ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart42f02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_193146.1| Oryza sativa (japonica cultivar-group), predic... 159 1e-35
2dbj|AK063442.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 1e-35
3dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 90 8e-15
4dbj|AP004357.4| Oryza sativa (japonica cultivar-group) genomic D... 90 8e-15
5dbj|AP004641.2| Oryza sativa (japonica cultivar-group) genomic D... 90 8e-15
6gb|BT016271.1| Zea mays clone Contig104 mRNA sequence 88 3e-14
7gb|AY111921.1| Zea mays CL10561_-2 mRNA sequence 60 7e-06
8gb|AY109479.1| Zea mays CL10561_1 mRNA sequence 60 7e-06
9ref|NM_125526.3| Arabidopsis thaliana unknown protein AT5G61330 ... 46 0.11
10gb|BT004561.1| Arabidopsis thaliana At5g61330 gene, complete cds 46 0.11
11emb|AL390198.17| Human DNA sequence from clone RP13-401N8 on chr... 44 0.44
12gb|AC096750.3| Homo sapiens BAC clone RP11-426F15 from 4, comple... 44 0.44
13gb|AC079899.16| Homo sapiens 4 BAC RP11-399C9 (Roswell Park Canc... 44 0.44
14gb|AC144402.2| Atelerix albiventris clone LBNL4-89B6, complete s... 42 1.7
15emb|AL592431.15| Human DNA sequence from clone RP11-145M4 on chr... 42 1.7
16emb|AL159155.8| Human DNA sequence from clone RP11-46I10 on chro... 42 1.7
17gb|AC021607.9| Homo sapiens chromosome 18, clone RP11-233O10, co... 42 1.7
18gb|AC007070.5| Arabidopsis thaliana chromosome 2 clone T22F11 ma... 42 1.7
19gb|AC016401.9| Homo sapiens chromosome 18, clone RP11-324I13, co... 42 1.7
20gb|AC159132.2| Pan troglodytes BAC clone CH251-542P7 from chromo... 42 1.7
21emb|BX664728.8| Zebrafish DNA sequence from clone CH211-108M10 i... 42 1.7
22gb|AC006991.3|AC006991 Homo sapiens BAC clone RP11-270H4 from Y,... 42 1.7
23dbj|AP003902.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
24gb|AC009947.2|AC009947 Homo sapiens BAC clone RP11-39P20 from Y,... 42 1.7
25ref|NG_004755.1| Homo sapiens chromosome Y palindromes P1, P2, P... 42 1.7
26emb|BX072535.4| Zebrafish DNA sequence from clone CH211-128E5, c... 42 1.7
27gb|AC165299.13| Mus musculus chromosome 15, clone RP23-266F2, co... 40 6.8
28gb|AC108393.10| Mus musculus chromosome 3, clone RP23-388A19, co... 40 6.8
29gb|AC101757.12| Mus musculus chromosome 8, clone RP24-545I11, co... 40 6.8
30ref|XM_706916.1| Candida albicans SC5314 hypothetical protein (C... 40 6.8
31ref|XM_706896.1| Candida albicans SC5314 hypothetical protein (C... 40 6.8
32gb|AC161236.6| Mus musculus chromosome 3, clone RP23-403O4, comp... 40 6.8
33gb|AC125182.3| Mus musculus BAC clone RP23-293D23 from 15, compl... 40 6.8
34emb|AJ298068.1|SWH298068 Soil-borne wheat mosaic virus ORF1, ORF... 40 6.8
35gb|AC119750.2| Homo sapiens chromosome 1 clone RP11-459K23, comp... 40 6.8
36gb|AC106038.3| Homo sapiens chromosome 8, clone RP11-68L18, comp... 40 6.8
37gb|AC093421.2| Homo sapiens chromosome 1 clone RP11-337M6, compl... 40 6.8
38gb|AF332093.1|AF332093 White spot syndrome virus, complete genome 40 6.8
39gb|AF411637.1|AF411637 White spot syndrome virus ORF21 gene, par... 40 6.8
40gb|AF369029.2| White spot syndrome virus, complete genome 40 6.8
41gb|AF146280.2|AF146280 Soil-borne rye mosaic virus strain O RNA... 40 6.8
42emb|AJ252151.1|EWH252151 European wheat mosaic virus RNA1 comple... 40 6.8
43emb|AJ132576.1|EWH132576 Soil-borne cereal mosaic virus RNA1 com... 40 6.8
44gb|AF440570.1| Shrimp white spot syndrome virus, complete genome 40 6.8
45gb|AF146279.1|AF146279 Soil-borne rye mosaic virus strain C RNA... 40 6.8
46gb|AF146278.1|AF146278 Soil-borne rye mosaic virus strain G RNA1... 40 6.8
47gb|AC074311.28| Mus musculus strain C57BL/6J chromosome 1 clone ... 40 6.8
48gb|AC133181.2| Mus musculus BAC clone RP24-169F11 from 8, comple... 40 6.8
49emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 40 6.8
50dbj|AP007299.1| Lotus japonicus genomic DNA, clone:LjT30I08, TM0... 40 6.8
51dbj|AB030447.1| Cyprinus carpio MRPb and MASPb genes for mannose... 40 6.8
52dbj|AB015752.1| Homo sapiens genomic DNA, chromosome 8q21, BAC c... 40 6.8 
>ref|NM_193146.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1260

