Clone Name	rbart41f06
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AK120033.1| Oryza sativa (japonica cultivar-group) cDNA clon...	307	2e-80
2	emb|X64621.1|OSR22CDNA O.sativa R22 mRNA	307	2e-80
3	dbj|AK066128.1| Oryza sativa (japonica cultivar-group) cDNA clon...	307	2e-80
4	dbj|AK062208.1| Oryza sativa (japonica cultivar-group) cDNA clon...	307	2e-80
5	gb|AF470356.1| Triticum aestivum QM mRNA, partial cds	305	8e-80
6	ref|XM_476047.1| Oryza sativa (japonica cultivar-group), predic...	293	3e-76
7	gb|AC084817.5| Oryza sativa (japonica cultivar-group) chromosome...	236	6e-59
8	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	236	6e-59
9	emb|X81692.1|OSSG12G O.sativa SG12 gene	236	6e-59
10	gb|U55048.1|OSU55048 Oryza sativa QM gene, complete cds	236	6e-59
11	gb|BT016528.1| Zea mays clone Contig361 mRNA sequence	230	4e-57
12	gb|BT016423.1| Zea mays clone Contig256 mRNA sequence	222	9e-55
13	gb|AY103671.1| Zea mays PCO135454 mRNA sequence	206	5e-50
14	gb|U06108.1|ZMU06108 Zea mays B73 QM protein mRNA, complete cds	204	2e-49
15	gb|AF542972.1| Triticum aestivum SC34 tumor suppressor-like mRNA...	192	8e-46
16	dbj|AK102971.1| Oryza sativa (japonica cultivar-group) cDNA clon...	184	2e-43
17	dbj|AK060902.1| Oryza sativa (japonica cultivar-group) cDNA clon...	184	2e-43
18	gb|U55212.1|OSU55212 Oryza sativa Wilms' tumor-related protein Q...	184	2e-43
19	emb|X81691.1|OSSC34MR O.sativa SC34 mRNA for tumor suppressor	178	1e-41
20	dbj|AK103710.1| Oryza sativa (japonica cultivar-group) cDNA clon...	176	5e-41
21	gb|BT012759.1| Lycopersicon esculentum clone 113703R, mRNA sequence	145	2e-31
22	gb|DQ056435.1| Lycopersicon esculentum 60S ribosomal protein L10...	145	2e-31
23	gb|AC147460.1| Oryza sativa (japonica cultivar-group) chromosome...	133	6e-28
24	gb|AC123524.2| Oryza sativa (japonica cultivar-group) chromosome...	133	6e-28
25	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	133	6e-28
26	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	133	6e-28
27	emb|Z14083.1|NTTRP N.tabacum mRNA for protein homologue to human...	123	6e-25
28	gb|DQ228354.1| Solanum tuberosum clone 150H09 60S ribosomal prot...	121	2e-24
29	gb|AY641430.1| Caragana jubata QM family protein (QM) mRNA, comp...	109	9e-21
30	gb|AY641733.1| Camellia sinensis QM-like protein mRNA, complete cds	109	9e-21
31	ref|NM_102455.1| Arabidopsis thaliana structural constituent of ...	107	4e-20
32	gb|BT024605.1| Arabidopsis thaliana At1g26910 mRNA, complete cds	107	4e-20
33	gb|AY087264.1| Arabidopsis thaliana clone 33391 mRNA, complete s...	100	9e-18
34	ref|NM_101298.2| Arabidopsis thaliana structural constituent of ...	96	1e-16
35	gb|BT000679.1| Arabidopsis thaliana clone RAFL07-10-D02 (R10643)...	96	1e-16
36	gb|AY113989.1| Arabidopsis thaliana putative tumor suppressor pr...	96	1e-16
37	gb|AY045866.1| Arabidopsis thaliana putative tumor suppressor pr...	96	1e-16
38	gb|AF428470.1|AF428470 Arabidopsis thaliana At1g14320/F14L17_28 ...	96	1e-16
39	gb|AF428286.1|AF428286 Arabidopsis thaliana At1g14320/F14L17_28 ...	96	1e-16
40	gb|AY050482.1| Arabidopsis thaliana At1g14320/F14L17_28 mRNA, co...	96	1e-16
41	gb|AF378902.1|AF378902 Arabidopsis thaliana At1g14320/F14L17_28 ...	96	1e-16
42	emb|BX816389.1|CNS0AE93 Arabidopsis thaliana Full-length cDNA Co...	96	1e-16
43	emb|BX816136.1|CNS0AE2V Arabidopsis thaliana Full-length cDNA Co...	96	1e-16
44	emb|Z15157.1|ATWILMTSH A.thaliana mRNA for Wilm's tumor suppress...	96	1e-16
45	gb|AF180758.1|AF180758 Vitis riparia 60S ribosomal protein L10 (...	96	1e-16
46	gb|AC140545.26| Medicago truncatula clone mth2-11g18, complete s...	88	3e-14
47	gb|AC012188.2|F14L17 Sequence of BAC F14L17 from Arabidopsis tha...	84	5e-13
48	gb|AC005508.1|AC005508 Arabidopsis thaliana chromosome I BAC T2P...	84	5e-13
49	ref|NM_105329.1| Arabidopsis thaliana structural constituent of ...	78	3e-11
50	gb|AY055103.1| Arabidopsis thaliana At1g66580/T12I7_3 mRNA, comp...	78	3e-11
51	gb|AF367276.1|AF367276 Arabidopsis thaliana At1g66580/T12I7_3 mR...	78	3e-11
52	emb|BX816025.1|CNS0ABON Arabidopsis thaliana Full-length cDNA Co...	78	3e-11
53	emb|BX815625.1|CNS0ABEZ Arabidopsis thaliana Full-length cDNA Co...	78	3e-11
54	gb|AF295636.1|AF295636 Elaeis guineensis QM-like protein mRNA, c...	78	3e-11
55	gb|AY087426.1| Arabidopsis thaliana clone 35307 mRNA, complete s...	78	3e-11
56	gb|AC079285.1|AC079285 Arabidopsis thaliana chromosome 1 BAC T12...	76	1e-10
57	gb|AF013804.1| Pinus taeda Wilm's tumor supressor homolog (lp20)...	76	1e-10
58	dbj|AB001582.1| Solanum melongena mRNA for QM family protein, pa...	76	1e-10
59	dbj|AB001891.1| Solanum melongena mRNA for QM family protein, co...	76	1e-10
60	gb|AY829778.1| Lonomia obliqua ribosomal protein L10 mRNA, compl...	74	5e-10
61	gb|AF368032.1|AF368032 Heliothis virescens QM protein mRNA, comp...	74	5e-10
62	gb|DQ440008.1| Aedes aegypti clone AE-200A ribosomal protein L10...	72	2e-09
63	ref|XM_660558.1| Cryptosporidium hominis TU502 ribosomal protein...	72	2e-09
64	emb|BX538352.1| Cryptosporidium parvum chromosome 6, complete se...	72	2e-09
65	emb|CR938586.1| Single read from an extremity of a full-length c...	72	2e-09
66	emb|CR938540.1| Single read from an extremity of a full-length c...	72	2e-09
67	emb|CR938096.1| Single read from an extremity of a full-length c...	72	2e-09
68	emb|CR938095.1| Single read from an extremity of a full-length c...	72	2e-09
69	emb|CR937970.1| Single read from an extremity of a full-length c...	72	2e-09
70	emb|CR937222.1| Single read from an extremity of a cDNA clone ma...	72	2e-09
71	ref|XM_627752.1| Cryptosporidium parvum Iowa II 60S ribosomal pr...	72	2e-09
72	gb|AY763500.1| Danio rerio QM protein (QM) mRNA, complete cds	70	8e-09
73	ref|XM_739285.1| Plasmodium chabaudi chabaudi ribosomal protein ...	70	8e-09
74	ref|XM_686253.1| PREDICTED: Danio rerio similar to Ribosomal pro...	70	8e-09
75	gb|AY762997.1| Ctenopharyngodon idella QM (QM) mRNA, complete cds	70	8e-09
76	gb|BC045950.1| Danio rerio ribosomal protein L10, mRNA (cDNA clo...	70	8e-09
77	ref|NM_200027.1| Danio rerio ribosomal protein L10 (rpl10), mRNA	70	8e-09
78	gb|AF227620.1|AF227620 Euphorbia esula 60S ribosomal protein L10...	70	8e-09
79	emb|CR938702.1| Single read from an extremity of a full-length c...	68	3e-08
80	gb|AY440350.1| Armigeres subalbatus ASAP ID: 41357 cytosolic lar...	64	5e-07
81	emb|AM049018.1| Curculio glandium partial mRNA for ribosomal pro...	64	5e-07
82	emb|BX071681.1|CNS09RH1 Single read from an extremity of a full-...	64	5e-07
83	emb|BX066414.1|CNS09NEQ Single read from an extremity of a full-...	64	5e-07
84	emb|BX066294.1|CNS09NBE Single read from an extremity of a full-...	64	5e-07
85	emb|BX062161.1|CNS09K4L Single read from an extremity of a full-...	64	5e-07
86	emb|BX054818.1|CNS09EGM Single read from an extremity of a full-...	64	5e-07
87	emb|BX054800.1|CNS09EG4 Single read from an extremity of a full-...	64	5e-07
88	emb|BX054799.1|CNS09EG3 Single read from an extremity of a full-...	64	5e-07
89	emb|BX046336.1|CNS097X0 Single read from an extremity of a full-...	64	5e-07
90	emb|BX045752.1|CNS097GS Single read from an extremity of a full-...	64	5e-07
91	emb|BX045505.1|CNS0979X Single read from an extremity of a full-...	64	5e-07
92	emb|BX043067.1|CNS095E7 Single read from an extremity of a full-...	64	5e-07
93	emb|BX043066.1|CNS095E6 Single read from an extremity of a full-...	64	5e-07
94	emb|BX044599.1|CNS096KR Single read from an extremity of a full-...	64	5e-07
95	emb|BX043398.1|CNS095NE Single read from an extremity of a full-...	64	5e-07
96	emb|BX038980.1|CNS0928O Single read from an extremity of a full-...	64	5e-07
97	emb|BX037545.1|CNS0914T Single read from an extremity of a full-...	64	5e-07
98	emb|BX037544.1|CNS0914S Single read from an extremity of a full-...	64	5e-07
99	emb|BX031114.1|CNS08W66 Single read from an extremity of a full-...	64	5e-07
100	emb|BX026833.1|CNS08SV9 Single read from an extremity of a full-...	64	5e-07
101	emb|BX025006.1|CNS08RGI Single read from an extremity of a full-...	64	5e-07
102	emb|BX025005.1|CNS08RGH Single read from an extremity of a full-...	64	5e-07
103	emb|BX024539.1|CNS08R3J Single read from an extremity of a full-...	64	5e-07
104	emb|BX020659.1|CNS08O3R Single read from an extremity of a full-...	64	5e-07
105	emb|BX019389.1|CNS08N4H Single read from an extremity of a full-...	64	5e-07
106	emb|BX018993.1|CNS08MTH Single read from an extremity of a full-...	64	5e-07
107	emb|BX017940.1|CNS08M08 Single read from an extremity of a full-...	64	5e-07
108	emb|BX017939.1|CNS08M07 Single read from an extremity of a full-...	64	5e-07
109	emb|BX018773.1|CNS08MND Single read from an extremity of a full-...	64	5e-07
110	emb|BX018772.1|CNS08MNC Single read from an extremity of a full-...	64	5e-07
111	emb|BX017778.1|CNS08LVQ Single read from an extremity of a full-...	64	5e-07
112	emb|BX017777.1|CNS08LVP Single read from an extremity of a full-...	64	5e-07
113	emb|BX016960.1|CNS08L90 Single read from an extremity of a full-...	64	5e-07
114	emb|BX012859.1|CNS08I33 Single read from an extremity of a full-...	64	5e-07
115	emb|BX012858.1|CNS08I32 Single read from an extremity of a full-...	64	5e-07
116	emb|BX010419.1|CNS08G7B Single read from an extremity of a full-...	64	5e-07
117	emb|BX008095.1|CNS08EER Single read from an extremity of a full-...	64	5e-07
118	emb|BX008094.1|CNS08EEQ Single read from an extremity of a full-...	64	5e-07
119	emb|BX005642.1|CNS08CIM Single read from an extremity of a full-...	64	5e-07
120	ref|XM_312560.2| Anopheles gambiae str. PEST ENSANGP00000014921 ...	64	5e-07
121	gb|AF118822.1|AF118822 Arabidopsis thaliana senescence-associate...	64	5e-07
122	gb|AY822650.1| Callinectes sapidus ribosomal protein L10 mRNA, c...	62	2e-06
123	ref|XM_754376.1| Ustilago maydis 521 hypothetical protein (UM033...	62	2e-06
124	ref|XM_723221.1| Plasmodium yoelii yoelii str. 17XNL ribosomal L...	62	2e-06
125	gb|BC058467.1| Rattus norvegicus ribosomal protein L10, mRNA (cD...	62	2e-06
126	emb|BX026834.1|CNS08SVA Single read from an extremity of a full-...	62	2e-06
127	emb|CR937221.1| Single read from an extremity of a cDNA clone ma...	62	2e-06
128	ref|XM_212832.3| PREDICTED: Rattus norvegicus ribosomal protein ...	62	2e-06
129	dbj|AB180439.1| Plutella xylostella mRNA for QM protein, complet...	62	2e-06
130	gb|AC113107.15| Mus musculus chromosome 10, clone RP23-325G13, c...	58	3e-05
131	emb|AM049016.1| Biphyllus lunatus mRNA for ribosomal protein L10...	58	3e-05
132	ref|XM_965782.1| PREDICTED: Tribolium castaneum similar to CG175...	58	3e-05
133	emb|BX038979.1|CNS0928N Single read from an extremity of a full-...	58	3e-05
134	gb|AC153942.8| Mus musculus 10 BAC RP24-174M19 (Roswell Park Can...	58	3e-05
135	gb|AY769278.1| Bombyx mori ribosomal protein L10 (RpL10) mRNA, c...	56	1e-04
136	ref|XM_868582.1| PREDICTED: Bos taurus similar to ribosomal prot...	56	1e-04
137	gb|U60651.1| Hydra vulgaris ribosomal protein L10 mRNA, complete...	56	1e-04
138	emb|CR734854.2|CNS0GTSL Tetraodon nigroviridis full-length cDNA	56	1e-04
139	emb|CR734175.2|CNS0GT9Q Tetraodon nigroviridis full-length cDNA	56	1e-04
140	emb|CR720542.2|CNS0GIX0 Tetraodon nigroviridis full-length cDNA	56	1e-04
141	emb|CR728834.2|CNS0GPBC Tetraodon nigroviridis full-length cDNA	56	1e-04
142	emb|CR720275.2|CNS0GIPL Tetraodon nigroviridis full-length cDNA	56	1e-04
143	emb|CR722877.2|CNS0GKPV Tetraodon nigroviridis full-length cDNA	56	1e-04
144	emb|CR722708.2|CNS0GKL6 Tetraodon nigroviridis full-length cDNA	56	1e-04
145	emb|CR722363.2|CNS0GKBL Tetraodon nigroviridis full-length cDNA	56	1e-04
146	emb|CR720772.2|CNS0GJ3E Tetraodon nigroviridis full-length cDNA	56	1e-04
147	emb|CR717491.2|CNS0GGK9 Tetraodon nigroviridis full-length cDNA	56	1e-04
148	emb|CR717039.2|CNS0GG7S Tetraodon nigroviridis full-length cDNA	56	1e-04
149	emb|CR716839.2|CNS0GG28 Tetraodon nigroviridis full-length cDNA	56	1e-04
150	emb|CR716359.2|CNS0GFOW Tetraodon nigroviridis full-length cDNA	56	1e-04
151	emb|CR715715.2|CNS0GF73 Tetraodon nigroviridis full-length cDNA	56	1e-04
152	emb|CR714866.2|CNS0GEJI Tetraodon nigroviridis full-length cDNA	56	1e-04
153	emb|CR714125.2|CNS0GDYX Tetraodon nigroviridis full-length cDNA	56	1e-04
154	emb|CR712979.2|CNS0GD33 Tetraodon nigroviridis full-length cDNA	56	1e-04
155	emb|CR713339.2|CNS0GDD3 Tetraodon nigroviridis full-length cDNA	56	1e-04
156	emb|CR713296.2|CNS0GDBW Tetraodon nigroviridis full-length cDNA	56	1e-04
157	emb|CR712692.2|CNS0GCV4 Tetraodon nigroviridis full-length cDNA	56	1e-04
158	emb|CR711229.2|CNS0GBQH Tetraodon nigroviridis full-length cDNA	56	1e-04
159	emb|CR710615.2|CNS0GB9F Tetraodon nigroviridis full-length cDNA	56	1e-04
160	emb|CR708839.2|CNS0G9W3 Tetraodon nigroviridis full-length cDNA	56	1e-04
161	emb|CR708432.2|CNS0G9KS Tetraodon nigroviridis full-length cDNA	56	1e-04
162	emb|CR706206.2|CNS0G7UY Tetraodon nigroviridis full-length cDNA	56	1e-04
163	emb|CR704971.2|CNS0G6WN Tetraodon nigroviridis full-length cDNA	56	1e-04
164	emb|CR704750.2|CNS0G6QI Tetraodon nigroviridis full-length cDNA	56	1e-04
165	emb|CR704546.2|CNS0G6KU Tetraodon nigroviridis full-length cDNA	56	1e-04
166	emb|CR703247.2|CNS0G5KR Tetraodon nigroviridis full-length cDNA	56	1e-04
167	emb|CR702411.2|CNS0G4XJ Tetraodon nigroviridis full-length cDNA	56	1e-04
168	emb|CR699842.2|CNS0G2Y6 Tetraodon nigroviridis full-length cDNA	56	1e-04
169	emb|CR699390.2|CNS0G2LM Tetraodon nigroviridis full-length cDNA	56	1e-04
170	emb|CR698890.2|CNS0G27Q Tetraodon nigroviridis full-length cDNA	56	1e-04
171	emb|CR698626.2|CNS0G20E Tetraodon nigroviridis full-length cDNA	56	1e-04
172	emb|CR697360.2|CNS0G118 Tetraodon nigroviridis full-length cDNA	56	1e-04
173	emb|CR696503.2|CNS0G0DF Tetraodon nigroviridis full-length cDNA	56	1e-04
174	emb|CR695584.2|CNS0FZNW Tetraodon nigroviridis full-length cDNA	56	1e-04
175	emb|CR695012.2|CNS0FZ80 Tetraodon nigroviridis full-length cDNA	56	1e-04
176	emb|CR693370.2|CNS0FXYE Tetraodon nigroviridis full-length cDNA	56	1e-04
177	emb|CR692920.2|CNS0FXLW Tetraodon nigroviridis full-length cDNA	56	1e-04
178	emb|CR691720.2|CNS0FWOK Tetraodon nigroviridis full-length cDNA	56	1e-04
179	emb|CR690750.2|CNS0FVXM Tetraodon nigroviridis full-length cDNA	56	1e-04
180	emb|CR687822.2|CNS0FTOA Tetraodon nigroviridis full-length cDNA	56	1e-04
181	emb|CR683944.2|CNS0FQOK Tetraodon nigroviridis full-length cDNA	56	1e-04
182	emb|CR683389.2|CNS0FQ95 Tetraodon nigroviridis full-length cDNA	56	1e-04
183	emb|CR683865.2|CNS0FQMD Tetraodon nigroviridis full-length cDNA	56	1e-04
184	emb|CR683765.2|CNS0FQJL Tetraodon nigroviridis full-length cDNA	56	1e-04
185	emb|CR682972.2|CNS0FPXK Tetraodon nigroviridis full-length cDNA	56	1e-04
186	emb|CR682444.2|CNS0FPIW Tetraodon nigroviridis full-length cDNA	56	1e-04
187	emb|CR682415.2|CNS0FPI3 Tetraodon nigroviridis full-length cDNA	56	1e-04
188	emb|CR680276.2|CNS0FNUO Tetraodon nigroviridis full-length cDNA	56	1e-04
189	emb|CR679679.2|CNS0FNE3 Tetraodon nigroviridis full-length cDNA	56	1e-04
190	emb|CR679292.2|CNS0FN3C Tetraodon nigroviridis full-length cDNA	56	1e-04
191	emb|CR678745.2|CNS0FMO5 Tetraodon nigroviridis full-length cDNA	56	1e-04
192	emb|CR677248.2|CNS0FLJ0 Tetraodon nigroviridis full-length cDNA	56	1e-04
193	emb|CR677235.2|CNS0FLIN Tetraodon nigroviridis full-length cDNA	56	1e-04
194	emb|CR676747.2|CNS0FL53 Tetraodon nigroviridis full-length cDNA	56	1e-04
195	emb|CR675816.2|CNS0FKFI Tetraodon nigroviridis full-length cDNA	56	1e-04
196	emb|CR671887.2|CNS0FHED Tetraodon nigroviridis full-length cDNA	56	1e-04
197	emb|CR670190.2|CNS0FG38 Tetraodon nigroviridis full-length cDNA	56	1e-04
198	emb|CR669765.2|CNS0FFRF Tetraodon nigroviridis full-length cDNA	56	1e-04
199	emb|CR669547.2|CNS0FFLD Tetraodon nigroviridis full-length cDNA	56	1e-04
200	emb|CR668289.2|CNS0FEMF Tetraodon nigroviridis full-length cDNA	56	1e-04
201	emb|CR667800.2|CNS0FE8U Tetraodon nigroviridis full-length cDNA	56	1e-04
202	emb|CR667784.2|CNS0FE8E Tetraodon nigroviridis full-length cDNA	56	1e-04
203	emb|CR666481.2|CNS0FD87 Tetraodon nigroviridis full-length cDNA	56	1e-04
204	emb|CR666070.2|CNS0FCWS Tetraodon nigroviridis full-length cDNA	56	1e-04
205	emb|CR665292.2|CNS0FCB6 Tetraodon nigroviridis full-length cDNA	56	1e-04
206	emb|CR664416.2|CNS0FBMU Tetraodon nigroviridis full-length cDNA	56	1e-04
207	emb|CR664793.2|CNS0FBXB Tetraodon nigroviridis full-length cDNA	56	1e-04
208	emb|CR664317.2|CNS0FBK3 Tetraodon nigroviridis full-length cDNA	56	1e-04
209	emb|CR663825.2|CNS0FB6F Tetraodon nigroviridis full-length cDNA	56	1e-04
210	emb|CR661995.2|CNS0F9RL Tetraodon nigroviridis full-length cDNA	56	1e-04
211	emb|CR661060.1|CNS0F91M Tetraodon nigroviridis full-length cDNA	56	1e-04
212	emb|CR660123.2|CNS0F8BL Tetraodon nigroviridis full-length cDNA	56	1e-04
213	emb|CR658652.2|CNS0F76Q Tetraodon nigroviridis full-length cDNA	56	1e-04
214	emb|CR657230.2|CNS0F638 Tetraodon nigroviridis full-length cDNA	56	1e-04
215	emb|CR656598.2|CNS0F5LO Tetraodon nigroviridis full-length cDNA	56	1e-04
216	emb|CR655837.2|CNS0F50J Tetraodon nigroviridis full-length cDNA	56	1e-04
217	emb|CR655821.2|CNS0F503 Tetraodon nigroviridis full-length cDNA	56	1e-04
218	emb|CR652829.2|CNS0F2OZ Tetraodon nigroviridis full-length cDNA	56	1e-04
219	emb|CR651640.2|CNS0F1RY Tetraodon nigroviridis full-length cDNA	56	1e-04
220	emb|CR650120.2|CNS0F0LQ Tetraodon nigroviridis full-length cDNA	56	1e-04
221	emb|CR649290.2|CNS0EZYO Tetraodon nigroviridis full-length cDNA	56	1e-04
222	emb|CR647942.2|CNS0EYX8 Tetraodon nigroviridis full-length cDNA	56	1e-04
223	emb|CR646246.2|CNS0EXM4 Tetraodon nigroviridis full-length cDNA	56	1e-04
224	emb|CR644771.2|CNS0EWH5 Tetraodon nigroviridis full-length cDNA	56	1e-04
225	emb|CR642622.2|CNS0EUTG Tetraodon nigroviridis full-length cDNA	56	1e-04
226	emb|CR642404.2|CNS0EUNE Tetraodon nigroviridis full-length cDNA	56	1e-04
227	emb|CR642314.2|CNS0EUKW Tetraodon nigroviridis full-length cDNA	56	1e-04
228	emb|CR642260.2|CNS0EUJE Tetraodon nigroviridis full-length cDNA	56	1e-04
229	emb|CR641599.2|CNS0EU11 Tetraodon nigroviridis full-length cDNA	56	1e-04
230	emb|CR641870.2|CNS0EU8K Tetraodon nigroviridis full-length cDNA	56	1e-04
231	emb|CR641322.2|CNS0ETTC Tetraodon nigroviridis full-length cDNA	56	1e-04
232	emb|CR640947.2|CNS0ETIX Tetraodon nigroviridis full-length cDNA	56	1e-04
233	emb|CR640163.2|CNS0ESX5 Tetraodon nigroviridis full-length cDNA	56	1e-04
234	emb|CR639985.2|CNS0ESS7 Tetraodon nigroviridis full-length cDNA	56	1e-04
235	emb|CR639593.2|CNS0ESHB Tetraodon nigroviridis full-length cDNA	56	1e-04
236	emb|CR639409.2|CNS0ESC7 Tetraodon nigroviridis full-length cDNA	56	1e-04
237	emb|CR635358.2|CNS0EP7O Tetraodon nigroviridis full-length cDNA	56	1e-04
238	emb|CR635001.2|CNS0EOXR Tetraodon nigroviridis full-length cDNA	56	1e-04
239	gb|AC147002.20| Medicago truncatula clone mth2-151m16, complete ...	56	1e-04
240	emb|BX051816.1|CNS09C58 Single read from an extremity of a full-...	56	1e-04
241	dbj|AB223250.1| Aspergillus oryzae cDNA, contig sequence: AoEST0081	56	1e-04
242	dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011	56	1e-04
243	gb|AF395838.1|AF395838 Bombyx mori QM protein (QM) mRNA, complet...	56	1e-04
244	gb|AY130416.1| Petromyzon marinus ribosomal protein L10 mRNA, pa...	56	1e-04
245	gb|AY130414.1| Branchiostoma lanceolatum ribosomal protein L10 m...	56	1e-04
246	emb|BX005483.3| Zebrafish DNA sequence from clone CH211-286G12 i...	56	1e-04
247	gb|AY168758.1| Branchiostoma belcheri tsingtaunese ribosomal pro...	56	1e-04
248	gb|AY909399.1| Siniperca chuatsi clone C410 ribosomal protein L1...	56	1e-04
249	gb|AF099012.1|AF099012 Bombyx mandarina QM protein mRNA, complet...	56	1e-04
250	emb|CR450723.12| Zebrafish DNA sequence from clone DKEY-47C8 in ...	56	1e-04
251	gb|BC086917.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo...	54	5e-04
252	gb|BC083327.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo...	54	5e-04
253	gb|BC082293.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo...	54	5e-04
