ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart41d08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|U88090.1|HVU88090 Hordeum vulgare nonspecific lipid transfer ... 733 0.0
2ref|XM_475853.1| Oryza sativa (japonica cultivar-group), predic... 121 2e-24
3gb|AC135925.2| Oryza sativa (japonica cultivar-group) chromosome... 121 2e-24
4gb|AC130725.2| Oryza sativa (japonica cultivar-group) chromosome... 121 2e-24
5gb|AC136492.3| Oryza sativa (japonica cultivar-group) chromosome... 121 2e-24
6dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 121 2e-24
7dbj|AK062463.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 2e-24
8gb|AY105127.1| Zea mays PCO127262 mRNA sequence 100 7e-18
9dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 56 9e-05
10dbj|AP003621.3| Oryza sativa (japonica cultivar-group) genomic D... 56 9e-05
11dbj|AP003761.3| Oryza sativa (japonica cultivar-group) genomic D... 56 9e-05
12dbj|AK062667.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
13emb|AL670413.19| Mouse DNA sequence from clone RP23-298E4 on chr... 48 0.022
14ref|XM_475855.1| Oryza sativa (japonica cultivar-group), predic... 46 0.085
15gb|AC129717.3| Oryza sativa (japonica cultivar-group) chromosome... 46 0.085
16emb|AL662905.7| Human DNA sequence from clone RP13-358O4 on chro... 46 0.085
17dbj|AK119689.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.085
18dbj|AK063729.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.085
19gb|BT016516.1| Zea mays clone Contig349 mRNA sequence 44 0.34
20ref|XM_359454.1| Magnaporthe grisea 70-15 hypothetical protein (... 44 0.34
21ref|NG_004620.1| Rattus norvegicus tenascin X pseudogene (Tnx) o... 44 0.34
22gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge... 44 0.34
23gb|AE009245.1| Agrobacterium tumefaciens str. C58 linear chromos... 44 0.34
24gb|AE008368.1| Agrobacterium tumefaciens str. C58 linear chromos... 44 0.34
25emb|BX883044.1| Rattus norvegicus chromosome 20, major histocomp... 44 0.34
26dbj|AK062493.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.34
27gb|AC150871.4| Bos taurus BAC CH240-316E7 (Children's Hospital ... 42 1.3
28gb|AC134870.4| Mus musculus BAC clone RP23-166E8 from chromosome... 42 1.3
29ref|XM_807845.1| Trypanosoma cruzi strain CL Brener ATP-dependen... 42 1.3
30ref|XM_809564.1| Trypanosoma cruzi strain CL Brener ATP-dependen... 42 1.3
31gb|AC133000.5| Rattus Norvegicus Strain CH230-62B6 BAC, BN/SsNHs... 42 1.3
32gb|AF234171.2|AF234171 Mus musculus STAT5B (Stat5b) gene, comple... 42 1.3
33gb|AC073918.13|AC073918 Mus musculus 11 BAC RP23-362J7 (Roswell ... 42 1.3
34gb|AC136926.4| Rattus Norvegicus Strain CH230-163A18 BAC, BN/SsN... 42 1.3
35gb|AC172623.3| Mus musculus chromosome 8, clone RP23-478A9, comp... 42 1.3
36gb|AC113182.14| Mus musculus chromosome 8, clone RP23-39F24, com... 42 1.3
37emb|AL591466.8| Mouse DNA sequence from clone RP23-279L23 on chr... 42 1.3
38gb|BT016589.1| Zea mays clone Contig422 mRNA sequence 40 5.3
39gb|BT016445.1| Zea mays clone Contig278 mRNA sequence 40 5.3
40gb|CP000114.1| Streptococcus agalactiae A909, complete genome 40 5.3
41gb|AC095326.9| Rattus norvegicus 1 BAC CH230-89E14 (Children's H... 40 5.3
42gb|AC125526.4| Mus musculus BAC clone RP24-498L21 from chromosom... 40 5.3
43gb|AC146842.9| Medicago truncatula clone mth2-10a3, complete seq... 40 5.3
44gb|AC137836.25| Medicago truncatula clone mth2-10f14, complete s... 40 5.3
45gb|AC139290.15| Medicago truncatula clone mth2-23f4, complete se... 40 5.3
46gb|AE014838.1| Plasmodium falciparum 3D7 chromosome 11 section 3... 40 5.3
47emb|AL021919.4|HS1045J21 Human DNA sequence from clone RP5-1045J... 40 5.3
48gb|AE014241.1| Streptococcus agalactiae 2603V/R section 51 of 10... 40 5.3
49gb|AC087675.9| Homo sapiens chromosome 18, clone RP11-871M19, co... 40 5.3
50gb|CP000088.1| Thermobifida fusca YX, complete genome 40 5.3
51emb|AL766848.1|SAG766848 Streptococcus agalactiae NEM316 complet... 40 5.3
52gb|AE005873.1| Caulobacter crescentus CB15 section 199 of 359 of... 40 5.3
53gb|AC160000.9| Mus musculus 6 BAC RP24-340J19 (Roswell Park Canc... 40 5.3
54gb|AC007814.6|AC007814 Drosophila melanogaster, chromosome 3R, r... 40 5.3
55gb|AC009242.5| Homo sapiens BAC clone RP11-557N21 from 2, comple... 40 5.3
56gb|AC153657.4| Mus musculus BAC clone RP23-324B3 from chromosome... 40 5.3
57gb|AC068999.15|AC068999 Homo sapiens chromosome 18 clone RP11-70... 40 5.3
58gb|AC138117.4| Mus musculus BAC clone RP24-146K16 from chromosom... 40 5.3
59emb|CR628394.17| Zebrafish DNA sequence from clone DKEY-204A24 i... 40 5.3
60emb|BX294662.13| Zebrafish DNA sequence from clone DKEYP-117E6 i... 40 5.3
61emb|AL928920.5| Zebrafish DNA sequence from clone DKEY-14A7 in l... 40 5.3
62gb|AY103625.1| Zea mays PCO091587 mRNA sequence 40 5.3
63emb|AL117193.2|CEY105C5A Caenorhabditis elegans YAC Y105C5A, com... 40 5.3
64gb|AE003724.3| Drosophila melanogaster chromosome 3R, section 62... 40 5.3
65dbj|AP000824.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 5.3
66dbj|AP005130.4| Homo sapiens genomic DNA, chromosome 18 clone:RP... 40 5.3
67gb|AC109314.8| Homo sapiens chromosome 18, clone CTD-3135I6, com... 40 5.3
68emb|AL031770.12|HS20B11 Human DNA sequence from clone RP1-20B11 ... 40 5.3
69gb|M12896.1|DROOPSAA D.melanogaster opsin gene Rh2, complete cds 40 5.3