 Score =  159 bits (80), Expect = 1e-35
 Identities = 167/196 (85%)
 Strand = Plus / Minus

                                                                        
Query: 290  ggttgcccattccaaacaaattctcgaacaatttcgaagccattggaggaaccgtcatag 349
            |||| ||||| |||||||||||||| |||||||| | ||||||||||||||    ||| |
Sbjct: 1240 ggtttcccatcccaaacaaattctcaaacaattttggagccattggaggaataaccatgg 1181

                                                                        
Query: 350  gcaccggggccatgaaattagcaatcttctcgtgaacactgtaccttatctttctgcttt 409
            | || |||||||||||||| |||||||||||||| |||  ||| |||||||||||||| |
Sbjct: 1180 gtactggggccatgaaatttgcaatcttctcgtggacatggtatcttatctttctgctct 1121

                                                                        
Query: 410  ttgaagcgcggcgatcaacgagttttcttttcttattctgcttcttcctcagagcataaa 469
            | ||||| || |||||||| |||||||| || |||| ||||| |||| | ||||||||||
Sbjct: 1120 tcgaagcacgacgatcaaccagttttctctttttatgctgctgcttctttagagcataaa 1061

                            
Query: 470  atgcagactcagatgc 485
            |||| |||||||||||
Sbjct: 1060 atgctgactcagatgc 1045
to top
>dbj|AK063442.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-115-F02, full
            insert sequence
          Length = 1661

 Score =  159 bits (80), Expect = 1e-35
 Identities = 167/196 (85%)
 Strand = Plus / Minus

                                                                        
Query: 290  ggttgcccattccaaacaaattctcgaacaatttcgaagccattggaggaaccgtcatag 349
            |||| ||||| |||||||||||||| |||||||| | ||||||||||||||    ||| |
Sbjct: 1312 ggtttcccatcccaaacaaattctcaaacaattttggagccattggaggaataaccatgg 1253

                                                                        
Query: 350  gcaccggggccatgaaattagcaatcttctcgtgaacactgtaccttatctttctgcttt 409
            | || |||||||||||||| |||||||||||||| |||  ||| |||||||||||||| |
Sbjct: 1252 gtactggggccatgaaatttgcaatcttctcgtggacatggtatcttatctttctgctct 1193

                                                                        
Query: 410  ttgaagcgcggcgatcaacgagttttcttttcttattctgcttcttcctcagagcataaa 469
            | ||||| || |||||||| |||||||| || |||| ||||| |||| | ||||||||||
Sbjct: 1192 tcgaagcacgacgatcaaccagttttctctttttatgctgctgcttctttagagcataaa 1133

                            
Query: 470  atgcagactcagatgc 485
            |||| |||||||||||
Sbjct: 1132 atgctgactcagatgc 1117
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 81/93 (87%)
 Strand = Plus / Minus

