No.
Definition
Score (bits)
E Value
1 gb|AF123608.1|AF123608 Triticum aestivum clone CYP73-TA cytochro...
281
1e-72
2 gb|AY104175.1| Zea mays PCO098406 mRNA sequence
198
1e-47
3 gb|AY034143.1| Sorghum bicolor cinnamic acid 4-hydroxylase (C4H)...
190
3e-45
4 gb|AC136224.2| Oryza sativa (japonica cultivar-group) chromosome...
188
1e-44
5 dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...
188
1e-44
6 dbj|AK104994.2| Oryza sativa (japonica cultivar-group) cDNA clon...
188
1e-44
7 dbj|AK100598.1| Oryza sativa (japonica cultivar-group) cDNA clon...
188
1e-44
8 dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...
125
1e-25
9 dbj|AP003446.3| Oryza sativa (japonica cultivar-group) genomic D...
125
1e-25
10 gb|AY616436.1| Agastache rugosa cinnamic acid 4-hydroxylase mRNA...
80
7e-12
11 gb|U19922.1|ZEU19922 Zinnia elegans cinnamic acid 4-hydroxylase ...
64
4e-07
12 gb|AC098866.3| Homo sapiens BAC clone RP11-404F3 from 4, complet...
46
0.10
13 gb|AC158158.6| Mus musculus chromosome 1, clone RP23-10D8, compl...
46
0.10
14 gb|AC110266.15| Mus musculus chromosome 1, clone RP23-319C1, com...
46
0.10
15 emb|AL133243.3|CNS01DUG BAC sequence from the SPG4 candidate reg...
46
0.10
16 gb|AY670393.1| Pinus taeda isolate 27 trans-cinnamate 4-hydroxyl...
44
0.41
17 gb|AY670388.1| Pinus taeda isolate 28 trans-cinnamate 4-hydroxyl...
44
0.41
18 gb|AY670384.1| Pinus taeda isolate 10 trans-cinnamate 4-hydroxyl...
44
0.41
19 gb|AY670382.1| Pinus taeda isolate 30 trans-cinnamate 4-hydroxyl...
44
0.41
20 gb|AY670380.1| Pinus taeda isolate 25 trans-cinnamate 4-hydroxyl...
44
0.41
21 gb|AY670377.1| Pinus taeda isolate 24 trans-cinnamate 4-hydroxyl...
44
0.41
22 gb|AY670376.1| Pinus taeda isolate 20 trans-cinnamate 4-hydroxyl...
44
0.41
23 gb|AY670375.1| Pinus taeda isolate 15 trans-cinnamate 4-hydroxyl...
44
0.41
24 gb|AY670372.1| Pinus taeda isolate 21 trans-cinnamate 4-hydroxyl...
44
0.41
25 gb|AY670371.1| Pinus taeda isolate 18 trans-cinnamate 4-hydroxyl...
44
0.41
26 gb|AY670370.1| Pinus taeda isolate 12 trans-cinnamate 4-hydroxyl...
44
0.41
27 gb|AY670367.1| Pinus taeda isolate 23 trans-cinnamate 4-hydroxyl...
44
0.41
28 gb|AY670363.1| Pinus taeda isolate 6 trans-cinnamate 4-hydroxyla...
44
0.41
29 gb|AY670362.1| Pinus taeda isolate 16 trans-cinnamate 4-hydroxyl...
44
0.41
30 gb|AC124764.3| Mus musculus BAC clone RP23-166K1 from chromosome...
44
0.41
31 emb|Z82201.1|HS345P10 Human DNA sequence from clone RP3-345P10 o...
44
0.41
32 emb|AL592163.1| Human DNA sequence from clone RP13-237P14 on chr...
44
0.41
33 gb|AF096998.1| Pinus taeda trans-cinnamate 4-hydroxylase (TC4H) ...
44
0.41
34 dbj|AB088224.1| Streptomyces rochei plasmid pSLA2-L DNA, complet...
44
0.41
35 gb|U55006.1|PEU55006 Pinus elliottii PEC18 mRNA, partial sequence
44
0.41
36 gb|AC160136.2| Mus musculus BAC clone RP23-125E11 from chromosom...
42
1.6
37 gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome
42
1.6
38 emb|BX255935.27| Zebrafish DNA sequence from clone DKEYP-46H4 in...
42
1.6
39 emb|CR847906.11| Zebrafish DNA sequence from clone DKEYP-4C4 in ...