>gb|U88090.1|HVU88090 Hordeum vulgare nonspecific lipid transfer protein (ltp-BR1) mRNA,
           complete cds
          Length = 681

 Score =  733 bits (370), Expect = 0.0
 Identities = 389/394 (98%), Gaps = 1/394 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   accacaaagagcgccatgaaaa-tgtgcacgccacaggaagaaacatataaattacatat 59
           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 619 accacaaagagcgccatgaaaaatgtgcacgccacaggaagaaacatataaattacatat 560

                                                                       
Query: 60  agctggatacatcaccattattgcgtatattcagaaatttagatacacatcggtccacaa 119
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 559 agctggatacatcaccattattgcgtatattcagaaatttagatacacatcggtccacaa 500

                                                                       
Query: 120 ctccacatacatcgtcagggtagctagattgtgttgggaaacactgacacatgaacacac 179
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 499 ctccacatacatcgtcagggtagctagattgtgttgggaaacactgacacatgaacacac 440

                                                                       
Query: 180 atgaaacatgcagcgagaggacaaaaaggcccgcgtgggcgctgcgctctcccgtatgga 239
           ||||||||||||||||||||||| | ||||||||||| ||||||||||||||||||||||
Sbjct: 439 atgaaacatgcagcgagaggacagagaggcccgcgtgcgcgctgcgctctcccgtatgga 380

                                                                       
Query: 240 tcgatcatatatgcgtccatctagcaggagggcacgggcaccttgcaggcggccatgacc 299
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 379 tcgatcatatatgcgtccatctagcaggagggcacgggcaccttgcaggcggccatgacc 320

                                                                       
Query: 300 ttcttgccgttaggggagtccacgtactgcttgaggttggggtcgcgcgcgtactggcac 359
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 319 ttcttgccgttaggggagtcgacgtactgcttgaggttggggtcgcgcgcgtactggcac 260

                                             
Query: 360 atgcaaggctgctgctccctcatcttgctgcagc 393
           ||||||||||||||||||||||||||||||||||
Sbjct: 259 atgcaaggctgctgctccctcatcttgctgcagc 226



to top

>ref|XM_475853.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 285

 Score =  121 bits (61), Expect = 2e-24
 Identities = 115/133 (86%)
 Strand = Plus / Minus