254	gb|BC024901.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo...	54	5e-04
255	gb|AY156926.1| Pinctada fucata QM protein mRNA, complete cds	54	5e-04
256	ref|NM_052835.1| Mus musculus ribosomal protein 10 (Rpl10), mRNA	54	5e-04
257	ref|XM_658595.1| Aspergillus nidulans FGSC A4 hypothetical prote...	54	5e-04
258	gb|AC121872.2| Mus musculus BAC clone RP24-122E10 from 12, compl...	54	5e-04
259	emb|X87106.1|RNRPL10 R.norvegicus mRNA for ribosomal protein L10	54	5e-04
260	emb|X75312.1|MMRNAQM M.musculus (C57BL/6) QM mRNA	54	5e-04
261	gb|BC099437.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo...	54	5e-04
262	gb|AC160997.5| Mus musculus BAC clone RP23-68E4 from chromosome ...	54	5e-04
263	gb|BC098204.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo...	54	5e-04
264	dbj|AK146217.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-...	54	5e-04
265	dbj|AK151736.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	54	5e-04
266	dbj|AK144831.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-...	54	5e-04
267	dbj|AK152854.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	54	5e-04
268	dbj|AK151655.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	54	5e-04
269	dbj|AK151416.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	54	5e-04
270	dbj|AK153345.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	54	5e-04
271	dbj|AK152123.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	54	5e-04
272	dbj|AK168854.1| Mus musculus 17 days embryo heart cDNA, RIKEN fu...	54	5e-04
273	dbj|AK166610.1| Mus musculus morula whole body morula cDNA, RIKE...	54	5e-04
274	dbj|AK167239.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f...	54	5e-04
275	dbj|AK160618.1| Mus musculus 11 days embryo whole body cDNA, RIK...	54	5e-04
276	dbj|AK168250.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-...	54	5e-04
277	gb|AY857421.1| Suberites domuncula L10 mRNA, complete cds	54	5e-04
278	dbj|AK167966.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-...	54	5e-04
279	dbj|AK014054.1| Mus musculus 13 days embryo head cDNA, RIKEN ful...	54	5e-04
280	dbj|AK088777.1| Mus musculus 2 days neonate thymus thymic cells ...	54	5e-04
281	dbj|AK012561.1| Mus musculus 11 days embryo whole body cDNA, RIK...	54	5e-04
282	dbj|AK011022.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu...	54	5e-04
283	ref|NM_031100.1| Rattus norvegicus ribosomal protein L10 (Rpl10)...	54	5e-04
284	gb|BC092383.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo...	54	5e-04
285	gb|AF401563.1| Ictalurus punctatus ribosomal protein L10 mRNA, c...	54	5e-04
286	ref|XM_574109.1| PREDICTED: Rattus norvegicus similar to ribosom...	54	5e-04
287	dbj|AK210081.1| Mus musculus cDNA, clone:Y2G0117E10, strand:minu...	54	5e-04
288	dbj|AK187587.1| Mus musculus cDNA, clone:Y0G0142F19, strand:minu...	54	5e-04
289	emb|AL512582.7| Mouse DNA sequence from clone RP23-290H11 on chr...	54	5e-04
290	emb|Y17222.1|SDO17222 Suberites domuncula mRNA for putative tumo...	54	5e-04
291	dbj|AK119983.1| Oryza sativa (japonica cultivar-group) cDNA clon...	54	5e-04
292	gb|BC048872.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo...	54	5e-04
293	gb|AC141642.4| Mus musculus BAC clone RP23-274K4 from chromosome...	54	5e-04
294	gb|AF530560.1| Pinctada fucata QM-like protein (QM) mRNA, comple...	54	5e-04
295	gb|U89405.1|MMU89405 Mus musculus strain BALB/c QM protein mRNA,...	54	5e-04
296	gb|BC006068.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo...	54	5e-04
297	gb|AC131733.3| Mus musculus BAC clone RP23-98C9 from 8, complete...	54	5e-04
298	gb|AC157945.2| Mus musculus BAC clone RP23-289C11 from chromosom...	54	5e-04
299	gb|AC161238.7| Mus musculus chromosome 19, clone RP24-288C19, co...	54	5e-04
300	gb|M93980.1|MUSADIPCT Mouse 24.6 kda protein mRNA, complete cds	54	5e-04
301	ref|XM_750162.1| Aspergillus fumigatus Af293 ribosomal protein L...	52	0.002
302	emb|CR938584.1| Single read from an extremity of a full-length c...	52	0.002
303	gb|AC122357.4| Mus musculus BAC clone RP23-403O8 from chromosome...	50	0.007
304	ref|XM_522844.1| PREDICTED: Pan troglodytes similar to ribosomal...	50	0.007
305	gb|AY701865.1| Gekko japonicus GekBS044P mRNA, complete cds	50	0.007
306	ref|XM_585834.2| PREDICTED: Bos taurus similar to ribosomal prot...	50	0.007
307	ref|XM_592251.2| PREDICTED: Bos taurus similar to ribosomal prot...	50	0.007
308	gb|BC014310.1| Homo sapiens ribosomal protein L10-like, mRNA (cD...	50	0.007
309	ref|NM_080746.2| Homo sapiens ribosomal protein L10-like (RPL10L...	50	0.007
310	ref|NM_174760.2| Bos taurus ribosomal protein L10 (RPL10), mRNA	50	0.007
311	gb|AC147680.4| Canis Familiaris, clone XX-10H12, complete sequence	50	0.007
312	ref|XM_862548.1| PREDICTED: Canis familiaris similar to ribosoma...	50	0.007
313	ref|XM_862530.1| PREDICTED: Canis familiaris similar to ribosoma...	50	0.007
314	ref|XM_862521.1| PREDICTED: Canis familiaris similar to ribosoma...	50	0.007
315	ref|XM_538206.2| PREDICTED: Canis familiaris similar to ribosoma...	50	0.007
316	ref|XM_848470.1| PREDICTED: Canis familiaris similar to ribosoma...	50	0.007
317	ref|XM_974001.1| PREDICTED: Mus musculus similar to ribosomal pr...	50	0.007
318	ref|XM_889722.2| PREDICTED: Mus musculus similar to ribosomal pr...	50	0.007
319	ref|XM_543494.2| PREDICTED: Canis familiaris similar to ribosoma...	50	0.007
320	ref|XM_542759.2| PREDICTED: Canis familiaris similar to ribosoma...	50	0.007
321	emb|CR974589.6| Mouse DNA sequence from clone RP23-77B14 on chro...	50	0.007
322	ref|XM_547794.2| PREDICTED: Canis familiaris similar to 60S ribo...	50	0.007
323	emb|AM049019.1| Scarabaeus laticollis mRNA for ribosomal protein...	50	0.007
324	ref|XM_849677.1| PREDICTED: Canis familiaris similar to ribosoma...	50	0.007
325	gb|AC117679.8| Mus musculus chromosome 9, clone RP23-435I22, com...	50	0.007
326	emb|BX054819.1|CNS09EGN Single read from an extremity of a full-...	50	0.007
327	emb|BX018994.1|CNS08MTI Single read from an extremity of a full-...	50	0.007
328	emb|BX014897.1|CNS08JNP Single read from an extremity of a full-...	50	0.007
329	emb|BX014896.1|CNS08JNO Single read from an extremity of a full-...	50	0.007
330	gb|BC066312.1| Homo sapiens ribosomal protein L10-like, mRNA (cD...	50	0.007
331	dbj|AB226277.1| Aspergillus oryzae cDNA, contig sequence: AoEST3138	50	0.007
332	gb|BC104528.1| Bos taurus ribosomal protein L10, mRNA (cDNA clon...	50	0.007
333	dbj|AB063608.1| Homo sapiens RPL10L mRNA for ribosomal protein L...	50	0.007
334	dbj|AB178981.1| Macaca fascicularis testis cDNA clone: QtsA-1084...	50	0.007
335	gb|AF143815.1|AF143815 Bos taurus ribosomal protein (QM) mRNA, c...	50	0.007
336	ref|NG_000911.1| Homo sapiens ribosomal protein L10 pseudogene 1...	50	0.007
337	emb|AL115669.1|CNS01CL9 Botrytis cinerea strain T4 cDNA library	50	0.007
338	emb|AL117032.1|CNS01DN4 Botrytis cinerea strain T4 cDNA library	50	0.007
339	emb|AL117016.1|CNS01DMO Botrytis cinerea strain T4 cDNA library	50	0.007
340	emb|AL116010.1|CNS01CUQ Botrytis cinerea strain T4 cDNA library	50	0.007
341	emb|AL116382.1|CNS01D52 Botrytis cinerea strain T4 cDNA library	50	0.007
342	emb|AL116380.1|CNS01D50 Botrytis cinerea strain T4 cDNA library	50	0.007
343	emb|AL115845.1|CNS01CQ5 Botrytis cinerea strain T4 cDNA library	50	0.007
344	emb|AL115361.1|CNS01CCP Botrytis cinerea strain T4 cDNA library	50	0.007
345	emb|AL114727.1|CNS01BV3 Botrytis cinerea strain T4 cDNA library	50	0.007
346	emb|AL114044.1|CNS01BC4 Botrytis cinerea strain T4 cDNA library	50	0.007
347	emb|AL114043.1|CNS01BC3 Botrytis cinerea strain T4 cDNA library	50	0.007
348	emb|AL112807.1|CNS01ADR Botrytis cinerea strain T4 cDNA library	50	0.007
349	emb|AL112775.1|CNS01ACV Botrytis cinerea strain T4 cDNA library	50	0.007
350	emb|AL111608.1|CNS019GG Botrytis cinerea strain T4 cDNA library	50	0.007
351	emb|AL111718.1|CNS019JI Botrytis cinerea strain T4 cDNA library	50	0.007
352	emb|AL111190.1|CNS0194U Botrytis cinerea strain T4 cDNA library	50	0.007
353	ref|XM_578693.1| PREDICTED: Rattus norvegicus similar to ribosom...	50	0.007
354	gb|AY735455.1| Sus scrofa ribosomal protein L10 mRNA, complete cds	50	0.007
355	gb|AY911380.1| Bos taurus clone IMAGE:7961519 GekBS044P-like mRN...	50	0.007
356	dbj|BS000216.1| Pan troglodytes chromosome 22 clone:RP43-057N15,...	50	0.007
357	dbj|AK130863.1| Homo sapiens cDNA FLJ27353 fis, clone TST05348, ...	50	0.007
358	dbj|AK110755.1| Oryza sativa (japonica cultivar-group) cDNA clon...	50	0.007
359	emb|AL591769.3|CNS07EGM Human chromosome 14 DNA sequence BAC R-6...	50	0.007
360	gb|BT021081.1| Bos taurus ribosomal protein L10 (RPL10), mRNA, c...	50	0.007
361	dbj|AP001699.1| Homo sapiens genomic DNA, chromosome 21q, sectio...	50	0.007
362	gb|DQ206500.1| Priapulus caudatus isolate TOA18 ribosomal protei...	50	0.007
363	dbj|AP000893.5| Homo sapiens genomic DNA, chromosome 11q, clone:...	50	0.007
364	dbj|AP001767.5| Homo sapiens genomic DNA, chromosome 11 clone:RP...	50	0.007
365	emb|CT573034.8| Mouse DNA sequence from clone RP23-156C20 on chr...	50	0.007
366	gb|AY610342.1| Sus scrofa clone rebs26c_k7.y1.abd, mRNA sequence	50	0.007
367	emb|AL591768.2|CNS07EGL Human chromosome 14 DNA sequence BAC R-2...	50	0.007
368	dbj|AP001605.1| Homo sapiens genomic DNA, chromosome 21, clone:K...	50	0.007
369	dbj|AP001604.1| Homo sapiens genomic DNA, chromosome 21, clone:K...	50	0.007
370	ref|XM_360593.1| Magnaporthe grisea 70-15 hypothetical protein (...	48	0.029
371	ref|XM_582414.2| PREDICTED: Bos taurus similar to ribosomal prot...	48	0.029
372	ref|XM_647007.1| Entamoeba histolytica HM-1:IMSS 60S ribosomal p...	48	0.029
373	ref|XM_647272.1| Entamoeba histolytica HM-1:IMSS 60S ribosomal p...	48	0.029
374	ref|XM_647426.1| Entamoeba histolytica HM-1:IMSS 60S ribosomal p...	48	0.029
375	ref|XM_647446.1| Entamoeba histolytica HM-1:IMSS 60S ribosomal p...	48	0.029
376	ref|XM_652123.1| Entamoeba histolytica HM-1:IMSS 60S ribosomal p...	48	0.029
377	emb|CR711070.2|CNS0GBM2 Tetraodon nigroviridis full-length cDNA	48	0.029
378	emb|CR708339.2|CNS0G9I7 Tetraodon nigroviridis full-length cDNA	48	0.029
379	emb|CR703469.2|CNS0G5QX Tetraodon nigroviridis full-length cDNA	48	0.029
380	emb|CR703431.2|CNS0G5PV Tetraodon nigroviridis full-length cDNA	48	0.029
381	emb|CR702951.2|CNS0G5CJ Tetraodon nigroviridis full-length cDNA	48	0.029
382	emb|CR694810.2|CNS0FZ2E Tetraodon nigroviridis full-length cDNA	48	0.029
383	emb|CR679487.2|CNS0FN8R Tetraodon nigroviridis full-length cDNA	48	0.029
384	emb|BX071887.1|CNS09RMR Single read from an extremity of a full-...	48	0.029
385	emb|BX071440.1|CNS09RAC Single read from an extremity of a full-...	48	0.029
386	emb|BX071439.1|CNS09RAB Single read from an extremity of a full-...	48	0.029
387	emb|BX070864.1|CNS09QUC Single read from an extremity of a full-...	48	0.029
388	emb|BX070863.1|CNS09QUB Single read from an extremity of a full-...	48	0.029
389	emb|BX070583.1|CNS09QMJ Single read from an extremity of a full-...	48	0.029
390	emb|BX070408.1|CNS09QHO Single read from an extremity of a full-...	48	0.029
391	emb|BX070407.1|CNS09QHN Single read from an extremity of a full-...	48	0.029
392	emb|BX070073.1|CNS09Q8D Single read from an extremity of a full-...	48	0.029
393	emb|BX070072.1|CNS09Q8C Single read from an extremity of a full-...	48	0.029
394	emb|BX070039.1|CNS09Q7F Single read from an extremity of a full-...	48	0.029
395	emb|BX070038.1|CNS09Q7E Single read from an extremity of a full-...	48	0.029
396	emb|BX069787.1|CNS09Q0F Single read from an extremity of a full-...	48	0.029
397	emb|BX066234.1|CNS09N9Q Single read from an extremity of a full-...	48	0.029
398	emb|BX066200.1|CNS09N8S Single read from an extremity of a full-...	48	0.029
399	emb|BX065195.1|CNS09MGV Single read from an extremity of a full-...	48	0.029
400	emb|BX065194.1|CNS09MGU Single read from an extremity of a full-...	48	0.029
401	emb|BX065178.1|CNS09MGE Single read from an extremity of a full-...	48	0.029
402	emb|BX065177.1|CNS09MGD Single read from an extremity of a full-...	48	0.029
403	emb|BX065011.1|CNS09MBR Single read from an extremity of a full-...	48	0.029
404	emb|BX065010.1|CNS09MBQ Single read from an extremity of a full-...	48	0.029
405	emb|BX064957.1|CNS09MA9 Single read from an extremity of a full-...	48	0.029
406	emb|BX064956.1|CNS09MA8 Single read from an extremity of a full-...	48	0.029
407	emb|BX064177.1|CNS09LOL Single read from an extremity of a full-...	48	0.029
408	emb|BX064176.1|CNS09LOK Single read from an extremity of a full-...	48	0.029
409	emb|BX063991.1|CNS09LJF Single read from an extremity of a full-...	48	0.029
410	emb|BX063841.1|CNS09LF9 Single read from an extremity of a full-...	48	0.029
411	emb|BX063840.1|CNS09LF8 Single read from an extremity of a full-...	48	0.029
412	emb|BX063569.1|CNS09L7P Single read from an extremity of a full-...	48	0.029
413	emb|BX062882.1|CNS09KOM Single read from an extremity of a full-...	48	0.029
414	emb|BX062815.1|CNS09KMR Single read from an extremity of a full-...	48	0.029
415	emb|BX062474.1|CNS09KDA Single read from an extremity of a full-...	48	0.029
416	emb|BX062455.1|CNS09KCR Single read from an extremity of a full-...	48	0.029
417	emb|BX062454.1|CNS09KCQ Single read from an extremity of a full-...	48	0.029
418	emb|BX061131.1|CNS09JBZ Single read from an extremity of a full-...	48	0.029
419	emb|BX060081.1|CNS09IIT Single read from an extremity of a full-...	48	0.029
420	emb|BX060080.1|CNS09IIS Single read from an extremity of a full-...	48	0.029
421	emb|BX059294.1|CNS09HWY Single read from an extremity of a full-...	48	0.029
422	emb|BX059258.1|CNS09HVY Single read from an extremity of a full-...	48	0.029
423	emb|BX058831.1|CNS09HK3 Single read from an extremity of a full-...	48	0.029
424	emb|BX058215.1|CNS09H2Z Single read from an extremity of a full-...	48	0.029
425	emb|BX057966.1|CNS09GW2 Single read from an extremity of a full-...	48	0.029
426	emb|BX056215.1|CNS09FJF Single read from an extremity of a full-...	48	0.029
427	emb|BX054398.1|CNS09E4Y Single read from an extremity of a full-...	48	0.029
428	emb|BX052529.1|CNS09CP1 Single read from an extremity of a full-...	48	0.029
429	emb|BX051694.1|CNS09C1U Single read from an extremity of a full-...	48	0.029
430	emb|BX051693.1|CNS09C1T Single read from an extremity of a full-...	48	0.029
431	emb|BX051507.1|CNS09BWN Single read from an extremity of a full-...	48	0.029
432	emb|BX050768.1|CNS09BC4 Single read from an extremity of a full-...	48	0.029
433	emb|BX050767.1|CNS09BC3 Single read from an extremity of a full-...	48	0.029
434	emb|BX049897.1|CNS09ANX Single read from an extremity of a full-...	48	0.029
435	emb|BX046497.1|CNS0981H Single read from an extremity of a full-...	48	0.029
436	emb|BX048384.1|CNS099HW Single read from an extremity of a full-...	48	0.029
437	emb|BX048191.1|CNS099CJ Single read from an extremity of a full-...	48	0.029
438	emb|BX047773.1|CNS0990X Single read from an extremity of a full-...	48	0.029
439	emb|BX047772.1|CNS0990W Single read from an extremity of a full-...	48	0.029
440	emb|BX047148.1|CNS098JK Single read from an extremity of a full-...	48	0.029
441	emb|BX045949.1|CNS097M9 Single read from an extremity of a full-...	48	0.029
442	emb|BX045930.1|CNS097LQ Single read from an extremity of a full-...	48	0.029
443	emb|BX045929.1|CNS097LP Single read from an extremity of a full-...	48	0.029
444	emb|BX045069.1|CNS096XT Single read from an extremity of a full-...	48	0.029
445	emb|BX045068.1|CNS096XS Single read from an extremity of a full-...	48	0.029
446	emb|BX044940.1|CNS096U8 Single read from an extremity of a full-...	48	0.029
447	emb|BX044939.1|CNS096U7 Single read from an extremity of a full-...	48	0.029
448	emb|BX045236.1|CNS0972G Single read from an extremity of a full-...	48	0.029
449	emb|BX045235.1|CNS0972F Single read from an extremity of a full-...	48	0.029
450	emb|BX045210.1|CNS0971Q Single read from an extremity of a full-...	48	0.029
451	emb|BX045168.1|CNS0970K Single read from an extremity of a full-...	48	0.029
452	emb|BX045167.1|CNS0970J Single read from an extremity of a full-...	48	0.029
453	emb|BX044818.1|CNS096QU Single read from an extremity of a full-...	48	0.029
454	emb|BX044813.1|CNS096QP Single read from an extremity of a full-...	48	0.029
455	emb|BX044702.1|CNS096NM Single read from an extremity of a full-...	48	0.029
456	emb|BX043998.1|CNS09642 Single read from an extremity of a full-...	48	0.029
457	emb|BX043345.1|CNS095LX Single read from an extremity of a full-...	48	0.029
458	emb|BX043344.1|CNS095LW Single read from an extremity of a full-...	48	0.029
459	emb|BX043332.1|CNS095LK Single read from an extremity of a full-...	48	0.029
460	emb|BX042201.1|CNS094Q5 Single read from an extremity of a full-...	48	0.029
461	emb|BX041060.1|CNS093UG Single read from an extremity of a full-...	48	0.029
462	emb|BX040103.1|CNS0933V Single read from an extremity of a full-...	48	0.029
463	emb|BX039792.1|CNS092V8 Single read from an extremity of a full-...	48	0.029
464	emb|BX035748.1|CNS08ZQW Single read from an extremity of a full-...	48	0.029
465	emb|BX035747.1|CNS08ZQV Single read from an extremity of a full-...	48	0.029
466	emb|BX035295.1|CNS08ZEB Single read from an extremity of a full-...	48	0.029
467	emb|BX033806.1|CNS08Y8Y Single read from an extremity of a full-...	48	0.029
468	emb|BX033805.1|CNS08Y8X Single read from an extremity of a full-...	48	0.029
469	emb|BX032532.1|CNS08X9K Single read from an extremity of a full-...	48	0.029
470	emb|BX031115.1|CNS08W67 Single read from an extremity of a full-...	48	0.029
471	emb|BX027292.1|CNS08T80 Single read from an extremity of a full-...	48	0.029
472	emb|BX027291.1|CNS08T7Z Single read from an extremity of a full-...	48	0.029
473	emb|BX020769.1|CNS08O6T Single read from an extremity of a full-...	48	0.029
474	emb|BX019929.1|CNS08NJH Single read from an extremity of a full-...	48	0.029
475	emb|BX019914.1|CNS08NJ2 Single read from an extremity of a full-...	48	0.029
476	emb|BX011291.1|CNS08GVJ Single read from an extremity of a full-...	48	0.029
477	emb|BX011290.1|CNS08GVI Single read from an extremity of a full-...	48	0.029
478	emb|BX011211.1|CNS08GTB Single read from an extremity of a full-...	48	0.029
479	emb|BX010775.1|CNS08GH7 Single read from an extremity of a full-...	48	0.029
480	emb|BX010321.1|CNS08G4L Single read from an extremity of a full-...	48	0.029
481	emb|BX010320.1|CNS08G4K Single read from an extremity of a full-...	48	0.029
482	emb|BX010145.1|CNS08FZP Single read from an extremity of a full-...	48	0.029
483	emb|BX008868.1|CNS08F08 Single read from an extremity of a full-...	48	0.029
484	emb|BX008784.1|CNS08EXW Single read from an extremity of a full-...	48	0.029
485	emb|BX007961.1|CNS08EB1 Single read from an extremity of a full-...	48	0.029
486	emb|BX006619.1|CNS08D9R Single read from an extremity of a full-...	48	0.029
487	dbj|AB195817.1| Coprinopsis cinerea dst1 gene for hypothetical p...	48	0.029
488	gb|BC109561.1| Bos taurus cDNA clone MGC:133542 IMAGE:8051598, c...	48	0.029
489	gb|AY072793.1| Entamoeba histolytica ribosomal protein L10 mRNA,...	48	0.029
490	ref|XM_236837.2| PREDICTED: Rattus norvegicus similar to ribosom...	48	0.029
491	gb|AY961498.1| Lysiphlebus testaceipes ribosomal protein L10/QM-...	48	0.029
492	ref|XM_309144.2| Anopheles gambiae str. PEST ENSANGP00000023750 ...	48	0.029
493	ref|XM_560169.1| Anopheles gambiae str. PEST ENSANGP00000029269 ...	48	0.029
494	gb|AY850340.1| Magnaporthe grisea 60S ribosomal protein L10-A-li...	48	0.029
495	gb|AC022775.16| Mus musculus chromosome 15, clone RP23-71O17, co...	46	0.12
496	ref|XM_955693.1| Neurospora crassa OR74A hypothetical protein (N...	46	0.12
497	ref|XM_331355.1| Neurospora crassa OR74A hypothetical protein (N...	46	0.12
498	emb|Z48334.1|CEF10B5 Caenorhabditis elegans Cosmid F10B5, comple...	46	0.12
499	gb|AC112151.3| Mus musculus BAC clone RP24-86M8 from 2, complete...	46	0.12
500	emb|BX035296.1|CNS08ZEC Single read from an extremity of a full-...	46	0.12