                                                                            
Query: 387      actgtaccttatctttctgctttttgaagcgcggcgatcaacgagttttcttttcttatt 446
                ||||||||||||||||||||| || ||||| || |||||||| |||||||| || |||| 
Sbjct: 18852852 actgtaccttatctttctgctcttcgaagcacgacgatcaaccagttttctctttttatg 18852793

                                                 
Query: 447      ctgcttcttcctcagagcataaaatgcagactc 479
                ||||| |||| | |||||||||||||| |||||
Sbjct: 18852792 ctgctgcttctttagagcataaaatgctgactc 18852760



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                            
Query: 290      ggttgcccattccaaacaaattctcgaacaatttcgaagccattggaggaaccgtcatag 349
                |||| ||||| |||||||||||||| |||||||| | ||||||||||||||    ||| |
Sbjct: 18853068 ggtttcccatcccaaacaaattctcaaacaattttggagccattggaggaataaccatgg 18853009

                                                  
Query: 350      gcaccggggccatgaaattagcaatcttctcgtg 383
                | || |||||||||||||| ||||||||||||||
Sbjct: 18853008 gtactggggccatgaaatttgcaatcttctcgtg 18852975



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 181      aagttttgtagtgttactgca 201
                |||||||||||||||||||||
Sbjct: 20860275 aagttttgtagtgttactgca 20860295
to top
>dbj|AP004357.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1074C08
          Length = 165701

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 81/93 (87%)
 Strand = Plus / Minus

                                                                         
Query: 387   actgtaccttatctttctgctttttgaagcgcggcgatcaacgagttttcttttcttatt 446
             ||||||||||||||||||||| || ||||| || |||||||| |||||||| || |||| 
Sbjct: 25242 actgtaccttatctttctgctcttcgaagcacgacgatcaaccagttttctctttttatg 25183

                                              
Query: 447   ctgcttcttcctcagagcataaaatgcagactc 479
             ||||| |||| | |||||||||||||| |||||
Sbjct: 25182 ctgctgcttctttagagcataaaatgctgactc 25150



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                         
Query: 290   ggttgcccattccaaacaaattctcgaacaatttcgaagccattggaggaaccgtcatag 349
             |||| ||||| |||||||||||||| |||||||| | ||||||||||||||    ||| |
Sbjct: 25458 ggtttcccatcccaaacaaattctcaaacaattttggagccattggaggaataaccatgg 25399

                                               
Query: 350   gcaccggggccatgaaattagcaatcttctcgtg 383
             | || |||||||||||||| ||||||||||||||
Sbjct: 25398 gtactggggccatgaaatttgcaatcttctcgtg 25365
to top
>dbj|AP004641.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1147B04
          Length = 142956

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 81/93 (87%)
 Strand = Plus / Minus

                                                                         
Query: 387   actgtaccttatctttctgctttttgaagcgcggcgatcaacgagttttcttttcttatt 446
             ||||||||||||||||||||| || ||||| || |||||||| |||||||| || |||| 
Sbjct: 59863 actgtaccttatctttctgctcttcgaagcacgacgatcaaccagttttctctttttatg 59804

                                              
Query: 447   ctgcttcttcctcagagcataaaatgcagactc 479
             ||||| |||| | |||||||||||||| |||||
Sbjct: 59803 ctgctgcttctttagagcataaaatgctgactc 59771



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                         
Query: 290   ggttgcccattccaaacaaattctcgaacaatttcgaagccattggaggaaccgtcatag 349
             |||| ||||| |||||||||||||| |||||||| | ||||||||||||||    ||| |
Sbjct: 60079 ggtttcccatcccaaacaaattctcaaacaattttggagccattggaggaataaccatgg 60020

                                               
Query: 350   gcaccggggccatgaaattagcaatcttctcgtg 383
             | || |||||||||||||| ||||||||||||||
Sbjct: 60019 gtactggggccatgaaatttgcaatcttctcgtg 59986
to top
>gb|BT016271.1| Zea mays clone Contig104 mRNA sequence
          Length = 1430