                                                                       
Query: 261 tagcaggagggcacgggcaccttgcaggcggccatgaccttcttgccgttaggggagtcc 320
           ||||||||||| ||||| || | ||||||||||| ||||||||||||||| |||||||  
Sbjct: 284 tagcaggaggggacggggacgtggcaggcggccaagaccttcttgccgttgggggagttg 225

                                                                       
Query: 321 acgtactgcttgaggttggggtcgcgcgcgtactggcacatgcaaggctgctgctccctc 380
           |||||  |||  ||||| |||||||||||||||||||||| ||| |||||||||||| ||
Sbjct: 224 acgtagcgctgcaggtttgggtcgcgcgcgtactggcacaggcacggctgctgctccttc 165

                        
Query: 381 atcttgctgcagc 393
           |||  ||||||||
Sbjct: 164 atccggctgcagc 152



to top

>gb|AC135925.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0560C03,
             complete sequence
          Length = 177861

 Score =  121 bits (61), Expect = 2e-24
 Identities = 115/133 (86%)
 Strand = Plus / Minus

                                                                         
Query: 261   tagcaggagggcacgggcaccttgcaggcggccatgaccttcttgccgttaggggagtcc 320
             ||||||||||| ||||| || | ||||||||||| ||||||||||||||| |||||||  
Sbjct: 42170 tagcaggaggggacggggacgtggcaggcggccaagaccttcttgccgttgggggagttg 42111

                                                                         
Query: 321   acgtactgcttgaggttggggtcgcgcgcgtactggcacatgcaaggctgctgctccctc 380
             |||||  |||  ||||| |||||||||||||||||||||| ||| |||||||||||| ||
Sbjct: 42110 acgtagcgctgcaggtttgggtcgcgcgcgtactggcacaggcacggctgctgctccttc 42051

                          
Query: 381   atcttgctgcagc 393
             |||  ||||||||
Sbjct: 42050 atccggctgcagc 42038



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                        
Query: 269   gggcacgggcaccttgcaggcggccatgaccttcttgccgttaggggagtccacgtact 327
             ||||| ||| |||||||||| ||| | ||||||||||||||| || ||||  |||||||
Sbjct: 57151 gggcaggggaaccttgcaggtggcgaagaccttcttgccgttgggcgagttgacgtact 57093



to top

>gb|AC130725.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0494H05,
              complete sequence
          Length = 141715

 Score =  121 bits (61), Expect = 2e-24
 Identities = 115/133 (86%)
 Strand = Plus / Minus

                                                                          
Query: 261    tagcaggagggcacgggcaccttgcaggcggccatgaccttcttgccgttaggggagtcc 320
              ||||||||||| ||||| || | ||||||||||| ||||||||||||||| |||||||  
Sbjct: 117355 tagcaggaggggacggggacgtggcaggcggccaagaccttcttgccgttgggggagttg 117296

                                                                          
Query: 321    acgtactgcttgaggttggggtcgcgcgcgtactggcacatgcaaggctgctgctccctc 380
              |||||  |||  ||||| |||||||||||||||||||||| ||| |||||||||||| ||
Sbjct: 117295 acgtagcgctgcaggtttgggtcgcgcgcgtactggcacaggcacggctgctgctccttc 117236

                           
Query: 381    atcttgctgcagc 393
              |||  ||||||||
Sbjct: 117235 atccggctgcagc 117223



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                         
Query: 269    gggcacgggcaccttgcaggcggccatgaccttcttgccgttaggggagtccacgtact 327
              ||||| ||| |||||||||| ||| | ||||||||||||||| || ||||  |||||||
Sbjct: 132336 gggcaggggaaccttgcaggtggcgaagaccttcttgccgttgggcgagttgacgtact 132278



to top

>gb|AC136492.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0554F08,
              complete sequence
          Length = 166218

 Score =  121 bits (61), Expect = 2e-24
 Identities = 115/133 (86%)
 Strand = Plus / Minus

                                                                          
Query: 261    tagcaggagggcacgggcaccttgcaggcggccatgaccttcttgccgttaggggagtcc 320
              ||||||||||| ||||| || | ||||||||||| ||||||||||||||| |||||||  
Sbjct: 141858 tagcaggaggggacggggacgtggcaggcggccaagaccttcttgccgttgggggagttg 141799

                                                                          
Query: 321    acgtactgcttgaggttggggtcgcgcgcgtactggcacatgcaaggctgctgctccctc 380
              |||||  |||  ||||| |||||||||||||||||||||| ||| |||||||||||| ||
Sbjct: 141798 acgtagcgctgcaggtttgggtcgcgcgcgtactggcacaggcacggctgctgctccttc 141739

