcttcctagtcttttgag 53565
to top
>emb|AL354862.11| Human DNA sequence from clone RP11-83L6 on chromosome 9 Contains an
             olfactory receptor pseudsogene, the SYK gene for spleen
             tyrosine kinase and a CpG island, complete sequence
          Length = 153954

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 247   tgggggcgctgaggtggggg 266
             ||||||||||||||||||||
Sbjct: 60897 tgggggcgctgaggtggggg 60916
to top
>gb|AC159540.1| Homo sapiens BAC clone RP11-474M15 from 2, complete sequence
          Length = 173191

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 171   tccctctctcttttttaggggatt 194
             ||||||||||||||| ||||||||
Sbjct: 59928 tccctctctctttttgaggggatt 59951
to top
>emb|AL161517.2|ATCHRIV29 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 29
          Length = 199861

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 179   tcttttttaggggattttct 198
             ||||||||||||||||||||
Sbjct: 97013 tcttttttaggggattttct 96994
to top
>emb|AL049524.1|ATF7L13 Arabidopsis thaliana DNA chromosome 4, BAC clone  F7L13 (ESSA project)
          Length = 95076

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 179   tcttttttaggggattttct 198
             ||||||||||||||||||||
Sbjct: 37050 tcttttttaggggattttct 37031
to top
>emb|CR937046.1|PT147K15 Pan troglodytes chromosome 11 BAC PTB-147K15, complete sequence
          Length = 197298

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 166   tttcttccctctctcttttt 185
             ||||||||||||||||||||
Sbjct: 12554 tttcttccctctctcttttt 12573
to top
>gb|AC104411.5| Homo sapiens 3 BAC RP11-555M1 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 70499

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 255   ctgaggtgggggaggtggcc 274
             ||||||||||||||||||||
Sbjct: 61765 ctgaggtgggggaggtggcc 61784
to top
>gb|AC098642.5| Genomic sequence for Mus musculus, clone RP23-270O7, complete sequence
          Length = 188834

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   gctgaggtgggggaggtggc 273
             ||||||||||||||||||||
Sbjct: 90114 gctgaggtgggggaggtggc 90095
to top
>gb|AC011333.7| Homo sapiens chromosome 5 clone CTC-229L21, complete sequence
          Length = 159964

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 192    attttctactgctaaaaccg 211
              ||||||||||||||||||||
Sbjct: 154215 attttctactgctaaaaccg 154234
to top
>gb|AC021581.10| Homo sapiens chromosome 17, clone RP11-956N15, complete sequence
          Length = 181607

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 247   tgggggcgctgaggtggggg 266
             ||||||||||||||||||||
Sbjct: 87526 tgggggcgctgaggtggggg 87507
to top
>gb|AC010612.8| Homo sapiens chromosome 5 clone CTB-91C24, complete sequence
          Length = 139873

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 247   tgggggcgctgaggtggggg 266
             ||||||||||||||||||||
Sbjct: 50173 tgggggcgctgaggtggggg 50154
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 241      ggaggctgggggcgctgaggtggg 264
                ||||||||||||||||| ||||||
Sbjct: 28314495 ggaggctgggggcgctggggtggg 28314518
to top
>gb|AC006111.4| Homo sapiens chromosome 16 clone RP11-461A8, complete sequence
          Length = 190814

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 252    gcgctgaggtgggggaggtggccc 275
              |||| |||||||||||||||||||
Sbjct: 175495 gcgcggaggtgggggaggtggccc 175518
to top
>gb|AC092683.3| Homo sapiens BAC clone RP11-734K23 from 2, complete sequence
          Length = 174105

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 171    tccctctctcttttttaggggatt 194
              ||||||||||||||| ||||||||
Sbjct: 151639 tccctctctctttttgaggggatt 151616



 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 171   tccctctctcttttttaggggatt 194
             ||||||||||||||| ||||||||
Sbjct: 19506 tccctctctctttttgaggggatt 19529
to top
>gb|AC112907.7| Homo sapiens 3 BAC RP11-573D15 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 132875

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 66    gtaaaaatacagaaaagaaa 85
             ||||||||||||||||||||
Sbjct: 28394 gtaaaaatacagaaaagaaa 28413
to top
>gb|AC148032.2| Homo sapiens BAC clone RP13-809J14 from 2, complete sequence
          Length = 155256

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 171    tccctctctcttttttaggggatt 194
              ||||||||||||||| ||||||||
Sbjct: 103007 tccctctctctttttgaggggatt 103030
to top
>gb|AC025752.8| Homo sapiens chromosome 5 clone CTC-430J12, complete sequence
          Length = 189154

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 192    attttctactgctaaaaccg 211
              ||||||||||||||||||||
Sbjct: 139286 attttctactgctaaaaccg 139267
to top
>dbj|AP004300.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0470D12
          Length = 157248

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 241   ggaggctgggggcgctgaggtggg 264
             ||||||||||||||||| ||||||
Sbjct: 40058 ggaggctgggggcgctggggtggg 40081
to top
>emb|AL845273.7| Mouse DNA sequence from clone RP23-334D15 on chromosome 2, complete
            sequence
          Length = 158861

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 24   ccattttcttcctagtcttt 43
            ||||||||||||||||||||
Sbjct: 9650 ccattttcttcctagtcttt 9669
to top
>emb|AL603682.36| Mouse DNA sequence from clone RP23-235J5 on chromosome 11, complete
             sequence
          Length = 211680

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   gctgaggtgggggaggtggc 273
             ||||||||||||||||||||
Sbjct: 15365 gctgaggtgggggaggtggc 15384
to top
>emb|AL663072.12| Mouse DNA sequence from clone RP23-22J3 on chromosome X, complete
              sequence
          Length = 249536

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 250    gggcgctgaggtgggggagg 269
              ||||||||||||||||||||
Sbjct: 171274 gggcgctgaggtgggggagg 171255


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,229,774
Number of Sequences: 3902068
Number of extensions: 3229774
Number of successful extensions: 92047
Number of sequences better than 10.0: 59
Number of HSP's better than 10.0 without gapping: 59
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 91849
Number of HSP's gapped (non-prelim): 198
length of query: 299
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 277
effective length of database: 17,147,199,772
effective search space: 4749774336844
effective search space used: 4749774336844
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top