ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart42g01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC010655.7| Homo sapiens chromosome 7 clone RP11-155G14, comp... 42 0.17
2emb|BX255893.5| Zebrafish DNA sequence from clone CH211-272H10 i... 42 0.17
3gb|AC147216.3| Pan troglodytes BAC clone RP43-156I12 from 7, com... 40 0.68
4gb|AY314773.1| Caenorhabditis elegans flamingo-like protein FMI-... 40 0.68
5emb|AL022477.1|HS172K10 Human DNA sequence from clone RP1-172K10... 40 0.68
6dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003 40 0.68
7ref|NM_073855.2| Caenorhabditis elegans F15B9.7 (cadherin) mRNA,... 40 0.68
8emb|Z78018.1|CEW07G4 Caenorhabditis elegans Cosmid W07G4, comple... 40 0.68
9gb|AC120984.3| Oryza sativa (japonica cultivar-group) chromosome... 38 2.7
10gb|AC120887.2| Oryza sativa (japonica cultivar-group) chromosome... 38 2.7
11emb|AL583830.7| Human DNA sequence from clone RP11-172L10 on chr... 38 2.7
12emb|AL139036.12| Human DNA sequence from clone RP11-285H24 on ch... 38 2.7
13gb|AC099563.3| Homo sapiens chromosome 1 clone RP11-323K10, comp... 38 2.7
14dbj|AP006716.1| Staphylococcus haemolyticus JCSC1435 DNA, comple... 38 2.7
15gb|AC093415.2| Homo sapiens chromosome 3 clone RP11-586N22, comp... 38 2.7
16gb|AC093201.3| Homo sapiens chromosome 5 clone CTC-223N18, compl... 38 2.7
17dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 38 2.7
18gb|AC155843.6| Mus musculus 6 BAC RP24-89H23 (Roswell Park Cance... 38 2.7
19dbj|AP003497.2| Homo sapiens genomic DNA, chromosome 11q clone:C... 38 2.7
20dbj|AP006194.1| Homo sapiens genomic DNA, chromosome 3, clone:RP... 38 2.7
21gb|AC153617.3| Mus musculus 6 BAC RP23-177G20 (Roswell Park Canc... 38 2.7
22gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 38 2.7
23emb|CR376779.18| Zebrafish DNA sequence from clone CH211-236N18 ... 38 2.7
24dbj|AP000495.1| Homo sapiens genomic DNA, chromosome 3p21.3, clo... 38 2.7

>gb|AC010655.7| Homo sapiens chromosome 7 clone RP11-155G14, complete sequence
          Length = 165090

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 7      aaatgaaacttcaatggaaacatct 31
              ||||||| |||||||||||||||||
Sbjct: 147301 aaatgaagcttcaatggaaacatct 147277



to top

>emb|BX255893.5| Zebrafish DNA sequence from clone CH211-272H10 in linkage group 4,
             complete sequence
          Length = 99176

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 10    tgaaacttcaatggaaacatctatt 34
             ||||||||||||||||| |||||||
Sbjct: 35322 tgaaacttcaatggaaaaatctatt 35346



to top

>gb|AC147216.3| Pan troglodytes BAC clone RP43-156I12 from 7, complete sequence
          Length = 199965

 Score = 40.1 bits (20), Expect = 0.68
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 13    aacttcaatggaaacatcta 32
             ||||||||||||||||||||
Sbjct: 74696 aacttcaatggaaacatcta 74715



to top

>gb|AY314773.1| Caenorhabditis elegans flamingo-like protein FMI-1 mRNA, complete cds
          Length = 7972

 Score = 40.1 bits (20), Expect = 0.68
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    gaattcaaatgaaacttcaa 20
            ||||||||||||||||||||
Sbjct: 4835 gaattcaaatgaaacttcaa 4816



to top

>emb|AL022477.1|HS172K10 Human DNA sequence from clone RP1-172K10 on chromosome 6q24, complete
             sequence
          Length = 82073

 Score = 40.1 bits (20), Expect = 0.68
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 45    gtctacaaccccactgccat 64
             ||||||||||||||||||||
Sbjct: 20541 gtctacaaccccactgccat 20522



to top

>dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003
          Length = 4170692

 Score = 40.1 bits (20), Expect = 0.68
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 13      aacttcaatggaaacatcta 32
               ||||||||||||||||||||
Sbjct: 3602534 aacttcaatggaaacatcta 3602553



to top

>ref|NM_073855.2| Caenorhabditis elegans F15B9.7 (cadherin) mRNA, complete cds
          Length = 7947

 Score = 40.1 bits (20), Expect = 0.68
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    gaattcaaatgaaacttcaa 20
            ||||||||||||||||||||
Sbjct: 4815 gaattcaaatgaaacttcaa 4796



to top

>emb|Z78018.1|CEW07G4 Caenorhabditis elegans Cosmid W07G4, complete sequence
          Length = 31001

 Score = 40.1 bits (20), Expect = 0.68
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    gaattcaaatgaaacttcaa 20
            ||||||||||||||||||||
Sbjct: 9653 gaattcaaatgaaacttcaa 9634



to top

>gb|AC120984.3| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
              OSJNBb0026G02, complete sequence
          Length = 123472