                           
Query: 381    atcttgctgcagc 393
              |||  ||||||||
Sbjct: 141738 atccggctgcagc 141726



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                         
Query: 269    gggcacgggcaccttgcaggcggccatgaccttcttgccgttaggggagtccacgtact 327
              ||||| ||| |||||||||| ||| | ||||||||||||||| || ||||  |||||||
Sbjct: 156839 gggcaggggaaccttgcaggtggcgaagaccttcttgccgttgggcgagttgacgtact 156781



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  121 bits (61), Expect = 2e-24
 Identities = 115/133 (86%)
 Strand = Plus / Minus

                                                                            
Query: 261      tagcaggagggcacgggcaccttgcaggcggccatgaccttcttgccgttaggggagtcc 320
                ||||||||||| ||||| || | ||||||||||| ||||||||||||||| |||||||  
Sbjct: 27110774 tagcaggaggggacggggacgtggcaggcggccaagaccttcttgccgttgggggagttg 27110715

                                                                            
Query: 321      acgtactgcttgaggttggggtcgcgcgcgtactggcacatgcaaggctgctgctccctc 380
                |||||  |||  ||||| |||||||||||||||||||||| ||| |||||||||||| ||
Sbjct: 27110714 acgtagcgctgcaggtttgggtcgcgcgcgtactggcacaggcacggctgctgctccttc 27110655

                             
Query: 381      atcttgctgcagc 393
                |||  ||||||||
Sbjct: 27110654 atccggctgcagc 27110642



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                           
Query: 269      gggcacgggcaccttgcaggcggccatgaccttcttgccgttaggggagtccacgtact 327
                ||||| ||| |||||||||| ||| | ||||||||||||||| || ||||  |||||||
Sbjct: 27125755 gggcaggggaaccttgcaggtggcgaagaccttcttgccgttgggcgagttgacgtact 27125697



to top

>dbj|AK062463.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-103-D11, full
           insert sequence
          Length = 625

 Score =  121 bits (61), Expect = 2e-24
 Identities = 115/133 (86%)
 Strand = Plus / Minus

                                                                       
Query: 261 tagcaggagggcacgggcaccttgcaggcggccatgaccttcttgccgttaggggagtcc 320
           ||||||||||| ||||| || | ||||||||||| ||||||||||||||| |||||||  
Sbjct: 382 tagcaggaggggacggggacgtggcaggcggccaagaccttcttgccgttgggggagttg 323

                                                                       
Query: 321 acgtactgcttgaggttggggtcgcgcgcgtactggcacatgcaaggctgctgctccctc 380
           |||||  |||  ||||| |||||||||||||||||||||| ||| |||||||||||| ||
Sbjct: 322 acgtagcgctgcaggtttgggtcgcgcgcgtactggcacaggcacggctgctgctccttc 263

                        
Query: 381 atcttgctgcagc 393
           |||  ||||||||
Sbjct: 262 atccggctgcagc 250



to top

>gb|AY105127.1| Zea mays PCO127262 mRNA sequence
          Length = 620

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 101/118 (85%)
 Strand = Plus / Minus

                                                                       
Query: 260 ctagcaggagggcacgggcaccttgcaggcggccatgaccttcttgccgttaggggagtc 319
           |||||| || ||||||||||||||||| ||||||||| ||||||||||||| || |||| 
Sbjct: 346 ctagcacgacggcacgggcaccttgcacgcggccatggccttcttgccgttgggcgagtt 287

                                                                     
Query: 320 cacgtactgcttgaggttggggtcgcgcgcgtactggcacatgcaaggctgctgctcc 377
            |||||  |||  || ||||||||||||||||||  ||||| ||| ||||||||||||
Sbjct: 286 gacgtagcgctgaagattggggtcgcgcgcgtacgtgcacaggcacggctgctgctcc 229



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                    
Query: 339      gggtcgcgcgcgtactggcacatgcaaggctgctgc 374
                |||||||||||||||||||||| ||| |||||||||
Sbjct: 29292232 gggtcgcgcgcgtactggcacaggcacggctgctgc 29292197



to top

>dbj|AP003621.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
            clone:P0621D05
          Length = 180250

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 339  gggtcgcgcgcgtactggcacatgcaaggctgctgc 374
            |||||||||||||||||||||| ||| |||||||||
Sbjct: 3113 gggtcgcgcgcgtactggcacaggcacggctgctgc 3078



to top

>dbj|AP003761.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0018H04
          Length = 142053