42
1.6
40 gb|AC124424.4| Mus musculus BAC clone RP24-230J3 from chromosome...
42
1.6
41 emb|BX465848.13| Zebrafish DNA sequence from clone RP71-84E6, co...
42
1.6
42 emb|BX640547.35| Zebrafish DNA sequence from clone DKEY-4J21 in ...
42
1.6
43 emb|BX663505.11| Zebrafish DNA sequence from clone CH211-246N15 ...
42
1.6
44 gb|AC015542.17| Homo sapiens 3 BAC RP11-38B6 (Roswell Park Cance...
42
1.6
45 gb|AC078899.1|AC078899 Homo sapiens chromosome 19, BAC BC371065 ...
42
1.6
46 dbj|BA000011.4| Thermoplasma volcanium GSS1 DNA, complete genome
42
1.6
47 dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ...
42
1.6
48 emb|BX294118.4| Zebrafish DNA sequence from clone DKEYP-38B6, co...
42
1.6
49 emb|CR385078.23| Zebrafish DNA sequence from clone DKEYP-104F11 ...
42
1.6
50 emb|CR388148.20| Zebrafish DNA sequence from clone DKEY-25I10 in...
42
1.6
51 emb|BX914214.12| Zebrafish DNA sequence from clone DKEY-9I5 in l...
42
1.6
52 emb|AL844163.7| Mouse DNA sequence from clone RP23-467L21 on chr...
42
1.6
53 ref|NM_198321.2| Homo sapiens UDP-N-acetyl-alpha-D-galactosamine...
40
6.4
54 gb|AY528720.1| Danio rerio activation-induced cytidine deaminase...
40
6.4
55 gb|AY268139.1| Hordeum vulgare BAC 184G9, complete sequece
40
6.4
56 gb|AE006353.1| Lactococcus lactis subsp. lactis IL1403 section 1...
40
6.4
57 gb|BC050333.1| Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:p...
40
6.4
58 ref|XM_976546.1| PREDICTED: Mus musculus membrane-associated rin...
40
6.4
59 emb|CR293498.12| Zebrafish DNA sequence from clone DKEY-5I16 in ...
40
6.4
60 emb|BX927318.10| Zebrafish DNA sequence from clone DKEY-159N16 i...
40
6.4
61 gb|AC131703.3| Mus musculus BAC clone RP24-141B8 from chromosome...
40
6.4
62 emb|Z68114.1|CEF17A2 Caenorhabditis elegans Cosmid F17A2, comple...
40
6.4
63 ref|XM_816528.1| Trypanosoma cruzi strain CL Brener hypothetical...
40
6.4
64 emb|BX510909.19| Zebrafish DNA sequence from clone DKEY-195E19 i...
40
6.4
65 ref|XM_546283.2| PREDICTED: Canis familiaris similar to GalNAc t...
40
6.4
66 gb|AC079804.5| Homo sapiens BAC clone RP11-740N7 from 7, complet...
40
6.4
67 gb|AC163330.4| Mus musculus chromosome 5, clone RP23-167H23, com...
40
6.4
68 emb|CR450700.21| Zebrafish DNA sequence from clone DKEY-263H8 in...
40
6.4
69 gb|AC010295.7| Homo sapiens chromosome 5 clone CTB-143H13, compl...
40
6.4
70 ref|NM_001008403.1| Danio rerio activation-induced cytidine deam...
40
6.4
71 ref|XM_775811.1| PREDICTED: Strongylocentrotus purpuratus simila...
40
6.4
72 emb|CR555306.1| Azoarcus sp. EbN1 complete genome
40
6.4
73 gb|AC164627.4| Mus musculus 10 BAC RP23-382A18 (Roswell Park Can...
40
6.4
74 emb|AL731817.11| Mouse DNA sequence from clone RP23-3J16 on chro...
40
6.4
75 emb|BX511066.9| Zebrafish DNA sequence from clone CH211-129P6 in...
40
6.4
76 emb|BX088603.12| Zebrafish DNA sequence from clone DKEYP-44D3, c...
40
6.4
77 emb|BX664605.15| Zebrafish DNA sequence from clone DKEYP-53E4 in...
40
6.4
78 emb|BX000703.15| Zebrafish DNA sequence from clone CH211-276I6 i...
40
6.4
79 gb|AC148832.5| Pan troglodytes BAC clone CH251-48K6 from chromos...