---

>dbj|AK120033.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-188-A02, full
           insert sequence
          Length = 906

 Score =  307 bits (155), Expect = 2e-80
 Identities = 275/315 (87%)
 Strand = Plus / Minus

                                                                       
Query: 217 aggcggccatggcatccgagcagcttagcattgactccatcaggcaagaccctgccctca 276
           ||||| |||||||| || || |||||||||||||| |||||||||| ||  || ||||| 
Sbjct: 676 aggcgaccatggcaaccaagtagcttagcattgacaccatcaggcatgattctaccctcg 617

                                                                       
Query: 277 ctcttgaacttgaggtagtcattgcggttgaacttggtgaaaccccacttcctgctctca 336
           ||||| | | ||| ||| |||| |||| |||||||||||||||||||||| || ||||||
Sbjct: 616 ctcttaagcctgacgtattcatcgcggctgaacttggtgaaaccccactttctactctca 557

                                                                       
Query: 337 atgatcttttggcgaccagggaacttgaacttggcacgacgaagagcctcagttgcatgg 396
           ||||||||||||||||||||||||||||||||||||||||| || || ||  | ||||||
Sbjct: 556 atgatcttttggcgaccagggaacttgaacttggcacgacggagggcttcgctggcatgg 497

                                                                       
Query: 397 atggcattgttgggcttgcaccgcacagaaaggaggacctggccaatggcaacacgggca 456
           |  ||||||||||||||||||||||||||||||||||||||||||||  | || |  |||
Sbjct: 496 acagcattgttgggcttgcaccgcacagaaaggaggacctggccaatatccaccctagca 437

                                                                       
Query: 457 cagactccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagcccca 516
           |||  |||||| |||||||| |||||||||||||| ||||||||||||||||| ||||| 
Sbjct: 436 caggttccctgtggcttcccaaaagcacccctcattccagtctggagcctatctgccccg 377

                          
Query: 517 gcacacgaaagcatc 531
           |||||||||||||||
Sbjct: 376 gcacacgaaagcatc 362

---

>emb|X64621.1|OSR22CDNA O.sativa R22 mRNA
          Length = 629

 Score =  307 bits (155), Expect = 2e-80
 Identities = 275/315 (87%)
 Strand = Plus / Minus

                                                                       
Query: 217 aggcggccatggcatccgagcagcttagcattgactccatcaggcaagaccctgccctca 276
           ||||| |||||||| || || |||||||||||||| |||||||||| ||  || ||||| 
Sbjct: 389 aggcgaccatggcaaccaagtagcttagcattgacaccatcaggcatgattctaccctcg 330

                                                                       
Query: 277 ctcttgaacttgaggtagtcattgcggttgaacttggtgaaaccccacttcctgctctca 336
           ||||| | | ||| ||| |||| |||| |||||||||||||||||||||| || ||||||
Sbjct: 329 ctcttaagcctgacgtattcatcgcggctgaacttggtgaaaccccactttctactctca 270

                                                                       
Query: 337 atgatcttttggcgaccagggaacttgaacttggcacgacgaagagcctcagttgcatgg 396
           ||||||||||||||||||||||||||||||||||||||||| || || ||  | ||||||
Sbjct: 269 atgatcttttggcgaccagggaacttgaacttggcacgacggagggcttcgctggcatgg 210

                                                                       
Query: 397 atggcattgttgggcttgcaccgcacagaaaggaggacctggccaatggcaacacgggca 456
           |  ||||||||||||||||||||||||||||||||||||||||||||  | || |  |||
Sbjct: 209 acagcattgttgggcttgcaccgcacagaaaggaggacctggccaatatccaccctagca 150

                                                                       
Query: 457 cagactccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagcccca 516
           |||  |||||| |||||||| |||||||||||||| ||||||||||||||||| ||||| 
Sbjct: 149 caggttccctgtggcttcccaaaagcacccctcattccagtctggagcctatctgccccg 90

                          
Query: 517 gcacacgaaagcatc 531
           |||||||||||||||
Sbjct: 89  gcacacgaaagcatc 75

---

>dbj|AK066128.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013052E20, full
           insert sequence
          Length = 910

 Score =  307 bits (155), Expect = 2e-80
 Identities = 275/315 (87%)
 Strand = Plus / Minus

                                                                       
Query: 217 aggcggccatggcatccgagcagcttagcattgactccatcaggcaagaccctgccctca 276
           ||||| |||||||| || || |||||||||||||| |||||||||| ||  || ||||| 
Sbjct: 680 aggcgaccatggcaaccaagtagcttagcattgacaccatcaggcatgattctaccctcg 621

                                                                       
Query: 277 ctcttgaacttgaggtagtcattgcggttgaacttggtgaaaccccacttcctgctctca 336
           ||||| | | ||| ||| |||| |||| |||||||||||||||||||||| || ||||||
Sbjct: 620 ctcttaagcctgacgtattcatcgcggctgaacttggtgaaaccccactttctactctca 561

                                                                       
Query: 337 atgatcttttggcgaccagggaacttgaacttggcacgacgaagagcctcagttgcatgg 396
           ||||||||||||||||||||||||||||||||||||||||| || || ||  | ||||||
Sbjct: 560 atgatcttttggcgaccagggaacttgaacttggcacgacggagggcttcgctggcatgg 501

                                                                       
Query: 397 atggcattgttgggcttgcaccgcacagaaaggaggacctggccaatggcaacacgggca 456
           |  ||||||||||||||||||||||||||||||||||||||||||||  | || |  |||
Sbjct: 500 acagcattgttgggcttgcaccgcacagaaaggaggacctggccaatatccaccctagca 441