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                 
Query: 339   gggtcgcgcgcgtactggcacatgcaaggctgctgc 374
             |||||||||||||||||||||| ||| |||||||||
Sbjct: 55030 gggtcgcgcgcgtactggcacaggcacggctgctgc 54995



to top

>dbj|AK062667.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-105-F12, full
           insert sequence
          Length = 626

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 339 gggtcgcgcgcgtactggcacatgcaaggctgctgc 374
           |||||||||||||||||||||| ||| |||||||||
Sbjct: 310 gggtcgcgcgcgtactggcacaggcacggctgctgc 275



to top

>emb|AL670413.19| Mouse DNA sequence from clone RP23-298E4 on chromosome 4, complete
            sequence
          Length = 243792

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 166  acacatgaacacacatgaaacatg 189
            ||||||||||||||||||||||||
Sbjct: 7083 acacatgaacacacatgaaacatg 7060



to top

>ref|XM_475855.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 291

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 269 gggcacgggcaccttgcaggcggccatgaccttcttgccgttaggggagtccacgtact 327
           ||||| ||| |||||||||| ||| | ||||||||||||||| || ||||  |||||||
Sbjct: 282 gggcaggggaaccttgcaggtggcgaagaccttcttgccgttgggcgagttgacgtact 224



to top

>gb|AC129717.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
           OSJNBa0079H23, complete sequence
          Length = 191765

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 269 gggcacgggcaccttgcaggcggccatgaccttcttgccgttaggggagtccacgtact 327
           ||||| ||| |||||||||| ||| | ||||||||||||||| || ||||  |||||||
Sbjct: 723 gggcaggggaaccttgcaggtggcgaagaccttcttgccgttgggcgagttgacgtact 665



to top

>emb|AL662905.7| Human DNA sequence from clone RP13-358O4 on chromosome X, complete
             sequence
          Length = 99284

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 38    aagaaacatataaattacatata 60
             |||||||||||||||||||||||
Sbjct: 67361 aagaaacatataaattacatata 67339



to top

>dbj|AK119689.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-B03, full
           insert sequence
          Length = 579

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 269 gggcacgggcaccttgcaggcggccatgaccttcttgccgttaggggagtccacgtact 327
           ||||| ||| |||||||||| ||| | ||||||||||||||| || ||||  |||||||
Sbjct: 365 gggcaggggaaccttgcaggtggcgaagaccttcttgccgttgggcgagttgacgtact 307



to top

>dbj|AK063729.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-120-E03, full
           insert sequence
          Length = 540

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 269 gggcacgggcaccttgcaggcggccatgaccttcttgccgttaggggagtccacgtact 327
           ||||| ||| |||||||||| ||| | ||||||||||||||| || ||||  |||||||
Sbjct: 375 gggcaggggaaccttgcaggtggcgaagaccttcttgccgttgggcgagttgacgtact 317



to top

>gb|BT016516.1| Zea mays clone Contig349 mRNA sequence
          Length = 818

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 289 cggccatgaccttcttgccgtt 310
           ||||||||||||||||||||||
Sbjct: 312 cggccatgaccttcttgccgtt 291



to top

>ref|XM_359454.1| Magnaporthe grisea 70-15 hypothetical protein (MG05323.4) partial
            mRNA
          Length = 1629

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 4    acaaagagcgccatgaaaatgt 25
            ||||||||||||||||||||||
Sbjct: 1289 acaaagagcgccatgaaaatgt 1268



to top

>ref|NG_004620.1| Rattus norvegicus tenascin X pseudogene (Tnx) on chromosome 20
          Length = 44507

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 159   aacactgacacatgaacacaca 180
             ||||||||||||||||||||||
Sbjct: 19362 aacactgacacatgaacacaca 19383



to top

>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome
          Length = 3696649

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 287     ggcggccatgaccttcttgccg 308
               ||||||||||||||||||||||
Sbjct: 1724267 ggcggccatgaccttcttgccg 1724288



to top

>gb|AE009245.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 15 of
            187 of the complete sequence
          Length = 12796

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 287  ggcggccatgaccttcttgccg 308
            ||||||||||||||||||||||
Sbjct: 5977 ggcggccatgaccttcttgccg 5998



to top

>gb|AE008368.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 172 of
            187 of the complete sequence
          Length = 13928

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 287  ggcggccatgaccttcttgccg 308
            ||||||||||||||||||||||
Sbjct: 7952 ggcggccatgaccttcttgccg 7931



to top

>emb|BX883044.1| Rattus norvegicus chromosome 20, major histocompatibility complex,
              assembled from 40 BACs, strain Brown Norway (BN/ssNHsd),
              RT1n haplotype; segment 3/11
          Length = 340493

