ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart41g06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|Z83827.1|HS473J6 Human DNA sequence from clone RP3-473J6 on ... 44 0.43
2gb|AC161194.14| Mus musculus chromosome 15, clone RP23-345C13, c... 42 1.7
3ref|XM_673646.1| Plasmodium berghei strain ANKA hypothetical pro... 42 1.7
4gb|AC012362.7| Homo sapiens BAC clone RP11-404D15 from 2, comple... 42 1.7
5gb|AC103681.4| Homo sapiens chromosome 11, clone CTD-2560E9, com... 42 1.7
6gb|AC103682.4| Homo sapiens chromosome 11, clone CTD-2604L9, com... 42 1.7
7ref|NM_122704.1| Arabidopsis thaliana mRNA guanylyltransferase/ ... 40 6.7
8gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 6.7
9gb|AC026471.6| Homo sapiens chromosome 16 clone RP11-452L6, comp... 40 6.7
10ref|XM_567023.1| Cryptococcus neoformans var. neoformans JEC21 i... 40 6.7
11gb|AC007276.3| Homo sapiens BAC clone RP11-226O1 from 7, complet... 40 6.7
12gb|AC152348.7| Medicago truncatula clone mth2-52e17, complete se... 40 6.7
13emb|AL953889.9| Human DNA sequence from clone RP11-7G23 on chrom... 40 6.7
14emb|BX005037.5| Human DNA sequence from clone RP11-34H11 on chro... 40 6.7
15emb|AL627230.15| Human DNA sequence from clone RP11-12A20 on chr... 40 6.7
16emb|AL591926.8| Human DNA sequence from clone RP11-157L3 on chro... 40 6.7
17emb|AL390061.9| Human DNA sequence from clone RP11-322I2 on chro... 40 6.7
18emb|AL356755.12| Human DNA sequence from clone RP5-964F7 on chro... 40 6.7
19emb|AL162731.33| Human DNA sequence from clone RP11-292F9 on chr... 40 6.7
20emb|AL162573.15| Human DNA sequence from clone RP11-275J18 on ch... 40 6.7
21emb|AL353146.9| Human DNA sequence from clone RP11-168O10 on chr... 40 6.7
22emb|AL139084.9| Human DNA sequence from clone RP11-318G11 on chr... 40 6.7
23emb|AL607083.17| Mouse DNA sequence from clone RP23-206E3 on chr... 40 6.7
24emb|AL773537.4| Human DNA sequence from clone RP11-268E1 on chro... 40 6.7
25gb|AC160836.12| Medicago truncatula clone mth2-115l23, complete ... 40 6.7
26gb|AC008706.5| Homo sapiens chromosome 5 clone CTB-77M23, comple... 40 6.7
27gb|AC090971.3| Homo sapiens chromosome 15 clone RP11-56B16 map 1... 40 6.7
28gb|DP000006.1| Oryctolagus cuniculus target 1 genomic scaffold 40 6.7
29gb|AC124042.3| Oryctolagus cuniculus clone LB1-56H19, complete s... 40 6.7
30gb|AC023344.4|AC023344 Homo sapiens BAC clone RP11-395G23 from 8... 40 6.7
31gb|AC131009.7| Homo sapiens 12 BAC RP11-417L19 (Roswell Park Can... 40 6.7
32dbj|AP006628.1| Onion yellows phytoplasma OY-M DNA, complete genome 40 6.7
33gb|AF177535.1|F26C17 Arabidopsis thaliana BAC F26C17 40 6.7
34emb|AL162831.6|CNS01RI2 Human chromosome 14 DNA sequence BAC R-1... 40 6.7
35emb|AL161757.4|CNS01RHK Human chromosome 14 DNA sequence BAC R-1... 40 6.7
36gb|AF086443.1|HUMZD81C11 Homo sapiens full length insert cDNA cl... 40 6.7
37emb|AL137918.4|CNS01DWQ Human chromosome 14 DNA sequence BAC R-4... 40 6.7
38dbj|AP002898.1| Homo sapiens genomic DNA, chromosome 20p, clone:... 40 6.7
39dbj|AP005404.2| Homo sapiens genomic DNA, chromosome 18 clone:RP... 40 6.7

>emb|Z83827.1|HS473J6 Human DNA sequence from clone RP3-473J6 on chromosome Xq21.1, complete
             sequence
          Length = 135686