                                                                       
Query: 457 cagactccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagcccca 516
           |||  |||||| |||||||| |||||||||||||| ||||||||||||||||| ||||| 
Sbjct: 440 caggttccctgtggcttcccaaaagcacccctcattccagtctggagcctatctgccccg 381

                          
Query: 517 gcacacgaaagcatc 531
           |||||||||||||||
Sbjct: 380 gcacacgaaagcatc 366

---

>dbj|AK062208.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-H08, full
           insert sequence
          Length = 555

 Score =  307 bits (155), Expect = 2e-80
 Identities = 275/315 (87%)
 Strand = Plus / Minus

                                                                       
Query: 217 aggcggccatggcatccgagcagcttagcattgactccatcaggcaagaccctgccctca 276
           ||||| |||||||| || || |||||||||||||| |||||||||| ||  || ||||| 
Sbjct: 325 aggcgaccatggcaaccaagtagcttagcattgacaccatcaggcatgattctaccctcg 266

                                                                       
Query: 277 ctcttgaacttgaggtagtcattgcggttgaacttggtgaaaccccacttcctgctctca 336
           ||||| | | ||| ||| |||| |||| |||||||||||||||||||||| || ||||||
Sbjct: 265 ctcttaagcctgacgtattcatcgcggctgaacttggtgaaaccccactttctactctca 206

                                                                       
Query: 337 atgatcttttggcgaccagggaacttgaacttggcacgacgaagagcctcagttgcatgg 396
           ||||||||||||||||||||||||||||||||||||||||| || || ||  | ||||||
Sbjct: 205 atgatcttttggcgaccagggaacttgaacttggcacgacggagggcttcgctggcatgg 146

                                                                       
Query: 397 atggcattgttgggcttgcaccgcacagaaaggaggacctggccaatggcaacacgggca 456
           |  ||||||||||||||||||||||||||||||||||||||||||||  | || |  |||
Sbjct: 145 acagcattgttgggcttgcaccgcacagaaaggaggacctggccaatatccaccctagca 86

                                                                       
Query: 457 cagactccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagcccca 516
           |||  |||||| |||||||| |||||||||||||| ||||||||||||||||| ||||| 
Sbjct: 85  caggttccctgtggcttcccaaaagcacccctcattccagtctggagcctatctgccccg 26

                          
Query: 517 gcacacgaaagcatc 531
           |||||||||||||||
Sbjct: 25  gcacacgaaagcatc 11

---

>gb|AF470356.1| Triticum aestivum QM mRNA, partial cds
          Length = 537

 Score =  305 bits (154), Expect = 8e-80
 Identities = 188/199 (94%), Gaps = 1/199 (0%)
 Strand = Plus / Minus

                                                                       
Query: 334 tcaatgatcttttggcgaccagggaa-cttgaacttggcacgacgaagagcctcagttgc 392
           ||||| ||||| ||||| |||||||| |||||||||||||||| |||| |||||||| ||
Sbjct: 537 tcaatnatcttntggcggccagggaancttgaacttggcacgangaagggcctcagtggc 478

                                                                       
Query: 393 atggatggcattgttgggcttgcaccgcacagaaaggaggacctggccaatggcaacacg 452
           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 477 atggatggcattgttgggcttgcaccgcacagaaaggaggacctgcccaatggcaacacg 418

                                                                       
Query: 453 ggcacagactccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagc 512
           |||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 417 ggcacagactccatgcggcttcccaaaagcacccctcataccagtctggagcctatcagc 358

                              
Query: 513 cccagcacacgaaagcatc 531
           ||| |||||||||||||||
Sbjct: 357 cccggcacacgaaagcatc 339

---

>ref|XM_476047.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 618

 Score =  293 bits (148), Expect = 3e-76
 Identities = 256/292 (87%)
 Strand = Plus / Minus

                                                                       
Query: 240 cttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtagtcatt 299
           |||||||||||| |||||||||| ||  || ||||| ||||| | | ||| ||| |||| 
Sbjct: 594 cttagcattgacaccatcaggcatgattctaccctcgctcttaagcctgacgtattcatc 535

                                                                       
Query: 300 gcggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaa 359
           |||| |||||||||||||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 534 gcggctgaacttggtgaaaccccactttctactctcaatgatcttttggcgaccagggaa 475

                                                                       
Query: 360 cttgaacttggcacgacgaagagcctcagttgcatggatggcattgttgggcttgcaccg 419
           |||||||||||||||||| || || ||  | |||||||  ||||||||||||||||||||
Sbjct: 474 cttgaacttggcacgacggagggcttcgctggcatggacagcattgttgggcttgcaccg 415

                                                                       
Query: 420 cacagaaaggaggacctggccaatggcaacacgggcacagactccctgcggcttcccgaa 479
           ||||||||||||||||||||||||  | || |  ||||||  |||||| |||||||| ||
Sbjct: 414 cacagaaaggaggacctggccaatatccaccctagcacaggttccctgtggcttcccaaa 355

                                                               
Query: 480 agcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           |||||||||||| ||||||||||||||||| ||||| |||||||||||||||
Sbjct: 354 agcacccctcattccagtctggagcctatctgccccggcacacgaaagcatc 303

---

>gb|AC084817.5| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0419C04,
             complete sequence
          Length = 136713

 Score =  236 bits (119), Expect = 6e-59
 Identities = 188/211 (89%)
 Strand = Plus / Minus

                                                                         
Query: 321   ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaag 380
             |||||| || ||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 59031 ccactttctactctcaatgatcttttggcgaccagggaacttgaacttggcacgacggag 58972

                                                                         
Query: 381   agcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctggcc 440
              || ||  | |||||||  |||||||||||||||||||||||||||||||||||||||||
Sbjct: 58971 ggcttcgctggcatggacagcattgttgggcttgcaccgcacagaaaggaggacctggcc 58912

                                                                         
Query: 441   aatggcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtctg 500
             |||  | || |  ||||||  |||||| |||||||| |||||||||||||| ||||||||
Sbjct: 58911 aatatccaccctagcacaggttccctgtggcttcccaaaagcacccctcattccagtctg 58852

                                            
Query: 501   gagcctatcagccccagcacacgaaagcatc 531
             ||||||||| ||||| |||||||||||||||
Sbjct: 58851 gagcctatctgccccggcacacgaaagcatc 58821



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                         
Query: 240   cttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtagtcatt 299
             |||||||||||| |||||||||| ||  || ||||| ||||| | | ||| ||| |||| 
Sbjct: 59216 cttagcattgacaccatcaggcatgattctaccctcgctcttaagcctgacgtattcatc 59157

                                    
Query: 300   gcggttgaacttggtgaaacccc 322
             |||| ||||||||||||||||||
Sbjct: 59156 gcggctgaacttggtgaaacccc 59134

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score =  236 bits (119), Expect = 6e-59
 Identities = 188/211 (89%)
 Strand = Plus / Minus

                                                                           
Query: 321     ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaag 380
               |||||| || ||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 4084337 ccactttctactctcaatgatcttttggcgaccagggaacttgaacttggcacgacggag 4084278

                                                                           
Query: 381     agcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctggcc 440
                || ||  | |||||||  |||||||||||||||||||||||||||||||||||||||||
Sbjct: 4084277 ggcttcgctggcatggacagcattgttgggcttgcaccgcacagaaaggaggacctggcc 4084218

                                                                           
Query: 441     aatggcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtctg 500
               |||  | || |  ||||||  |||||| |||||||| |||||||||||||| ||||||||
Sbjct: 4084217 aatatccaccctagcacaggttccctgtggcttcccaaaagcacccctcattccagtctg 4084158

                                              
Query: 501     gagcctatcagccccagcacacgaaagcatc 531
               ||||||||| ||||| |||||||||||||||
Sbjct: 4084157 gagcctatctgccccggcacacgaaagcatc 4084127



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                           
Query: 240     cttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtagtcatt 299
               |||||||||||| |||||||||| ||  || ||||| ||||| | | ||| ||| |||| 
Sbjct: 4084522 cttagcattgacaccatcaggcatgattctaccctcgctcttaagcctgacgtattcatc 4084463

                                      
Query: 300     gcggttgaacttggtgaaacccc 322
               |||| ||||||||||||||||||
Sbjct: 4084462 gcggctgaacttggtgaaacccc 4084440

---

>emb|X81692.1|OSSG12G O.sativa SG12 gene
          Length = 1734

 Score =  236 bits (119), Expect = 6e-59
 Identities = 188/211 (89%)
 Strand = Plus / Minus

                                                                        
Query: 321  ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaag 380
            |||||| || ||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 1120 ccactttctactctcaatgatcttttggcgaccagggaacttgaacttggcacgacggag 1061

                                                                        
Query: 381  agcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctggcc 440
             || ||  | |||||||  |||||||||||||||||||||||||||||||||||||||||
Sbjct: 1060 ggcttcgctggcatggacagcattgttgggcttgcaccgcacagaaaggaggacctggcc 1001

                                                                        
Query: 441  aatggcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtctg 500
            |||  | || |  ||||||  |||||| |||||||| |||||||||||||| ||||||||
Sbjct: 1000 aatatccaccctagcacaggttccctgtggcttcccaaaagcacccctcattccagtctg 941

                                           
Query: 501  gagcctatcagccccagcacacgaaagcatc 531
            ||||||||| ||||| |||||||||||||||
Sbjct: 940  gagcctatctgccccggcacacgaaagcatc 910



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                        
Query: 240  cttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtagtcatt 299
            |||||||||||| |||||||||| ||  || ||||| ||||| | | ||| ||| |||| 
Sbjct: 1307 cttagcattgacaccatcaggcatgattctaccctcgctcttaagcctgacgtattcatc 1248

                                   
Query: 300  gcggttgaacttggtgaaacccc 322
            |||| ||||||||||||||||||
Sbjct: 1247 gcggctgaacttggtgaaacccc 1225

---

>gb|U55048.1|OSU55048 Oryza sativa QM gene, complete cds
          Length = 2542

 Score =  236 bits (119), Expect = 6e-59
 Identities = 188/211 (89%)
 Strand = Plus / Minus

                                                                        
Query: 321  ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaag 380
            |||||| || ||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 1862 ccactttctactctcaatgatcttttggcgaccagggaacttgaacttggcacgacggag 1803

                                                                        
Query: 381  agcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctggcc 440
             || ||  | |||||||  |||||||||||||||||||||||||||||||||||||||||
Sbjct: 1802 ggcttcgctggcatggacagcattgttgggcttgcaccgcacagaaaggaggacctggcc 1743

                                                                        
Query: 441  aatggcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtctg 500
            |||  | || |  ||||||  |||||| |||||||| |||||||||||||| ||||||||
Sbjct: 1742 aatatccaccctagcacaggttccctgtggcttcccaaaagcacccctcattccagtctg 1683

                                           
Query: 501  gagcctatcagccccagcacacgaaagcatc 531
            ||||||||| ||||| |||||||||||||||
Sbjct: 1682 gagcctatctgccccggcacacgaaagcatc 1652



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                        
Query: 240  cttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtagtcatt 299
            |||||||||||| |||||||||| ||  || ||||| ||||| | | ||| ||| |||| 
Sbjct: 2047 cttagcattgacaccatcaggcatgattctaccctcgctcttaagcctgacgtattcatc 1988

                                   
Query: 300  gcggttgaacttggtgaaacccc 322
            |||| ||||||||||||||||||
Sbjct: 1987 gcggctgaacttggtgaaacccc 1965

---

>gb|BT016528.1| Zea mays clone Contig361 mRNA sequence
          Length = 814

 Score =  230 bits (116), Expect = 4e-57
 Identities = 254/300 (84%)
 Strand = Plus / Minus

                                                                       
Query: 232 ccgagcagcttagcattgactccatcaggcaagaccctgccctcactcttgaacttgagg 291
           ||||||||||| || ||||| |||||||| |  |  |||||||| |||||| |||| |||
Sbjct: 586 ccgagcagctttgcgttgacaccatcaggaacaattctgccctcgctcttgtacttcagg 527

                                                                       
Query: 292 tagtcattgcggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcga 351
           ||||||  |||| ||||||||||||| |||||||| ||||||||||||||||||||||| 
Sbjct: 526 tagtcagcgcggctgaacttggtgaagccccactttctgctctcaatgatcttttggcgg 467

                                                                       
Query: 352 ccagggaacttgaacttggcacgacgaagagcctcagttgcatggatggcattgttgggc 411
           ||||||||||||||||| || ||||| ||||| ||  | ||||||   |||||||||  |
Sbjct: 466 ccagggaacttgaacttagcgcgacgcagagcttcgctggcatgggcagcattgttgtcc 407

                                                                       
Query: 412 ttgcaccgcacagaaaggaggacctggccaatggcaacacgggcacagactccctgcggc 471
           ||||| ||||| |||||||||||||| |||||| | || |  ||||||   ||||| |||
Sbjct: 406 ttgcatcgcacggaaaggaggacctgaccaatgtccaccctagcacaggtgccctgaggc 347

                                                                       
Query: 472 ttcccgaaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           || || || ||||||||||| |||||||||||||| ||||||||||||||||||||||||
Sbjct: 346 ttgccaaaggcacccctcattccagtctggagcctgtcagccccagcacacgaaagcatc 287

---

>gb|BT016423.1| Zea mays clone Contig256 mRNA sequence
          Length = 959

 Score =  222 bits (112), Expect = 9e-55
 Identities = 253/300 (84%)
 Strand = Plus / Minus

                                                                       
Query: 232 ccgagcagcttagcattgactccatcaggcaagaccctgccctcactcttgaacttgagg 291
           ||||||||||| || ||||| |||||||| |  |  || |||||||||||| |||| |||
Sbjct: 656 ccgagcagctttgcgttgacaccatcaggaacaattctaccctcactcttgtacttcagg 597

                                                                       
Query: 292 tagtcattgcggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcga 351
           |||||    ||| ||||||||||||| |||||||| ||||||||||| ||||||||||| 
Sbjct: 596 tagtcggcacggctgaacttggtgaagccccactttctgctctcaataatcttttggcgg 537

                                                                       
Query: 352 ccagggaacttgaacttggcacgacgaagagcctcagttgcatggatggcattgttgggc 411
           |||||||||||||||||||| ||||| ||||| ||| | |||||    |||||||||  |
Sbjct: 536 ccagggaacttgaacttggcgcgacgcagagcttcactggcatgtgcagcattgttgtcc 477

                                                                       
Query: 412 ttgcaccgcacagaaaggaggacctggccaatggcaacacgggcacagactccctgcggc 471
           ||||| || ||||||||||||||||| |||||| | || |  ||||||   ||||| |||
Sbjct: 476 ttgcatcgaacagaaaggaggacctgaccaatgtccaccctagcacaggtgccctgaggc 417

                                                                       
Query: 472 ttcccgaaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           || || || ||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 416 ttgccaaaggcacccctcattccagtctggagcctatcagccccagcacacgaaagcatc 357

---

>gb|AY103671.1| Zea mays PCO135454 mRNA sequence
          Length = 1044

 Score =  206 bits (104), Expect = 5e-50
 Identities = 251/300 (83%)
 Strand = Plus / Minus

                                                                       
Query: 232 ccgagcagcttagcattgactccatcaggcaagaccctgccctcactcttgaacttgagg 291
           ||||||||||| || ||||| |||||||| |  |  || |||||||||||| |||| |||
Sbjct: 700 ccgagcagctttgcgttgacaccatcaggaacaattctaccctcactcttgtacttcagg 641

                                                                       
Query: 292 tagtcattgcggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcga 351
           |||||    ||| ||||||||||||| |||||||| ||||||||||| ||||||||||| 
Sbjct: 640 tagtcggcacggctgaacttggtgaagccccactttctgctctcaataatcttttggcgg 581

                                                                       
Query: 352 ccagggaacttgaacttggcacgacgaagagcctcagttgcatggatggcattgttgggc 411
           |||||||||||||||||||| ||||| ||||| ||| | |||||    |||||||||  |
Sbjct: 580 ccagggaacttgaacttggcgcgacgcagagcttcactggcatgtgcagcattgttgtcc 521

                                                                       
Query: 412 ttgcaccgcacagaaaggaggacctggccaatggcaacacgggcacagactccctgcggc 471
           ||||| || ||||||||||||||||| |||||| | || |  ||||||   ||||| |||
Sbjct: 520 ttgcatcgaacagaaaggaggacctgaccaatgtccaccctagcacaggtgccctgaggc 461

                                                                       
Query: 472 ttcccgaaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           || || || ||||||||||| ||||||||||||||||||||||| ||||| |||||||||
Sbjct: 460 ttgccaaaggcacccctcattccagtctggagcctatcagccccggcacaggaaagcatc 401

---

>gb|U06108.1|ZMU06108 Zea mays B73 QM protein mRNA, complete cds
          Length = 928

 Score =  204 bits (103), Expect = 2e-49
 Identities = 250/299 (83%)
 Strand = Plus / Minus

                                                                       
Query: 233 cgagcagcttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggt 292
           |||||||||| || ||||| |||||||| |  |  |||||||| |||||| |||| ||||
Sbjct: 634 cgagcagctttgcgttgacaccatcaggaacaattctgccctcgctcttgtacttcaggt 575

                                                                       
Query: 293 agtcattgcggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgac 352
           |||||  |||| ||||||||||||| |||||||| ||||||||||||||||| |||||  
Sbjct: 574 agtcagcgcggctgaacttggtgaagccccactttctgctctcaatgatcttctggcggg 515

                                                                       
Query: 353 cagggaacttgaacttggcacgacgaagagcctcagttgcatggatggcattgttgggct 412
           |||||||||||||||| || ||||| ||||| ||  | ||||||   |||||||||  ||
Sbjct: 514 cagggaacttgaacttagcgcgacgcagagcttcgctggcatgggcagcattgttgtcct 455

                                                                       
Query: 413 tgcaccgcacagaaaggaggacctggccaatggcaacacgggcacagactccctgcggct 472
           |||| ||||| |||||||||||||| |||||| | || |  ||||||   ||||| ||||
Sbjct: 454 tgcagcgcacggaaaggaggacctgaccaatgtccaccctagcacaggtgccctgaggct 395

                                                                      
Query: 473 tcccgaaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           | || || ||||||||||| ||||||||||||||||||||||| ||||| |||||||||
Sbjct: 394 tgccaaaggcacccctcattccagtctggagcctatcagccccggcacaggaaagcatc 336

---

>gb|AF542972.1| Triticum aestivum SC34 tumor suppressor-like mRNA, complete
           sequence
          Length = 836

 Score =  192 bits (97), Expect = 8e-46
 Identities = 247/297 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 agcagcttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtag 294
           ||||||||||||||||| |||||||||| ||  || |||||||||||| |||||| ||| 
Sbjct: 653 agcagcttagcattgacaccatcaggcacgattcttccctcactcttgtacttgatgtaa 594