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 159    aacactgacacatgaacacaca 180
              ||||||||||||||||||||||
Sbjct: 303632 aacactgacacatgaacacaca 303653



to top

>dbj|AK062493.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-103-H09, full
           insert sequence
          Length = 437

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 339 gggtcgcgcgcgtactggcaca 360
           ||||||||||||||||||||||
Sbjct: 178 gggtcgcgcgcgtactggcaca 157



to top

>gb|AC150871.4| Bos taurus  BAC CH240-316E7 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 167244

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 160   acactgacacatgaacacaca 180
             |||||||||||||||||||||
Sbjct: 97364 acactgacacatgaacacaca 97344



to top

>gb|AC134870.4| Mus musculus BAC clone RP23-166E8 from chromosome 7, complete sequence
          Length = 165349

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 160   acactgacacatgaacacaca 180
             |||||||||||||||||||||
Sbjct: 70802 acactgacacatgaacacaca 70782



to top

>ref|XM_807845.1| Trypanosoma cruzi strain CL Brener ATP-dependent zinc
           metallopeptidase (Tc00.1047053506223.80) partial mRNA
          Length = 2052

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 316 agtccacgtactgcttgaggt 336
           |||||||||||||||||||||
Sbjct: 592 agtccacgtactgcttgaggt 572



to top

>ref|XM_809564.1| Trypanosoma cruzi strain CL Brener ATP-dependent zinc
           metallopeptidase (Tc00.1047053511717.170) partial mRNA
          Length = 2049

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 316 agtccacgtactgcttgaggt 336
           |||||||||||||||||||||
Sbjct: 589 agtccacgtactgcttgaggt 569



to top

>gb|AC133000.5| Rattus Norvegicus Strain CH230-62B6 BAC, BN/SsNHsd/MCW, complete sequence
          Length = 245581

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 160    acactgacacatgaacacaca 180
              |||||||||||||||||||||
Sbjct: 103353 acactgacacatgaacacaca 103333



to top

>gb|AF234171.2|AF234171 Mus musculus STAT5B (Stat5b) gene, complete cds
          Length = 71512

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 170   atgaacacacatgaaacatgc 190
             |||||||||||||||||||||
Sbjct: 32559 atgaacacacatgaaacatgc 32539



to top

>gb|AC073918.13|AC073918 Mus musculus 11 BAC RP23-362J7 (Roswell Park Cancer Institute Mouse BAC
              Library) complete sequence
          Length = 195667

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 170    atgaacacacatgaaacatgc 190
              |||||||||||||||||||||
Sbjct: 142696 atgaacacacatgaaacatgc 142676



to top

>gb|AC136926.4| Rattus Norvegicus Strain CH230-163A18 BAC, BN/SsNHsd/MCW, complete
              sequence
          Length = 214942

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 160    acactgacacatgaacacaca 180
              |||||||||||||||||||||
Sbjct: 194422 acactgacacatgaacacaca 194402



to top

>gb|AC172623.3| Mus musculus chromosome 8, clone RP23-478A9, complete sequence
          Length = 182316

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 158    aaacactgacacatgaacaca 178
              |||||||||||||||||||||
Sbjct: 152669 aaacactgacacatgaacaca 152649



to top

>gb|AC113182.14| Mus musculus chromosome 8, clone RP23-39F24, complete sequence
          Length = 217373

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 158   aaacactgacacatgaacaca 178
             |||||||||||||||||||||
Sbjct: 50454 aaacactgacacatgaacaca 50434



to top

>emb|AL591466.8| Mouse DNA sequence from clone RP23-279L23 on chromosome 11, complete
              sequence
          Length = 239847

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 170    atgaacacacatgaaacatgc 190
              |||||||||||||||||||||
Sbjct: 177012 atgaacacacatgaaacatgc 176992



to top

>gb|BT016589.1| Zea mays clone Contig422 mRNA sequence
          Length = 899

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 291 gccatgaccttcttgccgtt 310
           ||||||||||||||||||||
Sbjct: 337 gccatgaccttcttgccgtt 318



to top

>gb|BT016445.1| Zea mays clone Contig278 mRNA sequence
          Length = 1018

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 291 gccatgaccttcttgccgtt 310
           ||||||||||||||||||||
Sbjct: 352 gccatgaccttcttgccgtt 333



to top

>gb|CP000114.1| Streptococcus agalactiae A909, complete genome
          Length = 2127839