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 301 ccaaacaaattctcgaacaatttcgaagccattggaggaaccgtcataggcaccggggcc 360
           ||||| |||||||| ||||| |||| ||||||||||||||    ||| ||| | ||||||
Sbjct: 986 ccaaataaattctcaaacaacttcggagccattggaggaagaaccatgggctctggggcc 927

                                                                       
Query: 361 atgaaattagcaatcttctcgtgaacactgtaccttatctttctgctttttgaagcgcgg 420
           ||||||||||  | |||||| || |||  ||||| ||||||||||||||||||||| || 
Sbjct: 926 atgaaattagtgaccttctcatggacatggtaccgtatctttctgctttttgaagcacga 867

                   
Query: 421 cgatcaac 428
           ||||||||
Sbjct: 866 cgatcaac 859
to top
>gb|AY111921.1| Zea mays CL10561_-2 mRNA sequence
          Length = 553

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 90/110 (81%)
 Strand = Plus / Minus

                                                                       
Query: 316 aacaatttcgaagccattggaggaaccgtcataggcaccggggccatgaaattagcaatc 375
           ||||| |||| ||||||||||||||    ||| ||| ||||||||||||||||||  |||
Sbjct: 375 aacaacttcggagccattggaggaagaaccatgggctccggggccatgaaattagggatc 316

                                                             
Query: 376 ttctcgtgaacactgtaccttatctttctgctttttgaagcgcggcgatc 425
           |||||| | |||  ||||| |||||| ||||| || ||||| || |||||
Sbjct: 315 ttctcggggacatggtaccgtatcttcctgctcttcgaagcacgacgatc 266
to top
>gb|AY109479.1| Zea mays CL10561_1 mRNA sequence
          Length = 1323

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 87/106 (82%)
 Strand = Plus / Minus

                                                                        
Query: 301  ccaaacaaattctcgaacaatttcgaagccattggaggaaccgtcataggcaccggggcc 360
            |||||||||||||| ||||| |||| ||||||||||| ||    ||| ||| | ||||||
Sbjct: 1045 ccaaacaaattctcaaacaacttcggagccattggagaaagaaccatgggctctggggcc 986

                                                          
Query: 361  atgaaattagcaatcttctcgtgaacactgtaccttatctttctgc 406
            ||||||||||  | |||||| || |||  | |||||||||||||||
Sbjct: 985  atgaaattagtgaccttctcatggacatgggaccttatctttctgc 940
to top
>ref|NM_125526.3| Arabidopsis thaliana unknown protein AT5G61330 mRNA, complete cds
          Length = 1551

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 371  caatcttctcgtgaacactgtaccttatctttctgctttttga 413
            |||||||||| |||||| | ||||| ||||||||||| |||||
Sbjct: 1338 caatcttctcatgaacattatacctgatctttctgctctttga 1296
to top
>gb|BT004561.1| Arabidopsis thaliana At5g61330 gene, complete cds
          Length = 1311

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 371  caatcttctcgtgaacactgtaccttatctttctgctttttga 413
            |||||||||| |||||| | ||||| ||||||||||| |||||
Sbjct: 1207 caatcttctcatgaacattatacctgatctttctgctctttga 1165
to top
>emb|AL390198.17| Human DNA sequence from clone RP13-401N8 on chromosome 20 Contains
            three novel genes, a vomeronasal organ phermone receptor
            family pseudogene, a novel zinc-finger pseudogene and
            nine CpG islands, complete sequence
          Length = 167717

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 456  cctcagagcataaaatgcagac 477
            ||||||||||||||||||||||
Sbjct: 9284 cctcagagcataaaatgcagac 9263
to top
>gb|AC096750.3| Homo sapiens BAC clone RP11-426F15 from 4, complete sequence
          Length = 159618

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 65    ttgcttatcctcttctatgttt 86
             ||||||||||||||||||||||
Sbjct: 79332 ttgcttatcctcttctatgttt 79311
to top
>gb|AC079899.16| Homo sapiens 4 BAC RP11-399C9 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 166679