                                                                       
Query: 295 tcattgcggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgacca 354
           |||     |||||||||||| || ||||||||||||||   |||||||||||| || |||
Sbjct: 593 tcagccttgttgaacttggtaaagccccacttcctgctgcgaatgatcttttgacggcca 534

                                                                       
Query: 355 gggaacttgaacttggcacgacgaagagcctcagttgcatggatggcattgttgggcttg 414
           |||||||||||||||||||| || || || |||   ||||| |  |||||| |   ||||
Sbjct: 533 gggaacttgaacttggcacggcggagggcttcatcagcatgaacagcattgctctccttg 474

                                                                       
Query: 415 caccgcacagaaaggaggacctggccaatggcaacacgggcacagactccctgcggcttc 474
           || |||||||| ||||| || ||||||||| | ||||| ||||||   ||| | ||||||
Sbjct: 473 cagcgcacagataggagtacttggccaatgtccacacgagcacaggtacccagaggcttc 414

                                                                    
Query: 475 ccgaaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           || |||||||||||||| ||||||||||||||||||||||| ||||| |||||||||
Sbjct: 413 ccaaaagcacccctcattccagtctggagcctatcagccccggcacatgaaagcatc 357

---

>dbj|AK102971.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033115J23, full
           insert sequence
          Length = 995

 Score =  184 bits (93), Expect = 2e-43
 Identities = 273/333 (81%)
 Strand = Plus / Minus

                                                                       
Query: 199 ccaggggcacggttcgcaaggcggccatggcatccgagcagcttagcattgactccatca 258
           ||||||||||| |||||||| || |||||  | || ||||||| ||||||||| ||||||
Sbjct: 695 ccaggggcacgcttcgcaagacgaccatgagaaccaagcagctgagcattgacaccatca 636

                                                                       
Query: 259 ggcaagaccctgccctcactcttgaacttgaggtagtcattgcggttgaacttggtgaaa 318
           | ||  |  |||||||||  ||| ||||||| ||| || |  ||| ||||||||||||| 
Sbjct: 635 gacataattctgccctcagccttcaacttgacgtactcctcacgggtgaacttggtgaag 576

                                                                       
Query: 319 ccccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacga 378
           |||||||||||||| |  ||||||||||| || ||||||||||||||||||||||| || 
Sbjct: 575 ccccacttcctgctgtggatgatcttttgccggccagggaacttgaacttggcacggcgg 516

                                                                       
Query: 379 agagcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctgg 438
           || |||||    |||||  | |||||| |   |||||| || |||||||| || ||||| 
Sbjct: 515 agtgcctcttcagcatgtttagcattgctctccttgcaacgaacagaaagaagaacctga 456

                                                                       
Query: 439 ccaatggcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtc 498
           |||||| | || || ||||||   ||||| |||||||| |||||||||||||| ||||| 
Sbjct: 455 ccaatgtccacgcgagcacaggtaccctgaggcttcccaaaagcacccctcattccagtt 396

                                            
Query: 499 tggagcctatcagccccagcacacgaaagcatc 531
           |||||||||||||||||||||||||| ||||||
Sbjct: 395 tggagcctatcagccccagcacacgagagcatc 363

---

>dbj|AK060902.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-D11, full
           insert sequence
          Length = 1034

 Score =  184 bits (93), Expect = 2e-43
 Identities = 273/333 (81%)
 Strand = Plus / Minus

                                                                       
Query: 199 ccaggggcacggttcgcaaggcggccatggcatccgagcagcttagcattgactccatca 258
           ||||||||||| |||||||| || |||||  | || ||||||| ||||||||| ||||||
Sbjct: 701 ccaggggcacgcttcgcaagacgaccatgagaaccaagcagctgagcattgacaccatca 642

                                                                       
Query: 259 ggcaagaccctgccctcactcttgaacttgaggtagtcattgcggttgaacttggtgaaa 318
           | ||  |  |||||||||  ||| ||||||| ||| || |  ||| ||||||||||||| 
Sbjct: 641 gacataattctgccctcagccttcaacttgacgtactcctcacgggtgaacttggtgaag 582

                                                                       
Query: 319 ccccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacga 378
           |||||||||||||| |  ||||||||||| || ||||||||||||||||||||||| || 
Sbjct: 581 ccccacttcctgctgtggatgatcttttgccggccagggaacttgaacttggcacggcgg 522

                                                                       
Query: 379 agagcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctgg 438
           || |||||    |||||  | |||||| |   |||||| || |||||||| || ||||| 
Sbjct: 521 agtgcctcttcagcatgtttagcattgctctccttgcaacgaacagaaagaagaacctga 462

                                                                       
Query: 439 ccaatggcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtc 498
           |||||| | || || ||||||   ||||| |||||||| |||||||||||||| ||||| 
Sbjct: 461 ccaatgtccacgcgagcacaggtaccctgaggcttcccaaaagcacccctcattccagtt 402

                                            
Query: 499 tggagcctatcagccccagcacacgaaagcatc 531
           |||||||||||||||||||||||||| ||||||
Sbjct: 401 tggagcctatcagccccagcacacgagagcatc 369

---

>gb|U55212.1|OSU55212 Oryza sativa Wilms' tumor-related protein QM mRNA, partial cds
          Length = 747

 Score =  184 bits (93), Expect = 2e-43
 Identities = 273/333 (81%)
 Strand = Plus / Minus

                                                                       
Query: 199 ccaggggcacggttcgcaaggcggccatggcatccgagcagcttagcattgactccatca 258
           ||||||||||| |||||||| || |||||  | || ||||||| ||||||||| ||||||
Sbjct: 483 ccaggggcacgcttcgcaagacgaccatgagaaccaagcagctgagcattgacaccatca 424

                                                                       
Query: 259 ggcaagaccctgccctcactcttgaacttgaggtagtcattgcggttgaacttggtgaaa 318
           | ||  |  |||||||||  ||| ||||||| ||| || |  ||| ||||||||||||| 
Sbjct: 423 gacataattctgccctcagccttcaacttgacgtactcctcacgggtgaacttggtgaag 364

                                                                       
Query: 319 ccccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacga 378
           |||||||||||||| |  ||||||||||| || ||||||||||||||||||||||| || 
Sbjct: 363 ccccacttcctgctgtggatgatcttttgccggccagggaacttgaacttggcacggcgg 304

                                                                       
Query: 379 agagcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctgg 438
           || |||||    |||||  | |||||| |   |||||| || |||||||| || ||||| 
Sbjct: 303 agtgcctcttcagcatgtttagcattgctctccttgcaacgaacagaaagaagaacctga 244

                                                                       
Query: 439 ccaatggcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtc 498
           |||||| | || || ||||||   ||||| |||||||| |||||||||||||| ||||| 
Sbjct: 243 ccaatgtccacgcgagcacaggtaccctgaggcttcccaaaagcacccctcattccagtt 184

                                            
Query: 499 tggagcctatcagccccagcacacgaaagcatc 531
           |||||||||||||||||||||||||| ||||||
Sbjct: 183 tggagcctatcagccccagcacacgagagcatc 151

---

>emb|X81691.1|OSSC34MR O.sativa SC34 mRNA for tumor suppressor
          Length = 971

 Score =  178 bits (90), Expect = 1e-41
 Identities = 275/334 (82%), Gaps = 2/334 (0%)
 Strand = Plus / Minus

                                                                       
Query: 199 ccaggggcacggttcgcaaggcggccatggcatccgagcagcttagcattgactccatca 258
           ||||||||||| |||||||| || |||||  | || ||||||||||||||||| ||||||
Sbjct: 679 ccaggggcacgcttcgcaagacgaccatgagaaccaagcagcttagcattgacaccatca 620

                                                                       
Query: 259 ggcaagaccctgccctcactcttgaacttgaggtagtcatt-gcggttgaacttggtgaa 317
           | ||  |  |||||||||  ||| |||||||| || ||    |||| |||||||||||||
Sbjct: 619 gacataattctgccctcagccttcaacttgag-tactctcacgcggctgaacttggtgaa 561

                                                                       
Query: 318 accccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacg 377
            |||||||||||||| | |||||||||||| || ||||||||||||||||||||||| ||
Sbjct: 560 gccccacttcctgctgtgaatgatcttttgccggccagggaacttgaacttggcacggcg 501

                                                                       
Query: 378 aagagcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctg 437
            || |||||    |||||  | |||||| |   |||||| || |||||||| || |||||
Sbjct: 500 gagtgcctcttcagcatgtttagcattgctctccttgcaacgaacagaaagaagaacctg 441

                                                                       
Query: 438 gccaatggcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagt 497
            |||||| | || || ||||||   ||||| |||||||| |||||||||||||| |||||
Sbjct: 440 accaatgtccacgcgagcacaggtaccctgaggcttcccaaaagcacccctcattccagt 381

                                             
Query: 498 ctggagcctatcagccccagcacacgaaagcatc 531
            |||||||||||||||||||||||||| ||||||
Sbjct: 380 ttggagcctatcagccccagcacacgagagcatc 347

---

>dbj|AK103710.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033136P16, full
           insert sequence
          Length = 973

 Score =  176 bits (89), Expect = 5e-41
 Identities = 272/333 (81%)
 Strand = Plus / Minus

                                                                       
Query: 199 ccaggggcacggttcgcaaggcggccatggcatccgagcagcttagcattgactccatca 258
           ||||||||||| |||||||| || |||||  | || ||||||| ||||||||| ||||||
Sbjct: 695 ccaggggcacgcttcgcaagacgaccatgagaaccaagcagctgagcattgacaccatca 636

                                                                       
Query: 259 ggcaagaccctgccctcactcttgaacttgaggtagtcattgcggttgaacttggtgaaa 318
           | ||  |  |||||||||  ||| ||||||| ||| || |  ||| ||||||||||||| 
Sbjct: 635 gacataattctgccctcagccttcaacttgacgtactcctcacgggtgaacttggtgaag 576

                                                                       
Query: 319 ccccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacga 378
           |||||||||||||| |   |||||||||| || ||||||||||||||||||||||| || 
Sbjct: 575 ccccacttcctgctgtgggtgatcttttgccggccagggaacttgaacttggcacggcgg 516

                                                                       
Query: 379 agagcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctgg 438
           || |||||    |||||  | |||||| |   |||||| || |||||||| || ||||| 
Sbjct: 515 agtgcctcttcagcatgtttagcattgctctccttgcaacgaacagaaagaagaacctga 456

                                                                       
Query: 439 ccaatggcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtc 498
           |||||| | || || ||||||   ||||| |||||||| |||||||||||||| ||||| 
Sbjct: 455 ccaatgtccacgcgagcacaggtaccctgaggcttcccaaaagcacccctcattccagtt 396

                                            
Query: 499 tggagcctatcagccccagcacacgaaagcatc 531
           |||||||||||||||||||||||||| ||||||
Sbjct: 395 tggagcctatcagccccagcacacgagagcatc 363

---

>gb|BT012759.1| Lycopersicon esculentum clone 113703R, mRNA sequence
          Length = 847

 Score =  145 bits (73), Expect = 2e-31
 Identities = 181/217 (83%)
 Strand = Plus / Minus

                                                                       
Query: 305 tgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttga 364
           ||||||| ||||| |||||||| |||||  |||| |||||||| || ||||| ||||| |
Sbjct: 565 tgaacttagtgaacccccactttctgctgacaataatcttttgtcggccaggaaacttaa 506

                                                                       
Query: 365 acttggcacgacgaagagcctcagttgcatggatggcattgttgggcttgcaccgcacag 424
           |||| ||||| |||||||||||    |||||| | ||||||      |||||||| || |
Sbjct: 505 acttagcacggcgaagagcctcttgagcatggttagcattgccatctttgcaccgaaccg 446

                                                                       
Query: 425 aaaggaggacctggccaatggcaacacgggcacagactccctgcggcttcccgaaagcac 484
           | || || ||||| ||||| ||||||||||||||||||||||| ||||| |||||||| |
Sbjct: 445 agagaagaacctgaccaatagcaacacgggcacagactccctgtggcttaccgaaagctc 386

                                                
Query: 485 ccctcataccagtctggagcctatcagccccagcaca 521
           | ||||||||||| |||||||||||||||||||||||
Sbjct: 385 ctctcataccagtttggagcctatcagccccagcaca 349

---

>gb|DQ056435.1| Lycopersicon esculentum 60S ribosomal protein L10 (ACI29) mRNA,
           complete cds
          Length = 890

 Score =  145 bits (73), Expect = 2e-31
 Identities = 181/217 (83%)
 Strand = Plus / Minus

                                                                       
Query: 305 tgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttga 364
           ||||||| ||||| |||||||| |||||  |||| |||||||| || ||||| ||||| |
Sbjct: 555 tgaacttagtgaacccccactttctgctgacaataatcttttgtcggccaggaaacttaa 496

                                                                       
Query: 365 acttggcacgacgaagagcctcagttgcatggatggcattgttgggcttgcaccgcacag 424
           |||| ||||| |||||||||||    |||||| | ||||||      |||||||| || |
Sbjct: 495 acttagcacggcgaagagcctcttgagcatggttagcattgccatctttgcaccgaaccg 436

                                                                       
Query: 425 aaaggaggacctggccaatggcaacacgggcacagactccctgcggcttcccgaaagcac 484
           | || || ||||| ||||| ||||||||||||||||||||||| ||||| |||||||| |
Sbjct: 435 agagaagaacctgaccaatagcaacacgggcacagactccctgtggcttaccgaaagctc 376

                                                
Query: 485 ccctcataccagtctggagcctatcagccccagcaca 521
           | ||||||||||| |||||||||||||||||||||||
Sbjct: 375 ctctcataccagtttggagcctatcagccccagcaca 339

---

>gb|AC147460.1| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNAb0050G15, complete sequence
          Length = 126156

 Score =  133 bits (67), Expect = 6e-28
 Identities = 175/211 (82%)
 Strand = Plus / Minus

                                                                         
Query: 321   ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaag 380
             |||||||||||| |  ||||||||||| || ||||||||||||||||||||||| || ||
Sbjct: 94758 ccacttcctgctgtggatgatcttttgccggccagggaacttgaacttggcacggcggag 94699

                                                                         
Query: 381   agcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctggcc 440
              |||||    |||||  | |||||| |   |||||| || |||||||| || ||||| ||
Sbjct: 94698 tgcctcttcagcatgtttagcattgctctccttgcaacgaacagaaagaagaacctgacc 94639

                                                                         
Query: 441   aatggcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtctg 500
             |||| | || || ||||||   ||||| |||||||| |||||||||||||| ||||| ||
Sbjct: 94638 aatgtccacgcgagcacaggtaccctgaggcttcccaaaagcacccctcattccagtttg 94579

                                            
Query: 501   gagcctatcagccccagcacacgaaagcatc 531
             |||||||||||||||||||||||| ||||||
Sbjct: 94578 gagcctatcagccccagcacacgagagcatc 94548

---

>gb|AC123524.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0052C03, complete sequence
          Length = 157178

 Score =  133 bits (67), Expect = 6e-28
 Identities = 175/211 (82%)
 Strand = Plus / Minus

                                                                         
Query: 321   ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaag 380
             |||||||||||| |  ||||||||||| || ||||||||||||||||||||||| || ||
Sbjct: 28602 ccacttcctgctgtggatgatcttttgccggccagggaacttgaacttggcacggcggag 28543

                                                                         
Query: 381   agcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctggcc 440
              |||||    |||||  | |||||| |   |||||| || |||||||| || ||||| ||
Sbjct: 28542 tgcctcttcagcatgtttagcattgctctccttgcaacgaacagaaagaagaacctgacc 28483

                                                                         
Query: 441   aatggcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtctg 500
             |||| | || || ||||||   ||||| |||||||| |||||||||||||| ||||| ||
Sbjct: 28482 aatgtccacgcgagcacaggtaccctgaggcttcccaaaagcacccctcattccagtttg 28423

                                            
Query: 501   gagcctatcagccccagcacacgaaagcatc 531
             |||||||||||||||||||||||| ||||||
Sbjct: 28422 gagcctatcagccccagcacacgagagcatc 28392

---

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  133 bits (67), Expect = 6e-28
 Identities = 175/211 (82%)
 Strand = Plus / Minus

                                                                           
Query: 321     ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaag 380
               |||||||||||| |  ||||||||||| || ||||||||||||||||||||||| || ||
Sbjct: 6245324 ccacttcctgctgtggatgatcttttgccggccagggaacttgaacttggcacggcggag 6245265

                                                                           
Query: 381     agcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctggcc 440
                |||||    |||||  | |||||| |   |||||| || |||||||| || ||||| ||
Sbjct: 6245264 tgcctcttcagcatgtttagcattgctctccttgcaacgaacagaaagaagaacctgacc 6245205

                                                                           
Query: 441     aatggcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtctg 500
               |||| | || || ||||||   ||||| |||||||| |||||||||||||| ||||| ||
Sbjct: 6245204 aatgtccacgcgagcacaggtaccctgaggcttcccaaaagcacccctcattccagtttg 6245145

                                              
Query: 501     gagcctatcagccccagcacacgaaagcatc 531
               |||||||||||||||||||||||| ||||||
Sbjct: 6245144 gagcctatcagccccagcacacgagagcatc 6245114

---

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  133 bits (67), Expect = 6e-28
 Identities = 175/211 (82%)
 Strand = Plus / Minus

                                                                           
Query: 321     ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaag 380
               |||||||||||| |  ||||||||||| || ||||||||||||||||||||||| || ||
Sbjct: 6311791 ccacttcctgctgtggatgatcttttgccggccagggaacttgaacttggcacggcggag 6311732

                                                                           
Query: 381     agcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctggcc 440
                |||||    |||||  | |||||| |   |||||| || |||||||| || ||||| ||
Sbjct: 6311731 tgcctcttcagcatgtttagcattgctctccttgcaacgaacagaaagaagaacctgacc 6311672

                                                                           
Query: 441     aatggcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtctg 500
               |||| | || || ||||||   ||||| |||||||| |||||||||||||| ||||| ||
Sbjct: 6311671 aatgtccacgcgagcacaggtaccctgaggcttcccaaaagcacccctcattccagtttg 6311612

                                              
Query: 501     gagcctatcagccccagcacacgaaagcatc 531
               |||||||||||||||||||||||| ||||||
Sbjct: 6311611 gagcctatcagccccagcacacgagagcatc 6311581

---

>emb|Z14083.1|NTTRP N.tabacum mRNA for protein homologue to human Wilm's tumor-related
           protein HUMQM (partial)
          Length = 615

 Score =  123 bits (62), Expect = 6e-25
 Identities = 98/110 (89%)
 Strand = Plus / Minus

                                                                       
Query: 412 ttgcaccgcacagaaaggaggacctggccaatggcaacacgggcacagactccctgcggc 471
           ||||| || ||||| || || ||||| ||||| ||||||||||||||||||||||| |||
Sbjct: 211 ttgcagcgaacagatagaagaacctgaccaatagcaacacgggcacagactccctgtggc 152

                                                             
Query: 472 ttcccgaaagcacccctcataccagtctggagcctatcagccccagcaca 521
           || || ||||| |||||||||||||| |||||||||||||||||||||||
Sbjct: 151 ttaccaaaagctcccctcataccagtttggagcctatcagccccagcaca 102