40
6.4
80 gb|AF509764.1| Hordeum vulgare subsp. vulgare Gobernadora Rpg1 p...
40
6.4
81 gb|AF509763.1| Hordeum vulgare subsp. vulgare Dictoo Rpg1 pseudo...
40
6.4
82 gb|AF509762.1| Hordeum vulgare subsp. vulgare Sm89010 Rpg1 pseud...
40
6.4
83 dbj|AK127135.1| Homo sapiens cDNA FLJ45192 fis, clone BRAWH30495...
40
6.4
84 dbj|AK158026.1| Mus musculus adult inner ear cDNA, RIKEN full-le...
40
6.4
85 emb|BX649307.12| Zebrafish DNA sequence from clone CH211-209P16 ...
40
6.4
86 emb|BX324142.7| Zebrafish DNA sequence from clone CH211-196F19 i...
40
6.4
87 gb|AC157950.2| Mus musculus BAC clone RP23-128A23 from chromosom...
40
6.4
88 ref|NM_077656.1| Caenorhabditis elegans F17A2.3 (PHD-finger.) mR...
40
6.4
89 gb|AC148692.1| Macaca mulatta Major Histocompatibility Complex B...
40
6.4
90 gb|AC148662.1| Macaca mulatta Major Histocompatibility Complex B...
40
6.4
91 gb|AC148660.1| Macaca mulatta Major Histocompatibility Complex B...
40
6.4
92 gb|AY641412.1| Hordeum vulgare subsp. vulgare retrotransposon Sa...
40
6.4
93 gb|AF036414.1|AF036414 Trypanosoma cruzi mucin-like protein (EMU...
40
6.4
94 gb|DQ075002.1| Malus x domestica cinnamic acid hydroxylase (C4H1...
40
6.4
95 emb|BX649499.11| Zebrafish DNA sequence from clone DKEY-60A16 in...
40
6.4
96 emb|BX279523.5| Zebrafish DNA sequence from clone CH211-63O20 in...
40
6.4
97 gb|BC059615.1| Danio rerio flavoprotein oxidoreductase MICAL3, m...
40
6.4
98 emb|CT025669.8| Zebrafish DNA sequence from clone DKEY-256E21 in...
40
6.4
99 gb|AY705658.1| Oikopleura dioica homeodomain protein Msx (Msx) g...
40
6.4
100 ref|NM_001033262.1| Mus musculus membrane-associated ring finger...
40
6.4
101 dbj|AP003467.2| Homo sapiens genomic DNA, chromosome 8q23, clone...
40
6.4
102 emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chro...
40
6.4
103 gb|AC131760.4| Mus musculus BAC clone RP24-220M2 from 10, comple...
40
6.4
104 gb|AC134329.3| Mus musculus BAC clone RP24-310D17 from 10, compl...
40
6.4
105 gb|AC139322.4| Mus musculus BAC clone RP24-397L22 from 9, comple...
40
6.4
106 gb|U92974.1|LLU92974 Lactococcus lactis unknown gene, partial cd...
40
6.4
107 emb|AL929029.7| Zebrafish DNA sequence from clone CH211-15F21, c...
40
6.4
108 emb|CR848818.10| Zebrafish DNA sequence from clone DKEY-38O19 in...
40
6.4
109 dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp...
40
6.4
110 gb|AC164629.14| Mus musculus 10 BAC RP23-16N3 (Roswell Park Canc...
