ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart41e05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_721222.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 42 0.93
2gb|AC146567.10| Medicago truncatula clone mth2-99p24, complete s... 42 0.93
3gb|AC118472.8| Mus musculus chromosome 19, clone RP23-187N14, co... 40 3.7
4gb|AC104631.2| Drosophila melanogaster clone BACR35D19, complete... 40 3.7
5gb|AC099308.2| Drosophila melanogaster clone BACR11M14, complete... 40 3.7
6ref|XM_719748.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 3.7
7ref|XM_718796.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 3.7
8ref|XM_719153.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 3.7
9ref|XM_719728.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 3.7
10ref|XM_720445.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 3.7
11ref|XM_720472.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 3.7
12ref|XM_720966.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 3.7
13ref|XM_721030.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 3.7
14ref|XM_721853.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 3.7
15ref|XM_722842.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 3.7
16ref|XM_724829.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 3.7
17ref|XM_722508.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 3.7
18ref|XM_722509.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 3.7
19ref|XM_740149.1| Plasmodium chabaudi chabaudi hypothetical prote... 40 3.7
20emb|AL096701.14|HSA247I13 Human DNA sequence from clone RP11-247... 40 3.7
21emb|AJ320480.1|PYO320480 Plasmodium yoelii yir3 gene, exons 1-3 40 3.7
22gb|AC112183.3| Homo sapiens chromosome 5 clone RP11-152F4, compl... 40 3.7
23gb|AC008512.8| Homo sapiens chromosome 5 clone CTC-454K8, comple... 40 3.7
24gb|AC026409.4| Homo sapiens chromosome 5 clone CTC-437M9, comple... 40 3.7
25gb|AF472921.1| Bacillus grandii grandii clone ggCGd6 Bag320 sate... 40 3.7
26gb|AC021080.4|AC021080 Homo sapiens chromosome 5 clone CTC-203K1... 40 3.7
27gb|AC008580.7| Homo sapiens chromosome 5 clone CTC-564J15, compl... 40 3.7
28gb|U79505.1|BGU79505 Bacillus grandii grandii satellite DNA 40 3.7
29gb|AE003569.4| Drosophila melanogaster chromosome X, section 70 ... 40 3.7
30gb|AC131231.10| Mus musculus chromosome 19, clone RP24-395L19, c... 40 3.7
31gb|AC102896.9| Mus musculus chromosome 5, clone RP24-353A8, comp... 40 3.7

>ref|XM_721222.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY05798)
           partial mRNA
          Length = 192

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 115 tgcattttttaataataatat 135
           |||||||||||||||||||||
Sbjct: 111 tgcattttttaataataatat 91



to top

>gb|AC146567.10| Medicago truncatula clone mth2-99p24, complete sequence
          Length = 141672

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 260   acagtcttgatttgagctcag 280
             |||||||||||||||||||||
Sbjct: 67430 acagtcttgatttgagctcag 67450



to top

>gb|AC118472.8| Mus musculus chromosome 19, clone RP23-187N14, complete sequence
          Length = 222869

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 15    tgctggttaaaaatgacaca 34
             ||||||||||||||||||||
Sbjct: 29601 tgctggttaaaaatgacaca 29582



to top

>gb|AC104631.2| Drosophila melanogaster clone BACR35D19, complete sequence
          Length = 166908

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 41   aaatgggaataattgttcta 60
            ||||||||||||||||||||
Sbjct: 2164 aaatgggaataattgttcta 2145



to top

>gb|AC099308.2| Drosophila melanogaster clone BACR11M14, complete sequence
          Length = 173097

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 41    aaatgggaataattgttcta 60
             ||||||||||||||||||||
Sbjct: 14308 aaatgggaataattgttcta 14327



to top

>ref|XM_719748.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY00498)
           partial mRNA
          Length = 967

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 tgcattttttaataataata 134
           ||||||||||||||||||||
Sbjct: 12  tgcattttttaataataata 31



to top

>ref|XM_718796.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY03699)
           partial mRNA
          Length = 885

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 tgcattttttaataataata 134
           ||||||||||||||||||||
Sbjct: 21  tgcattttttaataataata 40



to top

>ref|XM_719153.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY04006)
           partial mRNA
          Length = 1011

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 tgcattttttaataataata 134
           ||||||||||||||||||||
Sbjct: 11  tgcattttttaataataata 30



to top

>ref|XM_719728.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY04511)
           partial mRNA
          Length = 939

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 tgcattttttaataataata 134
           ||||||||||||||||||||
Sbjct: 21  tgcattttttaataataata 40



to top

>ref|XM_720445.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY05122)
           partial mRNA
          Length = 120

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 tgcattttttaataataata 134
           ||||||||||||||||||||
Sbjct: 11  tgcattttttaataataata 30



to top

>ref|XM_720472.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY05146)
           partial mRNA
          Length = 1056

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 tgcattttttaataataata 134
           ||||||||||||||||||||
Sbjct: 21  tgcattttttaataataata 40



to top

>ref|XM_720966.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY05586)
           partial mRNA
          Length = 999

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 tgcattttttaataataata 134
           ||||||||||||||||||||
Sbjct: 11  tgcattttttaataataata 30



to top

>ref|XM_721030.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY05637)
           partial mRNA
          Length = 942

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 tgcattttttaataataata 134
           ||||||||||||||||||||
Sbjct: 21  tgcattttttaataataata 40



to top

>ref|XM_721853.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY06318)
           partial mRNA
          Length = 873