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 72/82 (87%)
 Strand = Plus / Minus

                                                                       
Query: 305 tgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttga 364
           ||||||| ||||| ||||||||||||||  ||||||||||||| || | |||||||||||
Sbjct: 318 tgaacttagtgaacccccacttcctgctgacaatgatcttttgacggcgagggaacttga 259

                                 
Query: 365 acttggcacgacgaagagcctc 386
           |||| ||||| || ||||||||
Sbjct: 258 actttgcacggcgcagagcctc 237

---

>gb|DQ228354.1| Solanum tuberosum clone 150H09 60S ribosomal protein L10-like
           protein mRNA, complete cds
          Length = 841

 Score =  121 bits (61), Expect = 2e-24
 Identities = 82/89 (92%)
 Strand = Plus / Minus

                                                                       
Query: 433 acctggccaatggcaacacgggcacagactccctgcggcttcccgaaagcacccctcata 492
           ||||| ||||| ||||||||||||||||||||||||||||| || ||||| || ||||||
Sbjct: 417 acctgaccaatagcaacacgggcacagactccctgcggcttaccaaaagctcctctcata 358

                                        
Query: 493 ccagtctggagcctatcagccccagcaca 521
           ||||| |||||||||||||||||||||||
Sbjct: 357 ccagtttggagcctatcagccccagcaca 329



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 72/82 (87%)
 Strand = Plus / Minus

                                                                       
Query: 305 tgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttga 364
           ||||||| ||||| |||||||| |||||  ||||||||||||| || ||||||||||| |
Sbjct: 545 tgaacttagtgaacccccactttctgctgacaatgatcttttgtcggccagggaacttaa 486

                                 
Query: 365 acttggcacgacgaagagcctc 386
           |||| ||||| |||||||||||
Sbjct: 485 acttagcacggcgaagagcctc 464

---

>gb|AY641430.1| Caragana jubata QM family protein (QM) mRNA, complete cds
          Length = 977

 Score =  109 bits (55), Expect = 9e-21
 Identities = 76/83 (91%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           |||||| |||||||||| ||||||||||||||  ||||||||||||| ||||||||||||
Sbjct: 542 cggttgtacttggtgaatccccacttcctgctgacaatgatcttttgacgaccagggaac 483

                                  
Query: 361 ttgaacttggcacgacgaagagc 383
           |||||||| |||||||| |||||
Sbjct: 482 ttgaactttgcacgacgcagagc 460



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 412 ttgcaccgcacagaaaggaggacctggccaatggcaacacgggcacagactccctgcggc 471
           ||||| || ||||| ||||||||||| |||||||| ||||| |||||   ||| || |||
Sbjct: 431 ttgcagcggacagacaggaggacctgaccaatggccacacgtgcacatgttccttgaggc 372

                                                                       
Query: 472 ttcccgaaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           || || ||||| || | |||||||||||||||||||||||| || ||||| |||||||||
Sbjct: 371 ttaccaaaagctcctcgcataccagtctggagcctatcagctccggcacaggaaagcatc 312

---

>gb|AY641733.1| Camellia sinensis QM-like protein mRNA, complete cds
          Length = 969

 Score =  109 bits (55), Expect = 9e-21
 Identities = 76/83 (91%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           |||||| |||||||||| ||||||||||||||  ||||||||||||| ||||||||||||
Sbjct: 533 cggttgtacttggtgaatccccacttcctgctgacaatgatcttttgacgaccagggaac 474

                                  
Query: 361 ttgaacttggcacgacgaagagc 383
           |||||||| |||||||| |||||
Sbjct: 473 ttgaactttgcacgacgcagagc 451



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 100/119 (84%)
 Strand = Plus / Minus

                                                                       
Query: 412 ttgcaccgcacagaaaggaggacctggccaatggcaacacgggcacagactccctgcggc 471
           ||||| || ||||| ||||||||||| |||||||| ||||| |||||   ||| || |||
Sbjct: 422 ttgcagcggacagacaggaggacctgaccaatggccacacgtgcacatgttccttgaggc 363

                                                                      
Query: 472 ttcccgaaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcat 530
           || || ||||| || | |||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 362 ttaccaaaagctcctcgcataccagtctggagcctatcagctccggcacaggaaagcat 304

---

>ref|NM_102455.1| Arabidopsis thaliana structural constituent of ribosome AT1G26910
           mRNA, complete cds
          Length = 872

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           ||||| ||||||||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 592 cggttaaacttggtgaacccccatttcctgctaacaatgatcttttgacgaccagggaac 533

                                     
Query: 361 ttgaacttggcacgacgaagagcctc 386
           || ||||| |||||||||||||||||
Sbjct: 532 ttaaacttagcacgacgaagagcctc 507



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           |||||||| |||||||||||||| || |||||||| |||||||| |||||||||
Sbjct: 415 aaagcacctctcataccagtctgaagtctatcagctccagcacaagaaagcatc 362

---

>gb|BT024605.1| Arabidopsis thaliana At1g26910 mRNA, complete cds
          Length = 666

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           ||||| ||||||||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 533 cggttaaacttggtgaacccccatttcctgctaacaatgatcttttgacgaccagggaac 474

                                     
Query: 361 ttgaacttggcacgacgaagagcctc 386
           || ||||| |||||||||||||||||
Sbjct: 473 ttaaacttagcacgacgaagagcctc 448



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           |||||||| |||||||||||||| || |||||||| |||||||| |||||||||
Sbjct: 356 aaagcacctctcataccagtctgaagtctatcagctccagcacaagaaagcatc 303

---

>gb|AY087264.1| Arabidopsis thaliana clone 33391 mRNA, complete sequence
          Length = 872

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           ||||| ||||||||||| ||||| ||||||||  ||||||||||||| ||||| ||||||
Sbjct: 592 cggttaaacttggtgaacccccatttcctgctaacaatgatcttttgacgacccgggaac 533

                                     
Query: 361 ttgaacttggcacgacgaagagcctc 386
           || ||||| |||||||||||||||||
Sbjct: 532 ttaaacttagcacgacgaagagcctc 507



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           |||||||| |||||||||||||| || |||||||| |||||||| |||||||||
Sbjct: 415 aaagcacctctcataccagtctgaagtctatcagctccagcacaagaaagcatc 362

---

>ref|NM_101298.2| Arabidopsis thaliana structural constituent of ribosome AT1G14320
           mRNA, complete cds
          Length = 972

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 583 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 524

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 523 ttagcacgacgaagagcctc 504



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 51/54 (94%)
 Strand = Plus / Minus

                                                                 
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           |||||||| |||||||||||||| ||||||||||| ||||||||||||||||||
Sbjct: 412 aaagcacctctcataccagtctgaagcctatcagctccagcacacgaaagcatc 359

---

>gb|BT000679.1| Arabidopsis thaliana clone RAFL07-10-D02 (R10643) putative tumor
           suppressor (At1g14320) mRNA, complete cds
          Length = 920

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 571 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 512

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 511 ttagcacgacgaagagcctc 492



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 51/54 (94%)
 Strand = Plus / Minus

                                                                 
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           |||||||| |||||||||||||| ||||||||||| ||||||||||||||||||
Sbjct: 400 aaagcacctctcataccagtctgaagcctatcagctccagcacacgaaagcatc 347

---

>gb|AY113989.1| Arabidopsis thaliana putative tumor suppressor protein (At1g14320)
           mRNA, complete cds
          Length = 694

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 527 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 468

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 467 ttagcacgacgaagagcctc 448



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 51/54 (94%)
 Strand = Plus / Minus

                                                                 
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           |||||||| |||||||||||||| ||||||||||| ||||||||||||||||||
Sbjct: 356 aaagcacctctcataccagtctgaagcctatcagctccagcacacgaaagcatc 303

---

>gb|AY045866.1| Arabidopsis thaliana putative tumor suppressor protein (At1g14320)
           mRNA, complete cds
          Length = 966

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 574 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 515

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 514 ttagcacgacgaagagcctc 495



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 51/54 (94%)
 Strand = Plus / Minus

                                                                 
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           |||||||| |||||||||||||| ||||||||||| ||||||||||||||||||
Sbjct: 403 aaagcacctctcataccagtctgaagcctatcagctccagcacacgaaagcatc 350

---

>gb|AF428470.1|AF428470 Arabidopsis thaliana At1g14320/F14L17_28 mRNA, complete cds
          Length = 923

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 574 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 515

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 514 ttagcacgacgaagagcctc 495



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 51/54 (94%)
 Strand = Plus / Minus

                                                                 
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           |||||||| |||||||||||||| ||||||||||| ||||||||||||||||||
Sbjct: 403 aaagcacctctcataccagtctgaagcctatcagctccagcacacgaaagcatc 350

---

>gb|AF428286.1|AF428286 Arabidopsis thaliana At1g14320/F14L17_28 mRNA, complete cds
          Length = 882

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 574 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 515

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 514 ttagcacgacgaagagcctc 495



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 51/54 (94%)
 Strand = Plus / Minus

                                                                 
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           |||||||| |||||||||||||| ||||||||||| ||||||||||||||||||
Sbjct: 403 aaagcacctctcataccagtctgaagcctatcagctccagcacacgaaagcatc 350

---

>gb|AY050482.1| Arabidopsis thaliana At1g14320/F14L17_28 mRNA, complete cds
          Length = 360

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 224 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 165

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 164 ttagcacgacgaagagcctc 145



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcat 530
           |||||||| |||||||||||||| ||||||||||| |||||||||||||||||
Sbjct: 53  aaagcacctctcataccagtctgaagcctatcagctccagcacacgaaagcat 1

---

>gb|AF378902.1|AF378902 Arabidopsis thaliana At1g14320/F14L17_28 mRNA, complete cds
          Length = 542

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 233 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 174

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 173 ttagcacgacgaagagcctc 154



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 51/54 (94%)
 Strand = Plus / Minus

                                                                 
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           |||||||| |||||||||||||| ||||||||||| ||||||||||||||||||
Sbjct: 62  aaagcacctctcataccagtctgaagcctatcagctccagcacacgaaagcatc 9

---

>emb|BX816389.1|CNS0AE93 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH45ZB11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 465

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 157 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 98

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 97  ttagcacgacgaagagcctc 78

---

>emb|BX816136.1|CNS0AE2V Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH2ZH02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 869

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 561 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 502

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 501 ttagcacgacgaagagcctc 482



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           |||||||| |||||||||||||  ||||||||||| |||| |||||||||||||
Sbjct: 390 aaagcacctctcataccagtcttaagcctatcagctccagaacacgaaagcatc 337

---

>emb|Z15157.1|ATWILMTSH A.thaliana mRNA for Wilm's tumor suppressor homologue
          Length = 880

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 554 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 495

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 494 ttagcacgacgaagagcctc 475



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 51/54 (94%)
 Strand = Plus / Minus

                                                                 
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           |||||||| |||||||||||||| ||||||||||| ||||||||||||||||||
Sbjct: 383 aaagcacctctcataccagtctgaagcctatcagctccagcacacgaaagcatc 330

---

>gb|AF180758.1|AF180758 Vitis riparia 60S ribosomal protein L10 (QM) mRNA, complete cds
          Length = 980

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 75/84 (89%)
 Strand = Plus / Minus

                                                                       
Query: 303 gttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaactt 362
           ||||||||| ||||||||||||||||||||  ||||||||||||| ||  ||||||||||
Sbjct: 564 gttgaactttgtgaaaccccacttcctgctgacaatgatcttttgacgggcagggaactt 505

                                   
Query: 363 gaacttggcacgacgaagagcctc 386
           ||| || |||||||| ||||||||
Sbjct: 504 gaattttgcacgacggagagcctc 481



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                       
Query: 469 ggcttcccgaaagcacccctcataccagtctggagcctatcagccccagcacacgaaagc 528
           ||||| || |||||||||||||| ||||| || |||||||| || |||||||| ||||||
Sbjct: 398 ggcttaccaaaagcacccctcattccagtttgaagcctatcggctccagcacaggaaagc 339

              
Query: 529 atc 531
           |||
Sbjct: 338 atc 336



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 223 ccatggcatccgagcagcttagcattgactccatcagg 260
           |||||||||||||| ||||| |||||||| ||||||||
Sbjct: 644 ccatggcatccgagaagcttggcattgacaccatcagg 607

---

>gb|AC140545.26| Medicago truncatula clone mth2-11g18, complete sequence
          Length = 129414

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 160/196 (81%), Gaps = 2/196 (1%)
 Strand = Plus / Plus

                                                                          
Query: 337    atgatcttttggcgaccagggaacttgaacttggcacgacgaagagcctcagttgcatgg 396
              ||||||||||| || ||||||||||| ||||| |||||||| || |||||    ||||||
Sbjct: 106479 atgatcttttgacggccagggaacttaaacttagcacgacggagggcctcctgagcatgg 106538

                                                                          
Query: 397    atggca-ttgttgggcttgcaccgcacagaaaggaggacctggccaatggcaacacgggc 455
               ||||  ||||||   ||||| || |||||||| || ||||| ||||| || || |  ||
Sbjct: 106539 -tggctgttgttgtctttgcaacggacagaaagaagcacctgcccaatagccactctagc 106597

                                                                          
Query: 456    acagactccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagcccc 515
              ||| || ||||| ||||| || |||||||||||||||||||| || || |||||||| ||
Sbjct: 106598 acaaacaccctggggctttccaaaagcacccctcataccagtttgaagtctatcagcacc 106657

                              
Query: 516    agcacacgaaagcatc 531
              |||||| |||||||||
Sbjct: 106658 agcacatgaaagcatc 106673

---

>gb|AC012188.2|F14L17 Sequence of BAC F14L17 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 111686

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                         
Query: 325   ttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaagagcc 384
             ||||||||  |||| |||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 20126 ttcctgctgacaataatcttttgacgaccagggaacttgaacttagcacgacgaagagcc 20067

               
Query: 385   tc 386
             ||
Sbjct: 20066 tc 20065



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 51/54 (94%)
 Strand = Plus / Minus

                                                                   
Query: 478   aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
             |||||||| |||||||||||||| ||||||||||| ||||||||||||||||||
Sbjct: 19973 aaagcacctctcataccagtctgaagcctatcagctccagcacacgaaagcatc 19920

---

>gb|AC005508.1|AC005508 Arabidopsis thaliana chromosome I BAC T2P11 genomic sequence, complete
             sequence
          Length = 85372

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                         
Query: 325   ttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaagagcc 384
             ||||||||  ||||||||||||| |||||||||||||| ||||| |||||||||||||||
Sbjct: 30483 ttcctgctaacaatgatcttttgacgaccagggaacttaaacttagcacgacgaagagcc 30424

               
Query: 385   tc 386
             ||
Sbjct: 30423 tc 30422



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                   
Query: 478   aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
             |||||||| |||||||||||||| || |||||||| |||||||| |||||||||
Sbjct: 30330 aaagcacctctcataccagtctgaagtctatcagctccagcacaagaaagcatc 30277

---

>ref|NM_105329.1| Arabidopsis thaliana structural constituent of ribosome AT1G66580
           mRNA, complete cds
          Length = 882

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           |||||||| || ||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 576 cggttgaatttagtgaatccccatttcctgctaacaatgatcttttgacgaccagggaac 517

                                  
Query: 361 ttgaacttggcacgacgaagagc 383
           || ||||| || | |||||||||
Sbjct: 516 ttaaacttagctctacgaagagc 494



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                 
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           |||||||| ||||| |||||||| ||||||||||| ||||||||||||||||||
Sbjct: 399 aaagcacctctcattccagtctgaagcctatcagctccagcacacgaaagcatc 346

---

>gb|AY055103.1| Arabidopsis thaliana At1g66580/T12I7_3 mRNA, complete cds
          Length = 666

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           |||||||| || ||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 533 cggttgaatttagtgaatccccatttcctgctaacaatgatcttttgacgaccagggaac 474

                                  
Query: 361 ttgaacttggcacgacgaagagc 383
           || ||||| || | |||||||||
Sbjct: 473 ttaaacttagctctacgaagagc 451



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                 
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           |||||||| ||||| |||||||| ||||||||||| ||||||||||||||||||
Sbjct: 356 aaagcacctctcattccagtctgaagcctatcagctccagcacacgaaagcatc 303

---

>gb|AF367276.1|AF367276 Arabidopsis thaliana At1g66580/T12I7_3 mRNA, complete cds
          Length = 835

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           |||||||| || ||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 576 cggttgaatttagtgaatccccatttcctgctaacaatgatcttttgacgaccagggaac 517

                                  
Query: 361 ttgaacttggcacgacgaagagc 383
           || ||||| || | |||||||||
Sbjct: 516 ttaaacttagctctacgaagagc 494



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                 
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           |||||||| ||||| |||||||| ||||||||||| ||||||||||||||||||
Sbjct: 399 aaagcacctctcattccagtctgaagcctatcagctccagcacacgaaagcatc 346

---

>emb|BX816025.1|CNS0ABON Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH23ZE11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 839

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           |||||||| || ||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 557 cggttgaatttagtgaatccccatttcctgctaacaatgatcttttgacgaccagggaac 498

                                  
Query: 361 ttgaacttggcacgacgaagagc 383
           || ||||| || | |||||||||
Sbjct: 497 ttaaacttagctctacgaagagc 475



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                 
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           |||||||| ||||| |||||||| ||||||||||| ||||||||||||||||||
Sbjct: 380 aaagcacctctcattccagtctgaagcctatcagctccagcacacgaaagcatc 327

---

>emb|BX815625.1|CNS0ABEZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS78ZG01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 854

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           |||||||| || ||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 549 cggttgaatttagtgaatccccatttcctgctaacaatgatcttttgacgaccagggaac 490

                                  
Query: 361 ttgaacttggcacgacgaagagc 383
           || ||||| || | |||||||||
Sbjct: 489 ttaaacttagctctacgaagagc 467



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                 
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           |||||||| ||||| |||||||| ||||||||||| ||||||||||||||||||
Sbjct: 372 aaagcacctctcattccagtctgaagcctatcagctccagcacacgaaagcatc 319

---

>gb|AF295636.1|AF295636 Elaeis guineensis QM-like protein mRNA, complete cds
          Length = 974

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 469 ggcttcccgaaagcacccctcataccagtctggagcctatcagccccagcacacgaaagc 528
           |||||||| || ||||||||||| |||||||| ||||||||||| |||||||| ||||||
Sbjct: 398 ggcttcccaaaggcacccctcattccagtctgaagcctatcagctccagcacatgaaagc 339

              
Query: 529 atc 531
           |||
Sbjct: 338 atc 336



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 337 atgatcttttggcgaccagggaacttgaacttggcacgacgaagagc 383
           ||||||||||| || ||||||||||||||||||||||| || |||||
Sbjct: 530 atgatcttttgacggccagggaacttgaacttggcacggcgcagagc 484

---

>gb|AY087426.1| Arabidopsis thaliana clone 35307 mRNA, complete sequence
          Length = 882

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           |||||||| || ||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 576 cggttgaatttagtgaatccccatttcctgctaacaatgatcttttgacgaccagggaac 517

