Clone Information

BLAST Search Result

Clone Name	rbart41d05
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|AC022144.8\| Homo sapiens chromosome 19 clone CTD-2540F13, com...	52	0.002
2	gb\|AC022120.7\| Homo sapiens chromosome 5 clone CTC-570I13, compl...	52	0.002
3	gb\|AC146106.3\| Pan troglodytes BAC clone RP43-5I17 from 7, compl...	46	0.12
4	gb\|DP000012.1\| Macropus eugenii target 1 genomic scaffold	46	0.12
5	gb\|AC117411.3\| Homo sapiens 3 BAC RP11-55O2 (Roswell Park Cancer...	46	0.12
6	gb\|AC093916.2\| Homo sapiens BAC clone RP11-789C2 from 4, complet...	46	0.12
7	gb\|AC091895.2\| Homo sapiens chromosome 5 clone RP11-143A12, comp...	46	0.12
8	gb\|AC021088.5\| Homo sapiens chromosome 5 clone CTD-2144A5, compl...	46	0.12
9	gb\|AC152506.2\| Pan troglodytes BAC clone RP43-4B9 from chromosom...	46	0.12
10	gb\|AC010140.3\|AC010140 Homo sapiens BAC clone RP11-218E11 from Y...	46	0.12
11	gb\|AC147533.3\| Macropus eugenii clone ME_KBa-311C4, complete seq...	46	0.12
12	ref\|XM_530240.1\| PREDICTED: Pan troglodytes LOC457850 (LOC457850...	44	0.46
13	gb\|AC185978.2\| Pan troglodytes BAC clone CH251-508B17 from chrom...	44	0.46
14	gb\|AC146259.4\| Pan troglodytes BAC clone RP43-28H17 from 7, comp...	44	0.46
15	gb\|AC147382.3\| Pan troglodytes BAC clone RP43-171M24 from 7, com...	44	0.46
16	gb\|AC146098.3\| Pan troglodytes BAC clone RP43-51J12 from 7, comp...	44	0.46
17	gb\|AC146088.2\| Pan troglodytes BAC clone RP43-46I21 from 7, comp...	44	0.46
18	gb\|AF235103.5\| Homo sapiens chromosome 8 multiple clones map q24...	44	0.46
19	gb\|AC007237.3\| Homo sapiens PAC clone RP5-911M23 from 7, complet...	44	0.46
20	gb\|AC004925.1\| Homo sapiens PAC clone RP5-907C10 from 7, complet...	44	0.46
21	gb\|AC006322.2\| Homo sapiens PAC clone RP5-1060B11 from 7, comple...	44	0.46
22	gb\|AC147024.2\| Pan troglodytes BAC clone RP43-89L5 from 7, compl...	44	0.46
23	gb\|AC005748.10\| Homo sapiens X BAC GS1-293I18 (Genome Systems Hu...	44	0.46
24	gb\|AC104964.12\| Homo sapiens chromosome 8, clone RP11-981G7, com...	44	0.46
25	gb\|AC134099.2\| Homo sapiens 3 BAC RP11-221B6 (Roswell Park Cance...	44	0.46
26	gb\|AC107399.6\| Homo sapiens BAC clone RP11-755N14 from 4, comple...	44	0.46
27	gb\|AC004456.1\| Homo sapiens PAC clone RP5-1100F23 from 7, comple...	44	0.46
28	gb\|AC003078.1\| Homo sapiens BAC clone GS1-117O10 from 7, complet...	44	0.46
29	gb\|AC096752.4\| Homo sapiens BAC clone RP11-454E2 from 7, complet...	44	0.46
30	gb\|AC005090.2\| Homo sapiens BAC clone CTA-315L10 from 7, complet...	44	0.46
31	gb\|AC005024.2\| Homo sapiens BAC clone GS1-438P6 from 7, complete...	44	0.46
32	gb\|AC004875.2\| Homo sapiens PAC clone RP4-745K6 from 7, complete...	44	0.46
33	emb\|Z82210.2\|HS431C21 Human DNA sequence from clone RP3-431C21 o...	44	0.46
34	emb\|AL807246.11\| Human DNA sequence from clone RP11-461H3 on chr...	44	0.46
35	emb\|AL954680.5\| Human DNA sequence from clone RP4-803E15 on chro...	44	0.46
36	emb\|AL627427.11\| Human DNA sequence from clone RP11-350G11 on ch...	44	0.46
37	emb\|AL606527.6\| Human DNA sequence from clone RP11-454G24 on chr...	44	0.46
38	emb\|AL591502.10\| Human DNA sequence from clone RP11-199C17 on ch...	44	0.46
39	emb\|AL592104.6\| Human DNA sequence from clone RP11-428K13 on chr...	44	0.46
40	emb\|AL592067.4\| Human DNA sequence from clone RP11-361H7 on chro...	44	0.46
41	emb\|AL590394.7\| Human DNA sequence from clone RP11-435I7 on chro...	44	0.46
42	emb\|AL591030.6\| Human DNA sequence from clone RP11-35J1 on chrom...	44	0.46
43	emb\|AL589904.2\| Human DNA sequence from clone RP11-115B7 on chro...	44	0.46
44	emb\|AL513547.16\| Human DNA sequence from clone RP11-160E12 on ch...	44	0.46
45	emb\|AL513479.12\| Human DNA sequence from clone RP11-329N22 on ch...	44	0.46
46	emb\|AL512303.10\| Human DNA sequence from clone RP1-249I4 on chro...	44	0.46