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 12    atacataagacagtccacaaga 33
             ||||||||||||||||||||||
Sbjct: 35623 atacataagacagtccacaaga 35602



to top

>gb|AC161194.14| Mus musculus chromosome 15, clone RP23-345C13, complete sequence
          Length = 193998

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 318    catgttgtttcttcttccttc 338
              |||||||||||||||||||||
Sbjct: 152903 catgttgtttcttcttccttc 152923



to top

>ref|XM_673646.1| Plasmodium berghei strain ANKA hypothetical protein (PB000737.02.0)
           partial mRNA
          Length = 471

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 29  caagaacaaaatgcatgatga 49
           |||||||||||||||||||||
Sbjct: 309 caagaacaaaatgcatgatga 329



to top

>gb|AC012362.7| Homo sapiens BAC clone RP11-404D15 from 2, complete sequence
          Length = 156618

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 3      aaaaggaaaatacataagaca 23
              |||||||||||||||||||||
Sbjct: 127563 aaaaggaaaatacataagaca 127543



to top

>gb|AC103681.4| Homo sapiens chromosome 11, clone CTD-2560E9, complete sequence
          Length = 215485

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 376    tgatctgctttccttgacctc 396
              |||||||||||||||||||||
Sbjct: 209995 tgatctgctttccttgacctc 210015



to top

>gb|AC103682.4| Homo sapiens chromosome 11, clone CTD-2604L9, complete sequence
          Length = 57561

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 376   tgatctgctttccttgacctc 396
             |||||||||||||||||||||
Sbjct: 35232 tgatctgctttccttgacctc 35212



to top

>ref|NM_122704.1| Arabidopsis thaliana mRNA guanylyltransferase/ phosphoprotein
            phosphatase AT5G28210 mRNA, complete cds
          Length = 1878

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 255  taattgtgtctacaaccatc 274
            ||||||||||||||||||||
Sbjct: 1129 taattgtgtctacaaccatc 1110



to top

>gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete
               sequence
          Length = 2300533

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 261     tgtctacaaccatcatgcaa 280
               ||||||||||||||||||||
Sbjct: 1915326 tgtctacaaccatcatgcaa 1915345



to top

>gb|AC026471.6| Homo sapiens chromosome 16 clone RP11-452L6, complete sequence
          Length = 186860

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 373    aggtgatctgctttccttgacctc 396
              ||||||||||||| ||||||||||
Sbjct: 119405 aggtgatctgcttgccttgacctc 119382



to top

>ref|XM_567023.1| Cryptococcus neoformans var. neoformans JEC21 iron ion
            homeostasis-related protein (CNA07060) partial mRNA
          Length = 1772

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 261  tgtctacaaccatcatgcaa 280
            ||||||||||||||||||||
Sbjct: 1720 tgtctacaaccatcatgcaa 1701



to top

>gb|AC007276.3| Homo sapiens BAC clone RP11-226O1 from 7, complete sequence
          Length = 172573

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 322    ttgtttcttcttccttctgt 341
              ||||||||||||||||||||
Sbjct: 135731 ttgtttcttcttccttctgt 135712



to top

>gb|AC152348.7| Medicago truncatula clone mth2-52e17, complete sequence
          Length = 122070

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 322   ttgtttcttcttccttctgt 341
             ||||||||||||||||||||
Sbjct: 45306 ttgtttcttcttccttctgt 45325



to top

>emb|AL953889.9| Human DNA sequence from clone RP11-7G23 on chromosome 9 Contains six
              novel pseudogenes, the FAM27A gene for  family with
              sequence similarity 27, member A, a novel gene and five CpG
              islands, complete sequence
          Length = 160730

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 373    aggtgatctgctttccttgacctc 396
              |||||||||||| |||||||||||
Sbjct: 139741 aggtgatctgctctccttgacctc 139764



to top

>emb|BX005037.5| Human DNA sequence from clone RP11-34H11 on chromosome 9 Contains two
             CpG islands, complete sequence
          Length = 173181

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 373   aggtgatctgctttccttgacctc 396
             |||||||||||| |||||||||||
Sbjct: 12618 aggtgatctgctctccttgacctc 12595



to top

>emb|AL627230.15| Human DNA sequence from clone RP11-12A20 on chromosome 9 Contains six
              novel pseudogenes, the FAM27B gene for family with sequence
              similarity 27, member B, a pseudogene similar to part of
              ribosomal protein L10 (RPL10) and four CpG islands,
              complete sequence
          Length = 194246