                                  
Query: 361 ttgaacttggcacgacgaagagc 383
           || ||||| || | |||||||||
Sbjct: 516 ttaaacttagctctacgaagagc 494



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                 
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           |||||||| ||||| |||||||| ||||||||||| ||||||||||||||||||
Sbjct: 399 aaagcacctctcattccagtctgaagcctatcagctccagcacacgaaagcatc 346

---

>gb|AC079285.1|AC079285 Arabidopsis thaliana chromosome 1 BAC T12I7 genomic sequence,
            complete sequence
          Length = 35308

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                  
Query: 478  aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
            |||||||| ||||| |||||||| ||||||||||| ||||||||||||||||||
Sbjct: 9327 aaagcacctctcattccagtctgaagcctatcagctccagcacacgaaagcatc 9274



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 325  ttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaagagc 383
            ||||||||  ||||||||||||| |||||||||||||| ||||| || | |||||||||
Sbjct: 9480 ttcctgctaacaatgatcttttgacgaccagggaacttaaacttagctctacgaagagc 9422

---

>gb|AF013804.1| Pinus taeda Wilm's tumor supressor homolog (lp20) mRNA, complete
           cds
          Length = 1055

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 95/114 (83%)
 Strand = Plus / Minus

                                                                       
Query: 418 cgcacagaaaggaggacctggccaatggcaacacgggcacagactccctgcggcttcccg 477
           ||||| ||||||||||| || || ||||||||||| |||||   |||||| || || || 
Sbjct: 639 cgcactgaaaggaggacttgacctatggcaacacgtgcacatgttccctgaggttttcca 580

                                                                 
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           ||||| || ||||| ||||| ||||||||||| |||||||| || |||||||||
Sbjct: 579 aaagctcctctcattccagtttggagcctatcggccccagcgcatgaaagcatc 526



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 352 ccagggaacttgaacttggcacgacg 377
           ||||||||||||||||||||||||||
Sbjct: 705 ccagggaacttgaacttggcacgacg 680

---

>dbj|AB001582.1| Solanum melongena mRNA for QM family protein, partial cds
          Length = 413

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                       
Query: 305 tgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttga 364
           ||||||||||||| |||||||| |||||  ||||||||||||| || ||||| ||||| |
Sbjct: 317 tgaacttggtgaatccccactttctgctgacaatgatcttttgacggccaggaaacttaa 258

                                 
Query: 365 acttggcacgacgaagagcctc 386
           |||| ||||| || ||||||||
Sbjct: 257 acttagcacggcgcagagcctc 236



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 439 ccaatggcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtc 498
           ||||| |||||||| ||||| || ||||| ||||| || ||||| |||||||| ||||| 
Sbjct: 183 ccaattgcaacacgagcacaaacaccctggggcttaccaaaagctcccctcatgccagtt 124

                                     
Query: 499 tggagcctatcagccccagcacacga 524
           ||||| |||||||| |||||||||||
Sbjct: 123 tggagtctatcagctccagcacacga 98

---

>dbj|AB001891.1| Solanum melongena mRNA for QM family protein, complete cds
          Length = 820

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                       
Query: 305 tgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttga 364
           ||||||||||||| |||||||| |||||  ||||||||||||| || ||||| ||||| |
Sbjct: 565 tgaacttggtgaatccccactttctgctgacaatgatcttttgacggccaggaaacttaa 506

                                 
Query: 365 acttggcacgacgaagagcctc 386
           |||| ||||| || ||||||||
Sbjct: 505 acttagcacggcgcagagcctc 484



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 439 ccaatggcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtc 498
           ||||| |||||||| ||||| || ||||| ||||| || ||||| |||||||| ||||| 
Sbjct: 431 ccaattgcaacacgagcacaaacaccctggggcttaccaaaagctcccctcatgccagtt 372

                                     
Query: 499 tggagcctatcagccccagcacacga 524
           ||||| |||||||| |||||||||||
Sbjct: 371 tggagtctatcagctccagcacacga 346

---

>gb|AY829778.1| Lonomia obliqua ribosomal protein L10 mRNA, complete cds
          Length = 396

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                            
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctca 387
           |||||| || ||||||||||||||||||||||||||||| |||||||||
Sbjct: 231 gatcttctgacgaccagggaacttgaacttggcacgacgcagagcctca 183



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 493 ccagtctggagcctatcagccccagcacacga 524
           ||||||||||||||||| || ||||| |||||
Sbjct: 77  ccagtctggagcctatcggctccagcgcacga 46

---

>gb|AF368032.1|AF368032 Heliothis virescens QM protein mRNA, complete cds
          Length = 711

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                        
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagc 383
           |||||| |||||||||||||||||||||||||||||||| |||||
Sbjct: 495 gatcttctggcgaccagggaacttgaacttggcacgacgcagagc 451



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacga 524
           |||||||| | ||| |||||||||||||||||||| ||||| |||||
Sbjct: 356 aaagcaccacgcattccagtctggagcctatcagctccagcgcacga 310

---

>gb|DQ440008.1| Aedes aegypti clone AE-200A ribosomal protein L10 mRNA, complete
           cds
          Length = 660

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 495 gatcttctggcgaccggggaacttgaacttggcacgacgcagagcctc 448

---

>ref|XM_660558.1| Cryptosporidium hominis TU502 ribosomal protein L10 (Chro.60480)
           partial mRNA
          Length = 669

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                               
Query: 479 aagcacccctcataccagtctggagcctatcagccccagcacacgaaagcat 530
           ||||||| ||||||||||||||||||||||| || |||||||| ||||||||
Sbjct: 355 aagcacctctcataccagtctggagcctatcggcaccagcacatgaaagcat 304

---

>emb|BX538352.1| Cryptosporidium parvum chromosome 6, complete sequence; segment 3/4
          Length = 293050

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                                  
Query: 479    aagcacccctcataccagtctggagcctatcagccccagcacacgaaagcat 530
              ||||||| ||||||||||||||||||||||| || |||||||| ||||||||
Sbjct: 240148 aagcacctctcataccagtctggagcctatcggcaccagcacatgaaagcat 240097

---

>emb|CR938586.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YF21AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 768

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 561 gatcttctggcgaccggggaacttgaacttggcacgacgcagagcctc 514

---

>emb|CR938540.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YI18AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 700

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 565 gatcttctggcgaccggggaacttgaacttggcacgacgcagagcctc 518

---

>emb|CR938096.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YK16AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 944

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 568 gatcttctggcgaccggggaacttgaacttggcacgacgcagagcctc 521

---

>emb|CR938095.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 3-prime end of clone
           KW0AAA2YK16BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 813

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 361 gatcttctggcgaccggggaacttgaacttggcacgacgcagagcctc 408

---

>emb|CR937970.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YO19AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 932

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 561 gatcttctggcgaccggggaacttgaacttggcacgacgcagagcctc 514

---

>emb|CR937222.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 5-prime end of clone
           KW0AAB2YJ23AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 812

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 567 gatcttctggcgaccggggaacttgaacttggcacgacgcagagcctc 520

---

>ref|XM_627752.1| Cryptosporidium parvum Iowa II 60S ribosomal protein L10
           (cgd6_4190), partial mRNA
          Length = 669

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                               
Query: 479 aagcacccctcataccagtctggagcctatcagccccagcacacgaaagcat 530
           ||||||| ||||||||||||||||||||||| || |||||||| ||||||||
Sbjct: 355 aagcacctctcataccagtctggagcctatcggcaccagcacatgaaagcat 304

---

>gb|AY763500.1| Danio rerio QM protein (QM) mRNA, complete cds
          Length = 769

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagcaca 521
           ||||| ||||||||||| ||||| | |||||||||||||||||||||||| || |||||
Sbjct: 396 ccctgaggcttcccgaacgcaccacgcataccagtctggagcctatcagctccggcaca 338



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 339 gatcttttggcgaccagggaacttgaacttggc 371
           |||||| || || ||||||||||||||||||||
Sbjct: 520 gatcttctgacggccagggaacttgaacttggc 488

---

>ref|XM_739285.1| Plasmodium chabaudi chabaudi ribosomal protein L10 (PC000390.00.0)
           partial mRNA
          Length = 657

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 481 gcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           ||||| |||||||||||||| ||||||||||| |||||||| |||||||||
Sbjct: 350 gcacctctcataccagtctgaagcctatcagctccagcacatgaaagcatc 300

---

>ref|XM_686253.1| PREDICTED: Danio rerio similar to Ribosomal protein L10
           (LOC573236), mRNA
          Length = 687

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagcaca 521
           ||||| ||||||||||| ||||| | |||||||||||||||||||||||| || |||||
Sbjct: 491 ccctgaggcttcccgaacgcaccacgcataccagtctggagcctatcagctccggcaca 433



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 339 gatcttttggcgaccagggaacttgaacttggc 371
           |||||| || || ||||||||||||||||||||
Sbjct: 615 gatcttctgacggccagggaacttgaacttggc 583

---

>gb|AY762997.1| Ctenopharyngodon idella QM (QM) mRNA, complete cds
          Length = 759

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagcaca 521
           ||||| ||||| ||||||||||| | |||||||||||||||||||||||| || |||||
Sbjct: 393 ccctgaggcttaccgaaagcaccacgcataccagtctggagcctatcagctccggcaca 335

---

>gb|BC045950.1| Danio rerio ribosomal protein L10, mRNA (cDNA clone MGC:56154
           IMAGE:5412436), complete cds
          Length = 768

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagcaca 521
           ||||| ||||||||||| ||||| | |||||||||||||||||||||||| || |||||
Sbjct: 394 ccctgaggcttcccgaacgcaccacgcataccagtctggagcctatcagctccggcaca 336



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 339 gatcttttggcgaccagggaacttgaacttggc 371
           |||||| || || ||||||||||||||||||||
Sbjct: 518 gatcttctgacggccagggaacttgaacttggc 486

---

>ref|NM_200027.1| Danio rerio ribosomal protein L10 (rpl10), mRNA
          Length = 768

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagcaca 521
           ||||| ||||||||||| ||||| | |||||||||||||||||||||||| || |||||
Sbjct: 394 ccctgaggcttcccgaacgcaccacgcataccagtctggagcctatcagctccggcaca 336



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 339 gatcttttggcgaccagggaacttgaacttggc 371
           |||||| || || ||||||||||||||||||||
Sbjct: 518 gatcttctgacggccagggaacttgaacttggc 486

---

>gb|AF227620.1|AF227620 Euphorbia esula 60S ribosomal protein L10 mRNA, complete cds
          Length = 852

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 83/99 (83%)
 Strand = Plus / Minus

                                                                       
Query: 433 acctggccaatggcaacacgggcacagactccctgcggcttcccgaaagcacccctcata 492
           ||||| ||||| ||||| |  ||||| || ||||| ||||| || |||||||| ||||||
Sbjct: 425 acctgtccaatagcaactctagcacaaacaccctgaggctttccaaaagcacctctcata 366

                                                  
Query: 493 ccagtctggagcctatcagccccagcacacgaaagcatc 531
           ||||| || ||||||||||| || ||||| |||||||||
Sbjct: 365 ccagtttgaagcctatcagctccggcacatgaaagcatc 327



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           |||||||  ||||||||||||||||| |||||  |||| |||||||||||||| || |||
Sbjct: 557 cggttgattttggtgaaaccccactttctgctgacaataatcttttggcgaccgggaaac 498

                         
Query: 361 ttgaacttggcacg 374
           || ||||| |||||
Sbjct: 497 ttaaacttagcacg 484

---

>emb|CR938702.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YA10AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 705

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 341 tcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||| |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 563 tcttctggcgaccggggaacttgaacttggcacgacgcagagcctc 518

---

>gb|AY440350.1| Armigeres subalbatus ASAP ID: 41357 cytosolic large ribosomal
           subunit L10 mRNA sequence
          Length = 927

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| || ||||| ||||||||||||||||||||||| ||||||||
Sbjct: 535 gatcttctgacgaccggggaacttgaacttggcacgacgcagagcctc 488

---

>emb|AM049018.1| Curculio glandium partial mRNA for ribosomal protein L10e (rpL10e
           gene)
          Length = 321

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           ||||||||| || || ||||||||||||||||||||||| ||||||||
Sbjct: 156 gatcttttgacgtccggggaacttgaacttggcacgacggagagcctc 109

---

>emb|BX071681.1|CNS09RH1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 541 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 494

---

>emb|BX066414.1|CNS09NEQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 543 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 496

---

>emb|BX066294.1|CNS09NBE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 534

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 205 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 158

---

>emb|BX062161.1|CNS09K4L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 608

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 518 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 471

---

>emb|BX054818.1|CNS09EGM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 554 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 507

---

>emb|BX054800.1|CNS09EG4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 747

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 240 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 287

---

>emb|BX054799.1|CNS09EG3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 865

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 556 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 509

---

>emb|BX046336.1|CNS097X0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 264 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 311

---

>emb|BX045752.1|CNS097GS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 529 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 482

---

>emb|BX045505.1|CNS0979X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 599 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 552

---

>emb|BX043067.1|CNS095E7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15BF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 263 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 310

---

>emb|BX043066.1|CNS095E6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15BF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1022

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 704 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 657

---

>emb|BX044599.1|CNS096KR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 618

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 550 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 503

---

>emb|BX043398.1|CNS095NE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 740

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 514 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 467

---

>emb|BX038980.1|CNS0928O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 586

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 297 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 344

---

>emb|BX037545.1|CNS0914T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 690

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 299 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 346

---

>emb|BX037544.1|CNS0914S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 747

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 559 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 512

---

>emb|BX031114.1|CNS08W66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1046

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 955 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 908

---

>emb|BX026833.1|CNS08SV9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 661

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 547 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 500

---

>emb|BX025006.1|CNS08RGI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 567

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 251 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 298

---

>emb|BX025005.1|CNS08RGH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 540 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 493

---

>emb|BX024539.1|CNS08R3J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 541 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 494

---

>emb|BX020659.1|CNS08O3R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 542

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 149 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 196

---

>emb|BX019389.1|CNS08N4H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 531 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 484

---

>emb|BX018993.1|CNS08MTH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 536 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 489

---

>emb|BX017940.1|CNS08M08 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 266 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 313

---

>emb|BX017939.1|CNS08M07 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 535 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 488

---

>emb|BX018773.1|CNS08MND Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 226

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 82  gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 129

---

>emb|BX018772.1|CNS08MNC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 553 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 506

---

>emb|BX017778.1|CNS08LVQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 788

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 228 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 275

---

>emb|BX017777.1|CNS08LVP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA26DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 962 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 915

---

>emb|BX016960.1|CNS08L90 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 576 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 529

---

>emb|BX012859.1|CNS08I33 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2BD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 595

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 266 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 313

---

>emb|BX012858.1|CNS08I32 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2BD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 836

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 529 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 482

---

>emb|BX010419.1|CNS08G7B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 538 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 491

---

>emb|BX008095.1|CNS08EER Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 802

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 281 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 328

---

>emb|BX008094.1|CNS08EEQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 692

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 362 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 315

---

>emb|BX005642.1|CNS08CIM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA1AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 429

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 130 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 83

---

>ref|XM_312560.2| Anopheles gambiae str. PEST ENSANGP00000014921
           (ENSANGG00000012432), partial mRNA
          Length = 757

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 598 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 551

---

>gb|AF118822.1|AF118822 Arabidopsis thaliana senescence-associated protein (SAG24) mRNA,
           partial cds
          Length = 169

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           |||| ||| || ||||| ||||| ||| ||||  ||||||||||||| ||||||||||||
Sbjct: 161 cggtngaatttagtgaatccccatttcgtgctaacaatgatcttttgacgaccagggaac 102

                                  
Query: 361 ttgaacttggcacgacgaagagc 383
           || ||||| || | |||||||||
Sbjct: 101 ttaaacttagctctacgaagagc 79

---

>gb|AY822650.1| Callinectes sapidus ribosomal protein L10 mRNA, complete cds
          Length = 779

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                       
Query: 462 tccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagcaca 521
           |||||| ||||| || || ||||||| ||| || || |||||||||||||||||||||||
Sbjct: 404 tccctggggcttgccaaacgcaccccgcatccccgtttggagcctatcagccccagcaca 345

              
Query: 522 cga 524
           |||
Sbjct: 344 cga 342

---

>ref|XM_754376.1| Ustilago maydis 521 hypothetical protein (UM03322.1) partial mRNA
          Length = 801

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                       
Query: 469 ggcttcccgaaagcacccctcataccagtctggagcctatcagccccagcacacgaaagc 528
           ||||| ||| ||||||| | |||||| |||||||||||||| || ||||| |||||||||
Sbjct: 503 ggcttgccgtaagcaccacgcataccggtctggagcctatcggcaccagcgcacgaaagc 444

              
Query: 529 atc 531
           |||
Sbjct: 443 atc 441

---

>ref|XM_723221.1| Plasmodium yoelii yoelii str. 17XNL ribosomal L10 (PY07431) partial
           mRNA
          Length = 660

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 481 gcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
           ||||| ||||||||||| ||||||||||| || |||||||| |||||||||
Sbjct: 353 gcacctctcataccagtttggagcctatcggcaccagcacatgaaagcatc 303

---

>gb|BC058467.1| Rattus norvegicus ribosomal protein L10, mRNA (cDNA clone MGC:72797
           IMAGE:6918973), complete cds
          Length = 788

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagcaca 521
           ||||| |||||||| || ||||| | |||||| ||||||||||| ||||||||||||||
Sbjct: 418 ccctggggcttcccaaaggcaccacgcatacctgtctggagcctgtcagccccagcaca 360



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 339 gatcttttggcgaccagggaacttgaacttggc 371
           |||||| ||||| ||||||||||||||||||||
Sbjct: 542 gatcttctggcggccagggaacttgaacttggc 510

---

>emb|BX026834.1|CNS08SVA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 379

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                  
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacg 377
           |||||| |||||||| |||||||||||||||||||||||
Sbjct: 263 gatcttctggcgacccgggaacttgaacttggcacgacg 301

---

>emb|CR937221.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 3-prime end of clone
           KW0AAB2YJ23BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 527

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 340 atcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           ||||| |||||||| ||||||||||||||||||||||| | ||||||
Sbjct: 364 atcttctggcgaccggggaacttgaacttggcacgacgcaaagcctc 410

---

>ref|XM_212832.3| PREDICTED: Rattus norvegicus ribosomal protein L10 (Rpl10), mRNA
          Length = 761

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagcaca 521
           ||||| |||||||| || ||||| | |||||| ||||||||||| ||||||||||||||
Sbjct: 428 ccctggggcttcccaaaggcaccacgcatacctgtctggagcctgtcagccccagcaca 370



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 339 gatcttttggcgaccagggaacttgaacttggc 371
           |||||| ||||| ||||||||||||||||||||
Sbjct: 552 gatcttctggcggccagggaacttgaacttggc 520

---

>dbj|AB180439.1| Plutella xylostella mRNA for QM protein, complete cds
          Length = 705

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 466 tgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagcacacga 524
           |||||||| ||||| ||||| | ||| |||||||||||||||||||| ||||| |||||
Sbjct: 397 tgcggcttgccgaacgcaccacgcatcccagtctggagcctatcagctccagcgcacga 339