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 tgcattttttaataataata 134
           ||||||||||||||||||||
Sbjct: 21  tgcattttttaataataata 40



to top

>ref|XM_722842.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY07134)
           partial mRNA
          Length = 933

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 tgcattttttaataataata 134
           ||||||||||||||||||||
Sbjct: 2   tgcattttttaataataata 21



to top

>ref|XM_724829.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY00213)
           partial mRNA
          Length = 924

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 tgcattttttaataataata 134
           ||||||||||||||||||||
Sbjct: 21  tgcattttttaataataata 40



to top

>ref|XM_722508.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY06861)
           partial mRNA
          Length = 966

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 tgcattttttaataataata 134
           ||||||||||||||||||||
Sbjct: 2   tgcattttttaataataata 21



to top

>ref|XM_722509.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY06862)
           partial mRNA
          Length = 1023

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 tgcattttttaataataata 134
           ||||||||||||||||||||
Sbjct: 2   tgcattttttaataataata 21



to top

>ref|XM_740149.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000057.05.0)
            partial mRNA
          Length = 1836

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 119  ttttttaataataatatgct 138
            ||||||||||||||||||||
Sbjct: 1554 ttttttaataataatatgct 1535



to top

>emb|AL096701.14|HSA247I13 Human DNA sequence from clone RP11-247I13 on chromosome 22 Contains the
             5' end of the DRG1 gene for developmentally regulated GTP
             binding protein 1, the EIF4ENIF1 gene foreukaryotic
             translation initiation factor 4E nuclear import factor 1,
             the 5' end of the gene for homolog of yeast Sfi1 (SFI1), a
             H2A histone family member Z (H2AFZ) pseudogene, a
             ribosomal protein S26 (RPS260) pseudogene, two novel genes
             and two CpG islands, complete sequence
          Length = 168110

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 239   ttgaagtggaaaaggactttcacagtct 266
             |||||| | |||||||||||||||||||
Sbjct: 28065 ttgaagagaaaaaggactttcacagtct 28038



to top

>emb|AJ320480.1|PYO320480 Plasmodium yoelii yir3 gene, exons 1-3
          Length = 1514

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 115  tgcattttttaataataata 134
            ||||||||||||||||||||
Sbjct: 1282 tgcattttttaataataata 1263



to top

>gb|AC112183.3| Homo sapiens chromosome 5 clone RP11-152F4, complete sequence
          Length = 163612

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 120    tttttaataataatatgcta 139
              ||||||||||||||||||||
Sbjct: 139245 tttttaataataatatgcta 139264



to top

>gb|AC008512.8| Homo sapiens chromosome 5 clone CTC-454K8, complete sequence
          Length = 110931

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 13    gctgctggttaaaaatgacacaat 36
             |||||| |||||||||||||||||
Sbjct: 41657 gctgcttgttaaaaatgacacaat 41680



to top

>gb|AC026409.4| Homo sapiens chromosome 5 clone CTC-437M9, complete sequence
          Length = 163384

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 13     gctgctggttaaaaatgacacaat 36
              |||||| |||||||||||||||||
Sbjct: 137653 gctgcttgttaaaaatgacacaat 137630



to top

>gb|AF472921.1| Bacillus grandii grandii clone ggCGd6 Bag320 satellite sequence
          Length = 316

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 195 ataaccaaaatgacttgaatcgat 218
           ||||||||||| ||||||||||||
Sbjct: 61  ataaccaaaataacttgaatcgat 38



to top

>gb|AC021080.4|AC021080 Homo sapiens chromosome 5 clone CTC-203K17, complete sequence
          Length = 103522

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 13    gctgctggttaaaaatgacacaat 36
             |||||| |||||||||||||||||
Sbjct: 25956 gctgcttgttaaaaatgacacaat 25979



to top

>gb|AC008580.7| Homo sapiens chromosome 5 clone CTC-564J15, complete sequence
          Length = 122322

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 13    gctgctggttaaaaatgacacaat 36
             |||||| |||||||||||||||||
Sbjct: 61112 gctgcttgttaaaaatgacacaat 61089



to top

>gb|U79505.1|BGU79505 Bacillus grandii grandii satellite DNA
          Length = 316

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 195 ataaccaaaatgacttgaatcgat 218
           ||||||||||| ||||||||||||
Sbjct: 61  ataaccaaaataacttgaatcgat 38



to top

>gb|AE003569.4| Drosophila melanogaster chromosome X, section 70 of 74 of the complete
             sequence
          Length = 283558

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    aaatgggaataattgttcta 60
             ||||||||||||||||||||
Sbjct: 98396 aaatgggaataattgttcta 98377



to top

>gb|AC131231.10| Mus musculus chromosome 19, clone RP24-395L19, complete sequence
          Length = 181700

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 15     tgctggttaaaaatgacaca 34
              ||||||||||||||||||||
Sbjct: 178774 tgctggttaaaaatgacaca 178755



to top

>gb|AC102896.9| Mus musculus chromosome 5, clone RP24-353A8, complete sequence
          Length = 156422

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 238   attgaagtggaaaaggactt 257
             ||||||||||||||||||||
Sbjct: 65682 attgaagtggaaaaggactt 65663


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,551,143
Number of Sequences: 3902068
Number of extensions: 4551143
Number of successful extensions: 79077
Number of sequences better than 10.0: 31
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79030
Number of HSP's gapped (non-prelim): 47
length of query: 281
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 259
effective length of database: 17,147,199,772
effective search space: 4441124740948
effective search space used: 4441124740948
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top