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 373    aggtgatctgctttccttgacctc 396
              |||||||||||| |||||||||||
Sbjct: 149190 aggtgatctgctctccttgacctc 149213



to top

>emb|AL591926.8| Human DNA sequence from clone RP11-157L3 on chromosome 9 Contains five
              novel pseudogenes, a pseudogene similar to part of
              ribosomal protein L10 (RPL10) and two CpG islands, complete
              sequence
          Length = 182366

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 373    aggtgatctgctttccttgacctc 396
              |||||||||||| |||||||||||
Sbjct: 154475 aggtgatctgctctccttgacctc 154498



to top

>emb|AL390061.9| Human DNA sequence from clone RP11-322I2 on chromosome 10 Contains a
             novel gene and a pseudogene similar to MAP
             kinase-interacting serine/threonine kinase 1 (MKNK1),
             complete sequence
          Length = 174818

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 373   aggtgatctgctttccttgacctc 396
             ||||||||||||||||| ||||||
Sbjct: 72872 aggtgatctgctttcctcgacctc 72849



to top

>emb|AL356755.12| Human DNA sequence from clone RP5-964F7 on chromosome 20 Contains
           the GFRA4 gene for GDNF family receptor alpha 4, the 3'
           end of the ADAM33 gene for a disintegrin and
           metalloproteinase domain 33 protein and two CpG islands,
           complete sequence
          Length = 23379

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 237 agaataagaaaagctaacta 256
           ||||||||||||||||||||
Sbjct: 201 agaataagaaaagctaacta 182



to top

>emb|AL162731.33| Human DNA sequence from clone RP11-292F9 on chromosome 9 Contains four
              novel genes, three novel pseudogenes and two CpG islands,
              complete sequence
          Length = 188062

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 373    aggtgatctgctttccttgacctc 396
              |||||||||||| |||||||||||
Sbjct: 181992 aggtgatctgctctccttgacctc 182015



to top

>emb|AL162573.15| Human DNA sequence from clone RP11-275J18 on chromosome 13, complete
             sequence
          Length = 166509

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 373   aggtgatctgctttccttgacctc 396
             ||||||||||||| ||||||||||
Sbjct: 91520 aggtgatctgcttgccttgacctc 91543



to top

>emb|AL353146.9| Human DNA sequence from clone RP11-168O10 on chromosome 10 Contains the
             IFIT1 gene for interferon-induced protein with
             tetratricopeptide repeats 1, the 5' end of a variant of
             the LIPA gene for lipase A lysosomal acid cholesterol
             esterase (Wolman disease), the gene for retinoic acid- and
             interferon-inducible protein (58kD) (RI58), a novel gene,
             the gene for a novel protein similar to monocarboxylate,
             the 3' end of a novel gene and a CpG island, complete
             sequence
          Length = 126887

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 354   cggcatctattagactctta 373
             ||||||||||||||||||||
Sbjct: 93642 cggcatctattagactctta 93623



to top

>emb|AL139084.9| Human DNA sequence from clone RP11-318G11 on chromosome 13 Contains
             part of the gene for zizimin1 (KIAA1085) and a ribosomal
             protein L7 (RPL7) pseudogene, complete sequence
          Length = 80803

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 373   aggtgatctgctttccttgacctc 396
             ||||||||||||| ||||||||||
Sbjct: 68245 aggtgatctgcttgccttgacctc 68268



to top

>emb|AL607083.17| Mouse DNA sequence from clone RP23-206E3 on chromosome 11 Contains a
             novel gene, complete sequence
          Length = 189495

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 322   ttgtttcttcttccttctgt 341
             ||||||||||||||||||||
Sbjct: 87098 ttgtttcttcttccttctgt 87117



to top

>emb|AL773537.4| Human DNA sequence from clone RP11-268E1 on chromosome 9 Contains three
             novel pseudogene, a novel gene, a pseudogene similar to
             part ofribosomal protein L10 (QM, NOV, DXS648, DXS648E,
             FLJ23544) (RPL10) and a CpG island, complete sequence
          Length = 166231

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 373   aggtgatctgctttccttgacctc 396
             |||||||||||| |||||||||||
Sbjct: 57326 aggtgatctgctctccttgacctc 57349



to top

>gb|AC160836.12| Medicago truncatula clone mth2-115l23, complete sequence
          Length = 116158

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 322  ttgtttcttcttccttctgt 341
            ||||||||||||||||||||
Sbjct: 3747 ttgtttcttcttccttctgt 3728



to top

>gb|AC008706.5| Homo sapiens chromosome 5 clone CTB-77M23, complete sequence
          Length = 164394