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 33      acaggaagaaacatataaat 52
               ||||||||||||||||||||
Sbjct: 1138186 acaggaagaaacatataaat 1138205



to top

>gb|AC095326.9| Rattus norvegicus 1 BAC CH230-89E14 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 219914

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 166   acacatgaacacacatgaaa 185
             ||||||||||||||||||||
Sbjct: 32058 acacatgaacacacatgaaa 32077



to top

>gb|AC125526.4| Mus musculus BAC clone RP24-498L21 from chromosome 15, complete
             sequence
          Length = 178670

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 166   acacatgaacacacatgaaa 185
             ||||||||||||||||||||
Sbjct: 38434 acacatgaacacacatgaaa 38415



to top

>gb|AC146842.9| Medicago truncatula clone mth2-10a3, complete sequence
          Length = 63866

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 40    gaaacatataaattacatat 59
             ||||||||||||||||||||
Sbjct: 50735 gaaacatataaattacatat 50754



to top

>gb|AC137836.25| Medicago truncatula clone mth2-10f14, complete sequence
          Length = 140197

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 40    gaaacatataaattacatat 59
             ||||||||||||||||||||
Sbjct: 76417 gaaacatataaattacatat 76398



to top

>gb|AC139290.15| Medicago truncatula clone mth2-23f4, complete sequence
          Length = 127701

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 40     gaaacatataaattacatat 59
              ||||||||||||||||||||
Sbjct: 105251 gaaacatataaattacatat 105232



to top

>gb|AE014838.1| Plasmodium falciparum 3D7 chromosome 11 section 3 of 8 of the complete
              sequence
          Length = 250029

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 41     aaacatataaattacatata 60
              ||||||||||||||||||||
Sbjct: 123806 aaacatataaattacatata 123825



to top

>emb|AL021919.4|HS1045J21 Human DNA sequence from clone RP5-1045J21 on chromosome 1q23.3-24.3
             Contains part of the TNR gene for tenascin R (restrictin,
             janusin), a novel gene and one CpG island, complete
             sequence
          Length = 138636

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 42    aacatataaattacatatag 61
             ||||||||||||||||||||
Sbjct: 60990 aacatataaattacatatag 61009



to top

>gb|AE014241.1| Streptococcus agalactiae 2603V/R section 51 of 100 of the complete
            genome
          Length = 21827

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 33   acaggaagaaacatataaat 52
            ||||||||||||||||||||
Sbjct: 5110 acaggaagaaacatataaat 5129



to top

>gb|AC087675.9| Homo sapiens chromosome 18, clone RP11-871M19, complete sequence
          Length = 168201

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 40    gaaacatataaattacatatagctggatacat 71
             |||||||||||| |||||||| ||| ||||||
Sbjct: 11845 gaaacatataaactacatatatctgtatacat 11814



to top

>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 284     gcaggcggccatgaccttcttgcc 307
               |||||||||||||| |||||||||
Sbjct: 1700557 gcaggcggccatgatcttcttgcc 1700534



to top

>emb|AL766848.1|SAG766848 Streptococcus agalactiae NEM316 complete genome, segment 6
          Length = 233050

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 33     acaggaagaaacatataaat 52
              ||||||||||||||||||||
Sbjct: 200488 acaggaagaaacatataaat 200507



to top

>gb|AE005873.1| Caulobacter crescentus CB15 section 199 of 359 of the complete genome
          Length = 10022

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 206  aggcccgcgtgggcgctgcg 225
            ||||||||||||||||||||
Sbjct: 8207 aggcccgcgtgggcgctgcg 8226



to top

>gb|AC160000.9| Mus musculus 6 BAC RP24-340J19 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 198476

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 118    aactccacatacatcgtcag 137
              ||||||||||||||||||||
Sbjct: 152381 aactccacatacatcgtcag 152400



to top

>gb|AC007814.6|AC007814 Drosophila melanogaster, chromosome 3R, region 91D-91E, BAC clone
             BACR44N12, complete sequence
          Length = 204173

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 38    aagaaacatataaattacatatag 61
             ||||||||||||||||| ||||||
Sbjct: 59510 aagaaacatataaattagatatag 59487



to top

>gb|AC009242.5| Homo sapiens BAC clone RP11-557N21 from 2, complete sequence
          Length = 158395

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 41     aaacatataaattacatata 60
              ||||||||||||||||||||
Sbjct: 136737 aaacatataaattacatata 136718



to top

>gb|AC153657.4| Mus musculus BAC clone RP23-324B3 from chromosome 12, complete sequence
          Length = 208058