40
6.4
>emb|BX255935.27 | Zebrafish DNA sequence from clone DKEYP-46H4 in linkage group 14,
complete sequence
Length = 163552
Score = 42.1 bits (21), Expect = 1.6
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttta 46
|||||||||||||||||||||
Sbjct: 12173 ttttcattttttgtgatttta 12153
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 16195 ttttcattttttgtgatttt 16176
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 16167 ttttcattttttgtgatttt 16148
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 15014 ttttcattttttgtgatttt 14995
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 27 tttcattttttgtgatttta 46
||||||||||||||||||||
Sbjct: 13091 tttcattttttgtgatttta 13072
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 12560 ttttcattttttgtgatttt 12541
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 27 tttcattttttgtgatttta 46
||||||||||||||||||||
Sbjct: 12412 tttcattttttgtgatttta 12393
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 12358 ttttcattttttgtgatttt 12339
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 12118 ttttcattttttgtgatttt 12099
>emb|CR847906.11 | Zebrafish DNA sequence from clone DKEYP-4C4 in linkage group 6, complete
sequence
Length = 198346
Score = 42.1 bits (21), Expect = 1.6
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttta 46
|||||||||||||||||||||
Sbjct: 179966 ttttcattttttgtgatttta 179946
Score = 42.1 bits (21), Expect = 1.6
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttta 46
|||||||||||||||||||||
Sbjct: 178662 ttttcattttttgtgatttta 178642
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 180417 ttttcattttttgtgatttt 180398
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 180296 ttttcattttttgtgatttt 180277
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 179901 ttttcattttttgtgatttt 179882
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 179754 ttttcattttttgtgatttt 179735
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 179528 ttttcattttttgtgatttt 179509
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 179381 ttttcattttttgtgatttt 179362
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 179130 ttttcattttttgtgatttt 179111
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 178850 ttttcattttttgtgatttt 178831
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 178540 ttttcattttttgtgatttt 178521
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 178418 ttttcattttttgtgatttt 178399
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 178286 ttttcattttttgtgatttt 178267
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 178192 ttttcattttttgtgatttt 178173
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 178061 ttttcattttttgtgatttt 178042
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 177675 ttttcattttttgtgatttt 177656
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 177479 ttttcattttttgtgatttt 177460
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 177386 ttttcattttttgtgatttt 177367
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 177125 ttttcattttttgtgatttt 177106
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 176809 ttttcattttttgtgatttt 176790
>emb|BX465848.13 | Zebrafish DNA sequence from clone RP71-84E6, complete sequence
Length = 179411
Score = 42.1 bits (21), Expect = 1.6
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttta 46
|||||||||||||||||||||
Sbjct: 161410 ttttcattttttgtgatttta 161430
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 163918 ttttcattttttgtgatttt 163937
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 163447 ttttcattttttgtgatttt 163466
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 27 tttcattttttgtgatttta 46
||||||||||||||||||||
Sbjct: 163013 tttcattttttgtgatttta 163032
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 161837 ttttcattttttgtgatttt 161856
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 161500 ttttcattttttgtgatttt 161519
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 161464 ttttcattttttgtgatttt 161483
>emb|BX663505.11 | Zebrafish DNA sequence from clone CH211-246N15 in linkage group 5,
complete sequence
Length = 152339
Score = 42.1 bits (21), Expect = 1.6
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttta 46
|||||||||||||||||||||
Sbjct: 84365 ttttcattttttgtgatttta 84385
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 85145 ttttcattttttgtgatttt 85164
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 84985 ttttcattttttgtgatttt 85004
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 84901 ttttcattttttgtgatttt 84920
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 84663 ttttcattttttgtgatttt 84682
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 84635 ttttcattttttgtgatttt 84654
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 84607 ttttcattttttgtgatttt 84626
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 84064 ttttcattttttgtgatttt 84083
>emb|CR385078.23 | Zebrafish DNA sequence from clone DKEYP-104F11 in linkage group 20,
complete sequence
Length = 182152
Score = 42.1 bits (21), Expect = 1.6
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttta 46
|||||||||||||||||||||
Sbjct: 12743 ttttcattttttgtgatttta 12723
Score = 42.1 bits (21), Expect = 1.6
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttta 46
|||||||||||||||||||||
Sbjct: 11980 ttttcattttttgtgatttta 11960
Score = 42.1 bits (21), Expect = 1.6
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttta 46
|||||||||||||||||||||
Sbjct: 11508 ttttcattttttgtgatttta 11488
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 12336 ttttcattttttgtgatttt 12317
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 12111 ttttcattttttgtgatttt 12092
>emb|CR388148.20 | Zebrafish DNA sequence from clone DKEY-25I10 in linkage group 14,
complete sequence
Length = 118718
Score = 42.1 bits (21), Expect = 1.6
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttta 46
|||||||||||||||||||||
Sbjct: 87316 ttttcattttttgtgatttta 87296
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 87512 ttttcattttttgtgatttt 87493
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 87250 ttttcattttttgtgatttt 87231