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 355 gggaacttgaacttggcacgacgaagagcctca 387
           ||||||||||||||||||||||| |||||||||
Sbjct: 508 gggaacttgaacttggcacgacgcagagcctca 476

---

>gb|AC113107.15| Mus musculus chromosome 10, clone RP23-325G13, complete sequence
          Length = 207239

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                              
Query: 339   gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctca 387
             |||||| ||||| |||||||||||||||||||| | | |||||||||||
Sbjct: 45628 gatcttctggcggccagggaacttgaacttggctctatgaagagcctca 45580

---

>emb|AM049016.1| Biphyllus lunatus mRNA for ribosomal protein L10e (rpL10e gene)
          Length = 657

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagc 383
           ||||||||| || || ||||||||||| |||||||||||||||||
Sbjct: 495 gatcttttgacgtccggggaacttgaatttggcacgacgaagagc 451



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcacacga 524
           |||||||| | ||| || ||||||||||||||||| |||||||||||
Sbjct: 356 aaagcaccacgcattccggtctggagcctatcagctccagcacacga 310

---

>ref|XM_965782.1| PREDICTED: Tribolium castaneum similar to CG17521-PA, isoform A
           (LOC659478), mRNA
          Length = 738

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 469 ggcttcccgaaagcacccctcataccagtctggagcctatcagccccagcaca 521
           ||||||||||| || || ||||| ||||||||||||||||| || ||||||||
Sbjct: 404 ggcttcccgaaggctcctctcatcccagtctggagcctatcggctccagcaca 352



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 346 tggcgaccagggaacttgaacttggcacgacgaagagcctca 387
           ||||| || |||||||||||||| |||||||| || ||||||
Sbjct: 527 tggcgtccggggaacttgaacttcgcacgacgcagggcctca 486

---

>emb|BX038979.1|CNS0928N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 554

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 346 tggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 553 tggcgacccgggaacttgaacttggcacgacgcagcgcctc 513

---

>gb|AC153942.8| Mus musculus 10 BAC RP24-174M19 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 146201

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                              
Query: 339   gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctca 387
             |||||| ||||| |||||||||||||||||||| | | |||||||||||
Sbjct: 11542 gatcttctggcggccagggaacttgaacttggctctatgaagagcctca 11590

---

>gb|AY769278.1| Bombyx mori ribosomal protein L10 (RpL10) mRNA, complete cds
          Length = 726

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           ||||||||| || || |||||||||||||||||||| || ||||||||
Sbjct: 513 gatcttttgacgtccggggaacttgaacttggcacggcgcagagcctc 466



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || || ||||| | ||| |||||||||||||||||||| |||||
Sbjct: 389 ccctgaggcttgccaaacgcaccacgcatcccagtctggagcctatcagctccagc 334

---

>ref|XM_868582.1| PREDICTED: Bos taurus similar to ribosomal protein L10 (LOC616541),
           mRNA
          Length = 489

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 340 atcttttggcgaccagggaacttgaacttggc 371
           ||||| ||||||||||||||||||||||||||
Sbjct: 338 atcttctggcgaccagggaacttgaacttggc 307

---

>gb|U60651.1| Hydra vulgaris ribosomal protein L10 mRNA, complete cds
          Length = 709

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 340 atcttttggcgaccagggaacttgaacttggc 371
           |||||||| |||||||||||||||||||||||
Sbjct: 511 atcttttgacgaccagggaacttgaacttggc 480



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 478 aaagcacccctcataccagtctggagcctatcagccccagcaca 521
           |||||||| ||||| ||||| ||||||||||||||||| |||||
Sbjct: 373 aaagcacctctcattccagtttggagcctatcagccccggcaca 330

---

>emb|CR734854.2|CNS0GTSL Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 318 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 373



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 207 ccagggaacttgaacttggc 226

---

>emb|CR734175.2|CNS0GT9Q Tetraodon nigroviridis full-length cDNA
          Length = 697

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR720542.2|CNS0GIX0 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR728834.2|CNS0GPBC Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR720275.2|CNS0GIPL Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR722877.2|CNS0GKPV Tetraodon nigroviridis full-length cDNA
          Length = 696

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 383 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 328



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 494 ccagggaacttgaacttggc 475

---

>emb|CR722708.2|CNS0GKL6 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR722363.2|CNS0GKBL Tetraodon nigroviridis full-length cDNA
          Length = 667

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 350 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 295



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 461 ccagggaacttgaacttggc 442

---

>emb|CR720772.2|CNS0GJ3E Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR717491.2|CNS0GGK9 Tetraodon nigroviridis full-length cDNA
          Length = 820

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| |||||||| |||||||| | ||| |||||||||||||  |||||||||||
Sbjct: 503 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccagc 448



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 614 ccagggaacttgaacttggc 595

---

>emb|CR717039.2|CNS0GG7S Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| |||||||| |||||||| | ||| |||||||||||||  |||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR716839.2|CNS0GG28 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| |||||||| |||||||| | ||| |||||||||||||  |||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR716359.2|CNS0GFOW Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| |||||||| |||||||| | ||| |||||||||||||  |||||||||||
Sbjct: 438 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccagc 383



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 549 ccagggaacttgaacttggc 530

---

>emb|CR715715.2|CNS0GF73 Tetraodon nigroviridis full-length cDNA
          Length = 666

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| |||||||| |||||||| | ||| |||||||||||||  |||||||||||
Sbjct: 349 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccagc 294



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 460 ccagggaacttgaacttggc 441

---

>emb|CR714866.2|CNS0GEJI Tetraodon nigroviridis full-length cDNA
          Length = 726

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| |||||||| |||||||| | ||| |||||||||||||  |||||||||||
Sbjct: 409 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccagc 354



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 520 ccagggaacttgaacttggc 501

---

>emb|CR714125.2|CNS0GDYX Tetraodon nigroviridis full-length cDNA
          Length = 818

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| |||||||| |||||||| | ||| |||||||||||||  |||||||||||
Sbjct: 504 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccagc 449



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 615 ccagggaacttgaacttggc 596

---

>emb|CR712979.2|CNS0GD33 Tetraodon nigroviridis full-length cDNA
          Length = 461

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| |||||||| |||||||| | ||| |||||||||||||  |||||||||||
Sbjct: 144 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccagc 89



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 255 ccagggaacttgaacttggc 236

---

>emb|CR713339.2|CNS0GDD3 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| |||||||| |||||||| | ||| |||||||||||||  |||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR713296.2|CNS0GDBW Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| |||||||| |||||||| | ||| |||||||||||||  |||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR712692.2|CNS0GCV4 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| |||||||| |||||||| | ||| |||||||||||||  |||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR711229.2|CNS0GBQH Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| |||||||| |||||||| | ||| |||||||||||||  |||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR710615.2|CNS0GB9F Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| |||||||| |||||||| | ||| |||||||||||||  |||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR708839.2|CNS0G9W3 Tetraodon nigroviridis full-length cDNA
          Length = 726

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| |||||||| |||||||| | ||| |||||||||||||  |||||||||||
Sbjct: 409 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccagc 354



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 520 ccagggaacttgaacttggc 501

---

>emb|CR708432.2|CNS0G9KS Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| |||||||| |||||||| | ||| |||||||||||||  |||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR706206.2|CNS0G7UY Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| |||||||| |||||||| | ||| |||||||||||||  |||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR704971.2|CNS0G6WN Tetraodon nigroviridis full-length cDNA
          Length = 820

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| |||||||| |||||||| | ||| |||||||||||||  |||||||||||
Sbjct: 503 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccagc 448



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 614 ccagggaacttgaacttggc 595

---

>emb|CR704750.2|CNS0G6QI Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| |||||||| |||||||| | ||| |||||||||||||  |||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR704546.2|CNS0G6KU Tetraodon nigroviridis full-length cDNA
          Length = 865

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 544 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 489



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 657 ccagggaacttgaacttggc 638

---

>emb|CR703247.2|CNS0G5KR Tetraodon nigroviridis full-length cDNA
          Length = 916

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| |||||||| |||||||| | ||| |||||||||||||  |||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR702411.2|CNS0G4XJ Tetraodon nigroviridis full-length cDNA
          Length = 918

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 383 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 328



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 494 ccagggaacttgaacttggc 475

---

>emb|CR699842.2|CNS0G2Y6 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR699390.2|CNS0G2LM Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR698890.2|CNS0G27Q Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR698626.2|CNS0G20E Tetraodon nigroviridis full-length cDNA
          Length = 696

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR697360.2|CNS0G118 Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327

---

>emb|CR696503.2|CNS0G0DF Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR695584.2|CNS0FZNW Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR695012.2|CNS0FZ80 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR693370.2|CNS0FXYE Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR692920.2|CNS0FXLW Tetraodon nigroviridis full-length cDNA
          Length = 956

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 381 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 326



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 492 ccagggaacttgaacttggc 473

---

>emb|CR691720.2|CNS0FWOK Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR690750.2|CNS0FVXM Tetraodon nigroviridis full-length cDNA
          Length = 690

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 373 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 318



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 484 ccagggaacttgaacttggc 465

---

>emb|CR687822.2|CNS0FTOA Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR683944.2|CNS0FQOK Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR683389.2|CNS0FQ95 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR683865.2|CNS0FQMD Tetraodon nigroviridis full-length cDNA
          Length = 418

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 101 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 46



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 212 ccagggaacttgaacttggc 193

---

>emb|CR683765.2|CNS0FQJL Tetraodon nigroviridis full-length cDNA
          Length = 700

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 383 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 328



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 494 ccagggaacttgaacttggc 475

---

>emb|CR682972.2|CNS0FPXK Tetraodon nigroviridis full-length cDNA
          Length = 727

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 410 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 355



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 521 ccagggaacttgaacttggc 502

---

>emb|CR682444.2|CNS0FPIW Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| |||||||| |||||||| | ||| |||||||||||||  |||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR682415.2|CNS0FPI3 Tetraodon nigroviridis full-length cDNA
          Length = 915

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| |||||||| |||||||| | ||| |||||||||||||  |||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR680276.2|CNS0FNUO Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR679679.2|CNS0FNE3 Tetraodon nigroviridis full-length cDNA
          Length = 668

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 351 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 296



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 462 ccagggaacttgaacttggc 443

---

>emb|CR679292.2|CNS0FN3C Tetraodon nigroviridis full-length cDNA
          Length = 665

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 350 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 295



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 461 ccagggaacttgaacttggc 442

---

>emb|CR678745.2|CNS0FMO5 Tetraodon nigroviridis full-length cDNA
          Length = 667

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 349 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 294



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 460 ccagggaacttgaacttggc 441

---

>emb|CR677248.2|CNS0FLJ0 Tetraodon nigroviridis full-length cDNA
          Length = 694

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR677235.2|CNS0FLIN Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR676747.2|CNS0FL53 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR675816.2|CNS0FKFI Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR671887.2|CNS0FHED Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR670190.2|CNS0FG38 Tetraodon nigroviridis full-length cDNA
          Length = 696

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR669765.2|CNS0FFRF Tetraodon nigroviridis full-length cDNA
          Length = 697

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR669547.2|CNS0FFLD Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR668289.2|CNS0FEMF Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR667800.2|CNS0FE8U Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR667784.2|CNS0FE8E Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR666481.2|CNS0FD87 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR666070.2|CNS0FCWS Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR665292.2|CNS0FCB6 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR664416.2|CNS0FBMU Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR664793.2|CNS0FBXB Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR664317.2|CNS0FBK3 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR663825.2|CNS0FB6F Tetraodon nigroviridis full-length cDNA
          Length = 696

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR661995.2|CNS0F9RL Tetraodon nigroviridis full-length cDNA
          Length = 691

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 374 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 319



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 485 ccagggaacttgaacttggc 466

---

>emb|CR661060.1|CNS0F91M Tetraodon nigroviridis full-length cDNA
          Length = 690

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 379 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 324



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 490 ccagggaacttgaacttggc 471

---

>emb|CR660123.2|CNS0F8BL Tetraodon nigroviridis full-length cDNA
          Length = 676

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 384 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 329



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 495 ccagggaacttgaacttggc 476

---

>emb|CR658652.2|CNS0F76Q Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR657230.2|CNS0F638 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR656598.2|CNS0F5LO Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR655837.2|CNS0F50J Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR655821.2|CNS0F503 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR652829.2|CNS0F2OZ Tetraodon nigroviridis full-length cDNA
          Length = 490

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327

---

>emb|CR651640.2|CNS0F1RY Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR650120.2|CNS0F0LQ Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR649290.2|CNS0EZYO Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR647942.2|CNS0EYX8 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR646246.2|CNS0EXM4 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR644771.2|CNS0EWH5 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR642622.2|CNS0EUTG Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR642404.2|CNS0EUNE Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR642314.2|CNS0EUKW Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR642260.2|CNS0EUJE Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR641599.2|CNS0EU11 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR641870.2|CNS0EU8K Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR641322.2|CNS0ETTC Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR640947.2|CNS0ETIX Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR640163.2|CNS0ESX5 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR639985.2|CNS0ESS7 Tetraodon nigroviridis full-length cDNA
          Length = 490

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327

---

>emb|CR639593.2|CNS0ESHB Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR639409.2|CNS0ESC7 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR635358.2|CNS0EP7O Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>emb|CR635001.2|CNS0EOXR Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||| ||||| || |||||||| | ||| |||||||||||||| |||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccagc 327



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474

---

>gb|AC147002.20| Medicago truncatula clone mth2-151m16, complete sequence
          Length = 128621

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                 
Query: 335   caatgatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
             |||| ||||| || || ||||||||||| ||||| |||||||||||||||||
Sbjct: 63185 caataatcttctgacgcccagggaacttaaacttagcacgacgaagagcctc 63134



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                         
Query: 472   ttcccgaaagcacccctcataccagtctggagcctatcagccccagcacacgaaagcatc 531
             ||||| || ||||| ||||| || ||||| | |||||| |||||||||||||| ||||||
Sbjct: 63048 ttcccaaacgcacctctcatccccgtctgcaacctatccgccccagcacacgagagcatc 62989

---

>emb|BX051816.1|CNS09C58 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 339 gatcttttggcgaccagggaacttgaacttggcacg 374
           |||||||||||| || ||||||||||||||||||||
Sbjct: 545 gatcttttggcggccggggaacttgaacttggcacg 510

---

>dbj|AB223250.1| Aspergillus oryzae cDNA, contig sequence: AoEST0081
          Length = 802

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           ||||||||||||||||||||||||| || ||| ||| || ||||||||
Sbjct: 520 gatcttttggcgaccagggaacttgtacatggaacggcggagagcctc 473

---

>dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011
          Length = 2505489

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                               
Query: 339     gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
               ||||||||||||||||||||||||| || ||| ||| || ||||||||
Sbjct: 1970364 gatcttttggcgaccagggaacttgtacatggaacggcggagagcctc 1970411

---

>gb|AF395838.1|AF395838 Bombyx mori QM protein (QM) mRNA, complete cds
          Length = 751

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           ||||||||| || || |||||||||||||||||||| || ||||||||
Sbjct: 512 gatcttttgacgtccggggaacttgaacttggcacggcgcagagcctc 465



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 493 ccagtctggagcctatcagccccagcacacga 524
           |||||||||||||||||||| ||||| |||||
Sbjct: 358 ccagtctggagcctatcagctccagcgcacga 327

---

>gb|AY130416.1| Petromyzon marinus ribosomal protein L10 mRNA, partial cds
          Length = 642

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||| ||||| | ||||||
Sbjct: 495 gatcttctggcgacccgggaacttgaacttggcgcgacggaaagcctc 448

---

>gb|AY130414.1| Branchiostoma lanceolatum ribosomal protein L10 mRNA, partial cds
          Length = 581

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| ||||| |||||||||||||||||||| || || ||||||||
Sbjct: 463 gatcttctggcgtccagggaacttgaacttggctcggcgcagagcctc 416



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 505 ctatcagccccagcacacga 524
           ||||||||||||||||||||
Sbjct: 297 ctatcagccccagcacacga 278

---

>emb|BX005483.3| Zebrafish DNA sequence from clone CH211-286G12 in linkage group 23,
             complete sequence
          Length = 182479

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                         
Query: 463   ccctgcggcttcccgaaagcacccctcataccagtctggagcct 506
             ||||| ||||||||||| ||||| | ||||||||||||||||||
Sbjct: 13800 ccctgaggcttcccgaacgcaccacgcataccagtctggagcct 13757



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 352   ccagggaacttgaacttggc 371
             ||||||||||||||||||||
Sbjct: 13911 ccagggaacttgaacttggc 13892

---

>gb|AY168758.1| Branchiostoma belcheri tsingtaunese ribosomal protein L10 mRNA,
           complete cds
          Length = 763

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| ||||| |||||||||||||||||||| || || ||||||||
Sbjct: 512 gatcttctggcggccagggaacttgaacttggctcggcgcagagcctc 465



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagcacac 522
           ||||| ||||| || || ||||| | ||| |||||||| |  ||||||||||||||||||
Sbjct: 388 ccctgaggcttgccaaaggcaccacgcatcccagtctgcaatctatcagccccagcacac 329

             
Query: 523 ga 524
           ||
Sbjct: 328 ga 327

---

>gb|AY909399.1| Siniperca chuatsi clone C410 ribosomal protein L10 mRNA, partial
           cds
          Length = 194

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 475 ccgaaagcacccctcataccagtctggagcctatcagccccagc 518
           ||||||||||| | ||| |||||||||||||||||||| |||||
Sbjct: 136 ccgaaagcaccacgcattccagtctggagcctatcagctccagc 93

---

>gb|AF099012.1|AF099012 Bombyx mandarina QM protein mRNA, complete cds
          Length = 735

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           ||||||||| || || |||||||||||||||||||| || ||||||||
Sbjct: 527 gatcttttgacgtccggggaacttgaacttggcacggcgcagagcctc 480



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccagcacac 522
           ||||| ||||| || || ||||| | ||| |||||||||||||||||||| ||||| |||
Sbjct: 403 ccctgaggcttgccaaacgcaccacgcatcccagtctggagcctatcagctccagcgcac 344

             
Query: 523 ga 524
           ||
Sbjct: 343 ga 342

---

>emb|CR450723.12| Zebrafish DNA sequence from clone DKEY-47C8 in linkage group 23,
             complete sequence
          Length = 234987

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                         
Query: 463   ccctgcggcttcccgaaagcacccctcataccagtctggagcct 506
             ||||| ||||||||||| ||||| | ||||||||||||||||||
Sbjct: 28609 ccctgaggcttcccgaacgcaccacgcataccagtctggagcct 28566



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 352   ccagggaacttgaacttggc 371
             ||||||||||||||||||||
Sbjct: 28720 ccagggaacttgaacttggc 28701


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,633,870
Number of Sequences: 3902068
Number of extensions: 4633870
Number of successful extensions: 84305
Number of sequences better than 10.0: 736
Number of HSP's better than 10.0 without gapping: 736
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 82513
Number of HSP's gapped (non-prelim): 1765
length of query: 531
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 508
effective length of database: 17,143,297,704
effective search space: 8708795233632
effective search space used: 8708795233632
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---