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 166    acacatgaacacacatgaaa 185
              ||||||||||||||||||||
Sbjct: 133710 acacatgaacacacatgaaa 133729



to top

>gb|AC068999.15|AC068999 Homo sapiens chromosome 18 clone RP11-70G19, complete sequence
          Length = 194813

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 159   aacactgacacatgaacaca 178
             ||||||||||||||||||||
Sbjct: 23039 aacactgacacatgaacaca 23058



to top

>gb|AC138117.4| Mus musculus BAC clone RP24-146K16 from chromosome 6, complete sequence
          Length = 230020

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 118   aactccacatacatcgtcag 137
             ||||||||||||||||||||
Sbjct: 74147 aactccacatacatcgtcag 74166



to top

>emb|CR628394.17| Zebrafish DNA sequence from clone DKEY-204A24 in linkage group 19,
              complete sequence
          Length = 242800

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 41     aaacatataaattacatata 60
              ||||||||||||||||||||
Sbjct: 112808 aaacatataaattacatata 112789



to top

>emb|BX294662.13| Zebrafish DNA sequence from clone DKEYP-117E6 in linkage group 20,
            complete sequence
          Length = 154558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 166  acacatgaacacacatgaaacatg 189
            |||||||||| |||||||||||||
Sbjct: 5955 acacatgaactcacatgaaacatg 5932



to top

>emb|AL928920.5| Zebrafish DNA sequence from clone DKEY-14A7 in linkage group 20, complete
              sequence
          Length = 195351

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 161    cactgacacatgaacacaca 180
              ||||||||||||||||||||
Sbjct: 175547 cactgacacatgaacacaca 175566



to top

>gb|AY103625.1| Zea mays PCO091587 mRNA sequence
          Length = 1085

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 291 gccatgaccttcttgccgtt 310
           ||||||||||||||||||||
Sbjct: 403 gccatgaccttcttgccgtt 384



to top

>emb|AL117193.2|CEY105C5A Caenorhabditis elegans YAC Y105C5A, complete sequence
          Length = 314838

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 85     tatattcagaaatttagata 104
              ||||||||||||||||||||
Sbjct: 208317 tatattcagaaatttagata 208298



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 85     tatattcagaaatttagata 104
              ||||||||||||||||||||
Sbjct: 205497 tatattcagaaatttagata 205478



to top

>gb|AE003724.3| Drosophila melanogaster chromosome 3R, section 62 of 118 of the
             complete sequence
          Length = 232330

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 38    aagaaacatataaattacatatag 61
             ||||||||||||||||| ||||||
Sbjct: 38603 aagaaacatataaattagatatag 38580



to top

>dbj|AP000824.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-678L3, complete
              sequence
          Length = 186915

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 152    gttgggaaacactgacacat 171
              ||||||||||||||||||||
Sbjct: 181692 gttgggaaacactgacacat 181673



to top

>dbj|AP005130.4| Homo sapiens genomic DNA, chromosome 18 clone:RP11-168H23, complete
              sequence
          Length = 181276

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 159    aacactgacacatgaacaca 178
              ||||||||||||||||||||
Sbjct: 158083 aacactgacacatgaacaca 158102



to top

>gb|AC109314.8| Homo sapiens chromosome 18, clone CTD-3135I6, complete sequence
          Length = 221501

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 40    gaaacatataaattacatatagctggatacat 71
             |||||||||||| |||||||| ||| ||||||
Sbjct: 30094 gaaacatataaactacatatatctgtatacat 30125



to top

>emb|AL031770.12|HS20B11 Human DNA sequence from clone RP1-20B11 on chromosome 6p25.1-25.3,
              complete sequence
          Length = 140385

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 368    ctgctgctccctcatcttgc 387
              ||||||||||||||||||||
Sbjct: 106781 ctgctgctccctcatcttgc 106800



to top

>gb|M12896.1|DROOPSAA D.melanogaster opsin gene Rh2, complete cds
          Length = 1893

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 38   aagaaacatataaattacatatag 61
            ||||||||||||||||| ||||||
Sbjct: 1331 aagaaacatataaattagatatag 1308


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,319,861
Number of Sequences: 3902068
Number of extensions: 3319861
Number of successful extensions: 71495
Number of sequences better than 10.0: 69
Number of HSP's better than 10.0 without gapping: 69
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 71280
Number of HSP's gapped (non-prelim): 214
length of query: 393
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 371
effective length of database: 17,147,199,772
effective search space: 6361611115412
effective search space used: 6361611115412
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top