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 86593 ttttcattttttgtgatttt 86574
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 86048 ttttcattttttgtgatttt 86029
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 85642 ttttcattttttgtgatttt 85623
>emb|BX914214.12 | Zebrafish DNA sequence from clone DKEY-9I5 in linkage group 3, complete
sequence
Length = 137573
Score = 42.1 bits (21), Expect = 1.6
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 25 gttttcattttttgtgatttt 45
|||||||||||||||||||||
Sbjct: 54629 gttttcattttttgtgatttt 54649
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 57167 ttttcattttttgtgatttt 57186
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 56805 ttttcattttttgtgatttt 56824
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 56394 ttttcattttttgtgatttt 56413
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 56217 ttttcattttttgtgatttt 56236
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 56123 ttttcattttttgtgatttt 56142
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 55813 ttttcattttttgtgatttt 55832
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 55644 ttttcattttttgtgatttt 55663
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 55360 ttttcattttttgtgatttt 55379
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 53470 ttttcattttttgtgatttt 53489
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 53213 ttttcattttttgtgatttt 53232
>emb|CR293498.12 | Zebrafish DNA sequence from clone DKEY-5I16 in linkage group 23,
complete sequence
Length = 147189
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 10773 ttttcattttttgtgatttt 10754
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 10642 ttttcattttttgtgatttt 10623
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 10520 ttttcattttttgtgatttt 10501
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 10454 ttttcattttttgtgatttt 10435
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 10321 ttttcattttttgtgatttt 10302
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 9445 ttttcattttttgtgatttt 9426
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 9408 ttttcattttttgtgatttt 9389
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 9114 ttttcattttttgtgatttt 9095
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 8918 ttttcattttttgtgatttt 8899
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 8620 ttttcattttttgtgatttt 8601
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 8394 ttttcattttttgtgatttt 8375
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 7698 ttttcattttttgtgatttt 7679
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 7567 ttttcattttttgtgatttt 7548
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 7491 ttttcattttttgtgatttt 7472
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 7026 ttttcattttttgtgatttt 7007
>emb|BX927318.10 | Zebrafish DNA sequence from clone DKEY-159N16 in linkage group 23,
complete sequence
Length = 149430
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 73929 ttttcattttttgtgatttt 73910
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 73798 ttttcattttttgtgatttt 73779
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 73676 ttttcattttttgtgatttt 73657
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 73610 ttttcattttttgtgatttt 73591
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 73477 ttttcattttttgtgatttt 73458
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 72417 ttttcattttttgtgatttt 72398
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 71716 ttttcattttttgtgatttt 71697
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 71585 ttttcattttttgtgatttt 71566
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 71509 ttttcattttttgtgatttt 71490
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 71275 ttttcattttttgtgatttt 71256
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 71199 ttttcattttttgtgatttt 71180
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 70734 ttttcattttttgtgatttt 70715
>emb|BX510909.19 | Zebrafish DNA sequence from clone DKEY-195E19 in linkage group 5,
complete sequence
Length = 190731
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 38354 ttttcattttttgtgatttt 38373
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 38270 ttttcattttttgtgatttt 38289
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 37115 ttttcattttttgtgatttt 37134
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 36801 ttttcattttttgtgatttt 36820
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 36546 ttttcattttttgtgatttt 36565
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 36518 ttttcattttttgtgatttt 36537
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 35612 ttttcattttttgtgatttt 35631
>emb|BX664605.15 | Zebrafish DNA sequence from clone DKEYP-53E4 in linkage group 21,
complete sequence
Length = 170126
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 52641 ttttcattttttgtgatttt 52660
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 52421 ttttcattttttgtgatttt 52440
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 52330 ttttcattttttgtgatttt 52349
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 52274 ttttcattttttgtgatttt 52293
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 52078 ttttcattttttgtgatttt 52097
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 51685 ttttcattttttgtgatttt 51704
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 51647 ttttcattttttgtgatttt 51666
>emb|BX000703.15 | Zebrafish DNA sequence from clone CH211-276I6 in linkage group 14,
complete sequence
Length = 156295
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 133757 ttttcattttttgtgatttt 133738
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 132849 ttttcattttttgtgatttt 132830
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 132594 ttttcattttttgtgatttt 132575
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 131584 ttttcattttttgtgatttt 131565
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 131515 ttttcattttttgtgatttt 131496
