>gb|AC108773.9| Mus musculus chromosome 5, clone RP23-118L1, complete sequence
          Length = 222706

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    cctcactatcttattcagtt 30
             ||||||||||||||||||||
Sbjct: 36122 cctcactatcttattcagtt 36103

>emb|AL596132.7| Human DNA sequence from clone RP11-30A1 on chromosome 9 Contains part
             of the NTRK2 gene for Neurotrophic tyrosine kinase,
             receptor, type 2 (TRKB), complete sequence
          Length = 124156

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 101   cacctaggccttggccccaa 120
             ||||||||||||||||||||
Sbjct: 23969 cacctaggccttggccccaa 23950

>dbj|AP000056.1| Homo sapiens genomic DNA, chromosome 21q22.1, segment 27/28, complete
             sequence
          Length = 100000

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 119   aaaatccataggcttggcca 138
             ||||||||||||||||||||
Sbjct: 40661 aaaatccataggcttggcca 40642

>dbj|BS000192.1| Pan troglodytes chromosome 22 clone:PTB-125M11, map 22, complete
             sequences
          Length = 189269

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 119   aaaatccataggcttggcca 138
             ||||||||||||||||||||
Sbjct: 63845 aaaatccataggcttggcca 63826

>gb|AF074095.1|AF074095 Salvelinus namaycush clone A1 intergenic spacer region, partial
            sequence
          Length = 3114

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 17   tatcttattcagttccggcc 36
            ||||||||||||||||||||
Sbjct: 1853 tatcttattcagttccggcc 1872

>dbj|AP001720.1| Homo sapiens genomic DNA, chromosome 21q, section 64/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 119    aaaatccataggcttggcca 138
              ||||||||||||||||||||
Sbjct: 321532 aaaatccataggcttggcca 321513

>dbj|AP000330.3| Homo sapiens genomic DNA, chromosome 21 clone:RP1-140K16, complete
             sequence
          Length = 170368

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 119   aaaatccataggcttggcca 138
             ||||||||||||||||||||
Sbjct: 67121 aaaatccataggcttggcca 67102

>dbj|AP000171.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region, clone
             B2344F14-f50E8, segment 7/9, complete sequence
          Length = 100000

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 119   aaaatccataggcttggcca 138
             ||||||||||||||||||||
Sbjct: 31291 aaaatccataggcttggcca 31272


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,762,217
Number of Sequences: 3902068
Number of extensions: 1762217
Number of successful extensions: 28079
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 28070
Number of HSP's gapped (non-prelim): 9
length of query: 308
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 286
effective length of database: 17,147,199,772
effective search space: 4904099134792
effective search space used: 4904099134792
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)