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 65   ttgcttatcctcttctatgttt 86
            ||||||||||||||||||||||
Sbjct: 1417 ttgcttatcctcttctatgttt 1396
to top
>gb|AC144402.2| Atelerix albiventris clone LBNL4-89B6, complete sequence
          Length = 161430

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 446    tctgcttcttcctcagagcat 466
              |||||||||||||||||||||
Sbjct: 108309 tctgcttcttcctcagagcat 108289
to top
>emb|AL592431.15| Human DNA sequence from clone RP11-145M4 on chromosome 1 Contains part
             of a novel gene and three novel genes, complete sequence
          Length = 48658

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 431   gttttcttttcttattctgct 451
             |||||||||||||||||||||
Sbjct: 18780 gttttcttttcttattctgct 18800
to top
>emb|AL159155.8| Human DNA sequence from clone RP11-46I10 on chromosome 13, complete
             sequence
          Length = 152890

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 437   ttttcttattctgcttcttcc 457
             |||||||||||||||||||||
Sbjct: 97699 ttttcttattctgcttcttcc 97679
to top
>gb|AC021607.9| Homo sapiens chromosome 18, clone RP11-233O10, complete sequence
          Length = 157383

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 432   ttttcttttcttattctgctt 452
             |||||||||||||||||||||
Sbjct: 46303 ttttcttttcttattctgctt 46323
to top
>gb|AC007070.5| Arabidopsis thaliana chromosome 2 clone T22F11 map GPA1, complete
             sequence
          Length = 86017

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 432   ttttcttttcttattctgctt 452
             |||||||||||||||||||||
Sbjct: 34474 ttttcttttcttattctgctt 34494
to top
>gb|AC016401.9| Homo sapiens chromosome 18, clone RP11-324I13, complete sequence
          Length = 86811

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 432   ttttcttttcttattctgctt 452
             |||||||||||||||||||||
Sbjct: 40476 ttttcttttcttattctgctt 40456
to top
>gb|AC159132.2| Pan troglodytes BAC clone CH251-542P7 from chromosome unknown, complete
              sequence
          Length = 168297

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 432    ttttcttttcttattctgctt 452
              |||||||||||||||||||||
Sbjct: 117541 ttttcttttcttattctgctt 117561
to top
>emb|BX664728.8| Zebrafish DNA sequence from clone CH211-108M10 in linkage group 7,
             complete sequence
          Length = 101324

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 75    tcttctatgtttaacagatgaagaa 99
             |||||| ||||||||||||||||||
Sbjct: 50554 tcttctgtgtttaacagatgaagaa 50578
to top
>gb|AC006991.3|AC006991 Homo sapiens BAC clone RP11-270H4 from Y, complete sequence
          Length = 173242

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 441    cttattctgcttcttcctcag 461
              |||||||||||||||||||||
Sbjct: 146254 cttattctgcttcttcctcag 146234
to top
>dbj|AP003902.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1110C07
          Length = 173859

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 181   aagttttgtagtgttactgca 201
             |||||||||||||||||||||
Sbjct: 78717 aagttttgtagtgttactgca 78737
to top
>gb|AC009947.2|AC009947 Homo sapiens BAC clone RP11-39P20 from Y, complete sequence
          Length = 149230

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 441   cttattctgcttcttcctcag 461
             |||||||||||||||||||||
Sbjct: 18764 cttattctgcttcttcctcag 18784
to top
>ref|NG_004755.1| Homo sapiens chromosome Y palindromes P1, P2, P3 and inverted repeat IR2
               (P1-P2-P3-IR2@) on chromosome Y
          Length = 4538292

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 441     cttattctgcttcttcctcag 461
               |||||||||||||||||||||
Sbjct: 4405032 cttattctgcttcttcctcag 4405012



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 441     cttattctgcttcttcctcag 461
               |||||||||||||||||||||
Sbjct: 1643809 cttattctgcttcttcctcag 1643829
to top
>emb|BX072535.4| Zebrafish DNA sequence from clone CH211-128E5, complete sequence
          Length = 189694

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 75     tcttctatgtttaacagatgaagaa 99
              |||||| ||||||||||||||||||
Sbjct: 145748 tcttctgtgtttaacagatgaagaa 145724
to top
>gb|AC165299.13| Mus musculus chromosome 15, clone RP23-266F2, complete sequence
          Length = 186266