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 131355 ttttcattttttgtgatttt 131336
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 131273 ttttcattttttgtgatttt 131254
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 128222 ttttcattttttgtgatttt 128241
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 127917 ttttcattttttgtgatttt 127936
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 127879 ttttcattttttgtgatttt 127898
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 127597 ttttcattttttgtgatttt 127616
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 127559 ttttcattttttgtgatttt 127578
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 127364 ttttcattttttgtgatttt 127383
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 127218 ttttcattttttgtgatttt 127237
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 127132 ttttcattttttgtgatttt 127151
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 126786 ttttcattttttgtgatttt 126805
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 126640 ttttcattttttgtgatttt 126659
>emb|BX649307.12 | Zebrafish DNA sequence from clone CH211-209P16 in linkage group 4,
complete sequence
Length = 164976
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 10711 ttttcattttttgtgatttt 10730
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 10639 ttttcattttttgtgatttt 10658
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 10450 ttttcattttttgtgatttt 10469
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 9751 ttttcattttttgtgatttt 9770
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 9558 ttttcattttttgtgatttt 9577
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 9411 ttttcattttttgtgatttt 9430
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 9328 ttttcattttttgtgatttt 9347
>emb|BX324142.7 | Zebrafish DNA sequence from clone CH211-196F19 in linkage group 20,
complete sequence
Length = 177066
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 89313 ttttcattttttgtgatttt 89332
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 88686 ttttcattttttgtgatttt 88705
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 88434 ttttcattttttgtgatttt 88453
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 87369 ttttcattttttgtgatttt 87388
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 87331 ttttcattttttgtgatttt 87350
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 87293 ttttcattttttgtgatttt 87312
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 86966 ttttcattttttgtgatttt 86985
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 86321 ttttcattttttgtgatttt 86340
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 86238 ttttcattttttgtgatttt 86257
>emb|CT025669.8 | Zebrafish DNA sequence from clone DKEY-256E21 in linkage group 4,
complete sequence
Length = 111887
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 21141 ttttcattttttgtgatttt 21122
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 21048 ttttcattttttgtgatttt 21029
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 21010 ttttcattttttgtgatttt 20991
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 20917 ttttcattttttgtgatttt 20898
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 20602 ttttcattttttgtgatttt 20583
>gb|U92974.1 |LLU92974 Lactococcus lactis unknown gene, partial cds, and HisC (hisC),
unknown, HisG (hisG), unknown, HisB (hisB), unknown, HisH
(hish), HisA (hisA), HisF (hisF), HisIE (hisIE), unknown,
unknown, LeuA (leuA), LeuB (leuB), LeuC (leuC), LeuD
(leuD), unknown, IlvD (ilvD), IlvB (ilvB), IlvN, IlvC
(ilvC), IlvA (ilvA), AldB (aldB) and aldR (aldR) genes,
complete cds
Length = 25770
Score = 40.1 bits (20), Expect = 6.4
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 70 gcttttgagcaaaatatgtttttg 93
||||||||||||||||| ||||||
Sbjct: 3509 gcttttgagcaaaatatttttttg 3486
>emb|AL929029.7 | Zebrafish DNA sequence from clone CH211-15F21, complete sequence
Length = 192579
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 57902 ttttcattttttgtgatttt 57921
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 57378 ttttcattttttgtgatttt 57397
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 57340 ttttcattttttgtgatttt 57359
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 57312 ttttcattttttgtgatttt 57331
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 56451 ttttcattttttgtgatttt 56470
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 56290 ttttcattttttgtgatttt 56309
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 56186 ttttcattttttgtgatttt 56205
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 55925 ttttcattttttgtgatttt 55944
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 55823 ttttcattttttgtgatttt 55842
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 55756 ttttcattttttgtgatttt 55775
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 54944 ttttcattttttgtgatttt 54963
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 54781 ttttcattttttgtgatttt 54800
Score = 40.1 bits (20), Expect = 6.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 26 ttttcattttttgtgatttt 45
||||||||||||||||||||
Sbjct: 54677 ttttcattttttgtgatttt 54696
>gb|AC164629.14 | Mus musculus 10 BAC RP23-16N3 (Roswell Park Cancer Institute (C57BL/6J
Female) Mouse BAC Library) complete sequence
Length = 221874
Score = 40.1 bits (20), Expect = 6.4
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 107 tctttggagccaagaagttttaca 130
|||||||||||| |||||||||||
Sbjct: 44132 tctttggagccaggaagttttaca 44109
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,773,876
Number of Sequences: 3902068
Number of extensions: 5773876
Number of successful extensions: 154628
Number of sequences better than 10.0: 110
Number of HSP's better than 10.0 without gapping: 110
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 153127
Number of HSP's gapped (non-prelim): 1501
length of query: 473
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 451
effective length of database: 17,147,199,772
effective search space: 7733387097172
effective search space used: 7733387097172
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)