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 3      attcaaatgaaacttcaat 21
              |||||||||||||||||||
Sbjct: 108145 attcaaatgaaacttcaat 108127



 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 3     attcaaatgaaacttcaat 21
             |||||||||||||||||||
Sbjct: 88363 attcaaatgaaacttcaat 88345



to top

>gb|AC120887.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
            OSJNBa0088K21, complete sequence
          Length = 153239

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 3    attcaaatgaaacttcaat 21
            |||||||||||||||||||
Sbjct: 7062 attcaaatgaaacttcaat 7044



to top

>emb|AL583830.7| Human DNA sequence from clone RP11-172L10 on chromosome 1 Contains the
             5' end of a variant of the KCNK2 gene for potassium
             channel subfamily K member 2 and a translocase of inner
             mitochondrial membrane 17 homolog A (yeast) (TIMM17A)
             pseudogene, complete sequence
          Length = 151469

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 46    tctacaaccccactgccat 64
             |||||||||||||||||||
Sbjct: 95104 tctacaaccccactgccat 95122



to top

>emb|AL139036.12| Human DNA sequence from clone RP11-285H24 on chromosome 13q22.1-22.3
             Contains the 5' end of the KLF12 gene for Kruppel-like
             factor 12, complete sequence
          Length = 109810

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 7     aaatgaaacttcaatggaa 25
             |||||||||||||||||||
Sbjct: 34823 aaatgaaacttcaatggaa 34841



to top

>gb|AC099563.3| Homo sapiens chromosome 1 clone RP11-323K10, complete sequence
          Length = 91282

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 46    tctacaaccccactgccat 64
             |||||||||||||||||||
Sbjct: 58201 tctacaaccccactgccat 58183



to top

>dbj|AP006716.1| Staphylococcus haemolyticus JCSC1435 DNA, complete genome
          Length = 2685015

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                      
Query: 8       aatgaaacttcaatggaaacatc 30
               ||||||||| |||||||||||||
Sbjct: 2505504 aatgaaactgcaatggaaacatc 2505482



to top

>gb|AC093415.2| Homo sapiens chromosome 3 clone RP11-586N22, complete sequence
          Length = 196641

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 3      attcaaatgaaacttcaat 21
              |||||||||||||||||||
Sbjct: 147636 attcaaatgaaacttcaat 147618



to top

>gb|AC093201.3| Homo sapiens chromosome 5 clone CTC-223N18, complete sequence
          Length = 135976

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 2      aattcaaatgaaacttcaa 20
              |||||||||||||||||||
Sbjct: 102103 aattcaaatgaaacttcaa 102121



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 3        attcaaatgaaacttcaat 21
                |||||||||||||||||||
Sbjct: 22747345 attcaaatgaaacttcaat 22747327



 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 3        attcaaatgaaacttcaat 21
                |||||||||||||||||||
Sbjct: 22727563 attcaaatgaaacttcaat 22727545



to top

>gb|AC155843.6| Mus musculus 6 BAC RP24-89H23 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 210908

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 1      gaattcaaatgaaacttca 19
              |||||||||||||||||||
Sbjct: 162310 gaattcaaatgaaacttca 162292



to top

>dbj|AP003497.2| Homo sapiens genomic DNA, chromosome 11q clone:CTD-2028E8, complete
             sequence
          Length = 106081

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 2     aattcaaatgaaacttcaa 20
             |||||||||||||||||||
Sbjct: 47770 aattcaaatgaaacttcaa 47752



to top

>dbj|AP006194.1| Homo sapiens genomic DNA, chromosome 3, clone:RP11-81G2, complete
             sequence
          Length = 147925

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 3     attcaaatgaaacttcaat 21
             |||||||||||||||||||
Sbjct: 49319 attcaaatgaaacttcaat 49337



to top

>gb|AC153617.3| Mus musculus 6 BAC RP23-177G20 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 199525

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 1      gaattcaaatgaaacttca 19
              |||||||||||||||||||
Sbjct: 189887 gaattcaaatgaaacttca 189905



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 3        attcaaatgaaacttcaat 21
                |||||||||||||||||||
Sbjct: 23057255 attcaaatgaaacttcaat 23057237



 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 3        attcaaatgaaacttcaat 21
                |||||||||||||||||||
Sbjct: 23037474 attcaaatgaaacttcaat 23037456



to top

>emb|CR376779.18| Zebrafish DNA sequence from clone CH211-236N18 in linkage group 7,
             complete sequence
          Length = 177160

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 1     gaattcaaatgaaacttca 19
             |||||||||||||||||||
Sbjct: 44600 gaattcaaatgaaacttca 44618



to top

>dbj|AP000495.1| Homo sapiens genomic DNA, chromosome 3p21.3, clone:301 to 308,
             anti-oncogene region, section 3/5
          Length = 100000

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 3     attcaaatgaaacttcaat 21
             |||||||||||||||||||
Sbjct: 30672 attcaaatgaaacttcaat 30690


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 596,133
Number of Sequences: 3902068
Number of extensions: 596133
Number of successful extensions: 41974
Number of sequences better than 10.0: 24
Number of HSP's better than 10.0 without gapping: 24
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41913
Number of HSP's gapped (non-prelim): 61
length of query: 69
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 48
effective length of database: 17,151,101,840
effective search space: 823252888320
effective search space used: 823252888320
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top