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 432   ttttcttttcttattctgcttctt 455
             |||| |||||||||||||||||||
Sbjct: 56854 tttttttttcttattctgcttctt 56831
to top
>gb|AC108393.10| Mus musculus chromosome 3, clone RP23-388A19, complete sequence
          Length = 178878

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 16    aaatacttgatttcataaat 35
             ||||||||||||||||||||
Sbjct: 27076 aaatacttgatttcataaat 27057
to top
>gb|AC101757.12| Mus musculus chromosome 8, clone RP24-545I11, complete sequence
          Length = 148875

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 278  ctgacttctgcaggttgcccattc 301
            |||||||||| |||||||||||||
Sbjct: 1179 ctgacttctggaggttgcccattc 1202
to top
>ref|XM_706916.1| Candida albicans SC5314 hypothetical protein (CaO19.8257), mRNA
          Length = 3837

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 432  ttttcttttcttattctgcttcttcctc 459
            |||||||||||| |||| ||||||||||
Sbjct: 3511 ttttcttttcttcttcttcttcttcctc 3484
to top
>ref|XM_706896.1| Candida albicans SC5314 hypothetical protein (CaO19.643), mRNA
          Length = 3837

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 432  ttttcttttcttattctgcttcttcctc 459
            |||||||||||| |||| ||||||||||
Sbjct: 3511 ttttcttttcttcttcttcttcttcctc 3484
to top
>gb|AC161236.6| Mus musculus chromosome 3, clone RP23-403O4, complete sequence
          Length = 206652

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 16    aaatacttgatttcataaat 35
             ||||||||||||||||||||
Sbjct: 31017 aaatacttgatttcataaat 31036
to top
>gb|AC125182.3| Mus musculus BAC clone RP23-293D23 from 15, complete sequence
          Length = 169841

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 430   agttttcttttcttattctg 449
             ||||||||||||||||||||
Sbjct: 63289 agttttcttttcttattctg 63308
to top
>emb|AJ298068.1|SWH298068 Soil-borne wheat mosaic virus ORF1, ORF1 readthrough and ORF3,
            genomic segment RNA1, (Wiltshire, UK)
          Length = 6981

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 136  attcataacactcatcttct 155
            ||||||||||||||||||||
Sbjct: 6097 attcataacactcatcttct 6078
to top
>gb|AC119750.2| Homo sapiens chromosome 1 clone RP11-459K23, complete sequence
          Length = 171596

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 466    taaaatgcagactcagatgc 485
              ||||||||||||||||||||
Sbjct: 161881 taaaatgcagactcagatgc 161900
to top
>gb|AC106038.3| Homo sapiens chromosome 8, clone RP11-68L18, complete sequence
          Length = 159024

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 391   taccttatctttctgctttt 410
             ||||||||||||||||||||
Sbjct: 90329 taccttatctttctgctttt 90310
to top
>gb|AC093421.2| Homo sapiens chromosome 1 clone RP11-337M6, complete sequence
          Length = 183974

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 466   taaaatgcagactcagatgc 485
             ||||||||||||||||||||
Sbjct: 45049 taaaatgcagactcagatgc 45068
to top
>gb|AF332093.1|AF332093 White spot syndrome virus, complete genome
          Length = 305107

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 433  tttcttttcttattctgcttcttcctca 460
            ||||||||||| |||| |||||||||||
Sbjct: 3947 tttcttttcttcttcttcttcttcctca 3920
to top
>gb|AF411637.1|AF411637 White spot syndrome virus ORF21 gene, partial sequence
          Length = 3903

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 433 tttcttttcttattctgcttcttcctca 460
           ||||||||||| |||| |||||||||||
Sbjct: 897 tttcttttcttcttcttcttcttcctca 870
to top
>gb|AF369029.2| White spot syndrome virus, complete genome
          Length = 292967

