>gb|BC077547.1| Xenopus laevis glucocorticoid receptor protein, mRNA (cDNA clone
            MGC:83461 IMAGE:3404796), complete cds
          Length = 3392

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 96   gattgtgctgcatttctaggg 116
            |||||||||||||||||||||
Sbjct: 2924 gattgtgctgcatttctaggg 2904

>gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VI,
               complete sequence
          Length = 1813164

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 67      cgcgatcaaacacatcccga 86
               ||||||||||||||||||||
Sbjct: 1187629 cgcgatcaaacacatcccga 1187610

>emb|BX294375.7| Zebrafish DNA sequence from clone DKEY-176M20 in linkage group 17,
              complete sequence
          Length = 188455

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 94     cagattgtgctgcatttcta 113
              ||||||||||||||||||||
Sbjct: 156352 cagattgtgctgcatttcta 156333

>ref|NM_211321.1| Eremothecium gossypii AFR419Cp (AFR419C), mRNA
          Length = 1368

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 67  cgcgatcaaacacatcccga 86
           ||||||||||||||||||||
Sbjct: 696 cgcgatcaaacacatcccga 715

>emb|AL954769.9| Zebrafish DNA sequence from clone CH211-262A21 in linkage group 7,
             complete sequence
          Length = 145555

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 94    cagattgtgctgcatttcta 113
             ||||||||||||||||||||
Sbjct: 79308 cagattgtgctgcatttcta 79289

>ref|XM_322835.1| Neurospora crassa OR74A hypothetical protein (NCU03578.1) partial
            mRNA
          Length = 7452

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 126  ttggctgcgctcaaagaggagga 148
            ||||||| |||||||||||||||
Sbjct: 5245 ttggctgagctcaaagaggagga 5267

>ref|XM_950924.1| Neurospora crassa OR74A hypothetical protein (NCU03578.1) partial
            mRNA
          Length = 7452

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 126  ttggctgcgctcaaagaggagga 148
            ||||||| |||||||||||||||
Sbjct: 5245 ttggctgagctcaaagaggagga 5267

>gb|AC063955.20| Homo sapiens 3 BAC RP11-441M10 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 201692

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 142  aggaggatcttttcttaga 160
            |||||||||||||||||||
Sbjct: 5838 aggaggatcttttcttaga 5820

>gb|AC113003.9| Mus musculus chromosome 18, clone RP23-246G4, complete sequence
          Length = 162882

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 135    ctcaaagaggaggatcttt 153
              |||||||||||||||||||
Sbjct: 102415 ctcaaagaggaggatcttt 102433

>gb|AC118290.7| Rattus norvegicus 2 BAC CH230-366D18 (Children's Hospital Oakland
            Research Institute) complete sequence
          Length = 210896

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 77   cacatcccgaattgctaca 95
            |||||||||||||||||||
Sbjct: 8944 cacatcccgaattgctaca 8962

>emb|BX284746.1|NCB23I4 Neurospora crassa DNA linkage group II BAC contig B23I4
          Length = 71047

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 126   ttggctgcgctcaaagaggagga 148
             ||||||| |||||||||||||||
Sbjct: 23592 ttggctgagctcaaagaggagga 23614

>gb|AC122587.5| Rattus norvegicus  BAC CH230-173H6 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 202972

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 77     cacatcccgaattgctaca 95
              |||||||||||||||||||
Sbjct: 171334 cacatcccgaattgctaca 171352

>gb|AC149589.2| Mus musculus BAC clone RP23-356I2 from 18, complete sequence
          Length = 225803

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 135   ctcaaagaggaggatcttt 153
             |||||||||||||||||||
Sbjct: 10032 ctcaaagaggaggatcttt 10014

>emb|BX323079.7| Zebrafish DNA sequence from clone DKEYP-113D7 in linkage group 19,
             complete sequence
          Length = 165200

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 94    cagattgtgctgcatttct 112
             |||||||||||||||||||
Sbjct: 10159 cagattgtgctgcatttct 10177


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,162,940
Number of Sequences: 3902068
Number of extensions: 1162940
Number of successful extensions: 69700
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 69680
Number of HSP's gapped (non-prelim): 20
length of query: 162
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 140
effective length of database: 17,147,199,772
effective search space: 2400607968080
effective search space used: 2400607968080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)