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 373   aggtgatctgctttccttgacctc 396
             ||||||||||||| ||||||||||
Sbjct: 70633 aggtgatctgcttgccttgacctc 70656



to top

>gb|AC090971.3| Homo sapiens chromosome 15 clone RP11-56B16 map 15q21.3, complete
             sequence
          Length = 192464

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 373   aggtgatctgctttccttgacctc 396
             ||||||||||| ||||||||||||
Sbjct: 30464 aggtgatctgccttccttgacctc 30441



to top

>gb|DP000006.1| Oryctolagus cuniculus target 1 genomic scaffold
          Length = 1889755

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 2       aaaaaggaaaatacataaga 21
               ||||||||||||||||||||
Sbjct: 1051954 aaaaaggaaaatacataaga 1051935



to top

>gb|AC124042.3| Oryctolagus cuniculus clone LB1-56H19, complete sequence
          Length = 194657

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     aaaaaggaaaatacataaga 21
             ||||||||||||||||||||
Sbjct: 49004 aaaaaggaaaatacataaga 48985



to top

>gb|AC023344.4|AC023344 Homo sapiens BAC clone RP11-395G23 from 8, complete sequence
          Length = 186751

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 373   aggtgatctgctttccttgacctc 396
             ||||||||||||| ||||||||||
Sbjct: 63171 aggtgatctgcttgccttgacctc 63148



to top

>gb|AC131009.7| Homo sapiens 12 BAC RP11-417L19 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 170327

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 327  tcttcttccttctgtgttta 346
            ||||||||||||||||||||
Sbjct: 7732 tcttcttccttctgtgttta 7751



to top

>dbj|AP006628.1| Onion yellows phytoplasma OY-M DNA, complete genome
          Length = 860631

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 25     tccacaagaacaaaatgcat 44
              ||||||||||||||||||||
Sbjct: 548495 tccacaagaacaaaatgcat 548476



to top

>gb|AF177535.1|F26C17 Arabidopsis thaliana BAC F26C17
          Length = 53537

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 255   taattgtgtctacaaccatc 274
             ||||||||||||||||||||
Sbjct: 39674 taattgtgtctacaaccatc 39655



to top

>emb|AL162831.6|CNS01RI2 Human chromosome 14 DNA sequence BAC R-1077A2 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 208102

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 373    aggtgatctgctttccttgacctc 396
              ||||||||||||||||||| ||||
Sbjct: 183035 aggtgatctgctttccttggcctc 183012



to top

>emb|AL161757.4|CNS01RHK Human chromosome 14 DNA sequence BAC R-1085N6 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 242832

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 373   aggtgatctgctttccttgacctc 396
             ||||||||||||||||||| ||||
Sbjct: 85799 aggtgatctgctttccttggcctc 85776



to top

>gb|AF086443.1|HUMZD81C11 Homo sapiens full length insert cDNA clone ZD81C11
          Length = 457

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 373 aggtgatctgctttccttgacctc 396
           ||||||||||||| ||||||||||
Sbjct: 209 aggtgatctgcttgccttgacctc 232



to top

>emb|AL137918.4|CNS01DWQ Human chromosome 14 DNA sequence BAC R-442G21 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 162016

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 373    aggtgatctgctttccttgacctc 396
              ||||||||||||||||||| ||||
Sbjct: 122506 aggtgatctgctttccttggcctc 122483



to top

>dbj|AP002898.1| Homo sapiens genomic DNA, chromosome 20p, clone:13N6, complete sequence
          Length = 206647

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 237    agaataagaaaagctaacta 256
              ||||||||||||||||||||
Sbjct: 129691 agaataagaaaagctaacta 129672



to top

>dbj|AP005404.2| Homo sapiens genomic DNA, chromosome 18 clone:RP11-94H14, complete
             sequence
          Length = 142000

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 373   aggtgatctgctttccttgacctc 396
             ||||||||||||| ||||||||||
Sbjct: 70782 aggtgatctgcttgccttgacctc 70805


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,129,637
Number of Sequences: 3902068
Number of extensions: 5129637
Number of successful extensions: 106255
Number of sequences better than 10.0: 39
Number of HSP's better than 10.0 without gapping: 39
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 106128
Number of HSP's gapped (non-prelim): 127
length of query: 494
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 472
effective length of database: 17,147,199,772
effective search space: 8093478292384
effective search space used: 8093478292384
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top