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 433   tttcttttcttattctgcttcttcctca 460
             ||||||||||| |||| |||||||||||
Sbjct: 52903 tttcttttcttcttcttcttcttcctca 52876
to top
>gb|AF146280.2|AF146280 Soil-borne rye mosaic virus strain O  RNA1 148K protein, 207K
            protein, and 37K protein genes, complete cds
          Length = 6985

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 136  attcataacactcatcttct 155
            ||||||||||||||||||||
Sbjct: 6103 attcataacactcatcttct 6084
to top
>emb|AJ252151.1|EWH252151 European wheat mosaic virus RNA1 complete sequence, genomic RNA
          Length = 7025

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 136  attcataacactcatcttct 155
            ||||||||||||||||||||
Sbjct: 6126 attcataacactcatcttct 6107
to top
>emb|AJ132576.1|EWH132576 Soil-borne cereal mosaic virus RNA1 complete genome
          Length = 7025

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 136  attcataacactcatcttct 155
            ||||||||||||||||||||
Sbjct: 6126 attcataacactcatcttct 6107
to top
>gb|AF440570.1| Shrimp white spot syndrome virus, complete genome
          Length = 307287

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 433   tttcttttcttattctgcttcttcctca 460
             ||||||||||| |||| |||||||||||
Sbjct: 37535 tttcttttcttcttcttcttcttcctca 37508
to top
>gb|AF146279.1|AF146279 Soil-borne rye mosaic virus strain C  RNA1 148K protein, 207K
            protein, and 37K protein genes, complete cds
          Length = 6985

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 136  attcataacactcatcttct 155
            ||||||||||||||||||||
Sbjct: 6103 attcataacactcatcttct 6084
to top
>gb|AF146278.1|AF146278 Soil-borne rye mosaic virus strain G RNA1 148K protein, 207K protein,
            and 37K protein genes, complete cds
          Length = 7026

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 136  attcataacactcatcttct 155
            ||||||||||||||||||||
Sbjct: 6127 attcataacactcatcttct 6108
to top
>gb|AC074311.28| Mus musculus strain C57BL/6J chromosome 1 clone rp23-157j4, complete
              sequence
          Length = 185871

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 433    tttcttttcttattctgcttcttcctca 460
              ||||||||||| |||| |||||||||||
Sbjct: 149733 tttcttttcttcttcttcttcttcctca 149706
to top
>gb|AC133181.2| Mus musculus BAC clone RP24-169F11 from 8, complete sequence
          Length = 140384

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 278    ctgacttctgcaggttgcccattc 301
              |||||||||| |||||||||||||
Sbjct: 104562 ctgacttctggaggttgcccattc 104585
to top
>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica
          Length = 4224103

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 254     acacctcctaaaatcagaccgcgg 277
               ||||||||||||||||| ||||||
Sbjct: 2136685 acacctcctaaaatcaggccgcgg 2136708
to top
>dbj|AP007299.1| Lotus japonicus genomic DNA, clone:LjT30I08, TM0492, complete sequence
          Length = 106844

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 352   accggggccatgaaattagcaatc 375
             |||||||||||||||||| |||||
Sbjct: 47330 accggggccatgaaattatcaatc 47307
to top
>dbj|AB030447.1| Cyprinus carpio MRPb and MASPb genes for mannose-binding
           lectin-associated serine protease (MASP) and
           MASP-related protein, complete cds
          Length = 2753

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 435 tcttttcttattctgcttct 454
           ||||||||||||||||||||
Sbjct: 581 tcttttcttattctgcttct 600
to top
>dbj|AB015752.1| Homo sapiens genomic DNA, chromosome 8q21, BAC clone 521F14, complete
              sequence
          Length = 116160

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 391    taccttatctttctgctttt 410
              ||||||||||||||||||||
Sbjct: 107466 taccttatctttctgctttt 107485


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,526,191
Number of Sequences: 3902068
Number of extensions: 5526191
Number of successful extensions: 110397
Number of sequences better than 10.0: 52
Number of HSP's better than 10.0 without gapping: 53
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 110164
Number of HSP's gapped (non-prelim): 225
length of query: 504
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 482
effective length of database: 17,147,199,772
effective search space: 8264950290104
effective search space used: 8264950290104
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top