47	emb\|AL512446.8\| Human DNA sequence from clone RP11-268K9 on chro...	44	0.46
48	emb\|AL513243.1\| Human DNA sequence from clone RP11-453F18 on chr...	44	0.46
49	emb\|AL392088.12\| Human DNA sequence from clone RP5-964H19 on chr...	44	0.46
50	emb\|AL445591.10\| Human DNA sequence from clone RP11-314N2 on chr...	44	0.46
51	emb\|AL391838.9\| Human DNA sequence from clone RP11-307O11 on chr...	44	0.46
52	emb\|AL360011.19\| Human DNA sequence from clone RP11-103A2 on chr...	44	0.46
53	emb\|AL365189.15\| Human DNA sequence from clone RP11-595C20 on ch...	44	0.46
54	emb\|AL359919.11\| Human DNA sequence from clone RP11-15K3 on chro...	44	0.46
55	emb\|AL390758.6\| Human DNA sequence from clone RP11-540C21 on chr...	44	0.46
56	emb\|AL359764.18\| Human DNA sequence from clone RP11-527D7 on chr...	44	0.46
57	emb\|AL359703.13\| Human DNA sequence from clone RP11-389N12 on ch...	44	0.46
58	emb\|AL357149.13\| Human DNA sequence from clone RP11-352E13 on ch...	44	0.46
59	emb\|AL359746.8\| Human DNA sequence from clone RP11-315G12 on chr...	44	0.46
60	emb\|AL358533.6\| Human DNA sequence from clone RP11-456F13 on chr...	44	0.46
61	emb\|AL355506.23\| Human DNA sequence from clone RP3-366M24 on chr...	44	0.46
62	emb\|AL355601.19\| Human DNA sequence from clone RP11-445L6 on chr...	44	0.46
63	emb\|AL356356.17\| Human DNA sequence from clone RP11-54A4 on chro...	44	0.46
64	emb\|AL355375.17\| Human DNA sequence from clone RP11-448N11 on ch...	44	0.46
65	emb\|AL354682.22\| Human DNA sequence from clone RP11-282L14 on ch...	44	0.46
66	emb\|AL353801.13\| Human DNA sequence from clone RP11-285G1 on chr...	44	0.46
67	emb\|AL354810.8\| Human DNA sequence from clone RP11-527N12 on chr...	44	0.46
68	emb\|AL158053.14\| Human DNA sequence from clone RP11-156J23 on ch...	44	0.46
69	emb\|AL161637.13\| Human DNA sequence from clone RP3-393B19 on chr...	44	0.46
70	gb\|AC044849.12\| Homo sapiens chromosome 8, clone RP11-489E7, com...	44	0.46
71	emb\|AL137122.8\| Human DNA sequence from clone RP1-119J15 on chro...	44	0.46
72	emb\|AL136136.7\| Human DNA sequence from clone RP11-141E20 on chr...	44	0.46
73	emb\|AL133257.17\| Human DNA sequence from clone RP1-166D18 on chr...	44	0.46
74	emb\|AL050348.21\|HSDJ447F3 Human DNA sequence from clone RP3-447F...	44	0.46
75	emb\|AL109659.20\|HSJ1024N4 Human DNA sequence from clone RP5-1024...	44	0.46
76	emb\|AL049643.12\|HSJ672M15 Human DNA sequence from clone RP4-672M...	44	0.46
77	emb\|AL031183.4\|HS1168A5 Human DNA sequence from clone RP5-1168A5...	44	0.46
78	emb\|AL009031.1\|HS467D16 Human DNA sequence from clone RP3-467D16...	44	0.46
79	emb\|AJ289711.1\|HSA289711 Human endogenous retrovirus H HERV-H/en...	44	0.46
80	gb\|AC130509.6\| Homo sapiens 3 BAC RP11-429M9 (Roswell Park Cance...	44	0.46
81	gb\|AC112770.4\| Homo sapiens 3 BAC RP11-686L6 (Roswell Park Cance...	44	0.46
82	gb\|AC139103.3\| Homo sapiens chromosome 8, clone, complete sequence	44	0.46
83	gb\|AC104308.3\| Homo sapiens chromosome 3 clone RP11-544F21, comp...	44	0.46
84	gb\|AC105449.8\| Homo sapiens chromosome 8, clone RP11-152B5, comp...	44	0.46
85	emb\|AL954247.2\| Pan troglodytes chromosome 22 clone CH251-479I13...	44	0.46
86	gb\|AC069435.19\| Homo sapiens 3 BAC RP11-384L1 (Roswell Park Canc...	44	0.46
87	gb\|AC009318.11\| Homo sapiens 12p BAC RP11-996F15 (Roswell Park C...	44	0.46
88	gb\|AC009635.5\| Homo sapiens chromosome 8, clone RP11-21J9, compl...	44	0.46
89	gb\|AC148832.5\| Pan troglodytes BAC clone CH251-48K6 from chromos...	44	0.46
90	gb\|AC011476.8\| Homo sapiens chromosome 19 clone CTC-550B14, comp...	44	0.46
91	gb\|AC015802.21\| Homo sapiens chromosome 17, clone RP11-666A8, co...	44	0.46
92	gb\|AC093298.3\| Homo sapiens chromosome 5 clone RP11-543L14, comp...	44	0.46
93	gb\|AC016044.11\| Homo sapiens chromosome 15 clone RP11-209K10 map...	44	0.46
94	gb\|AC026101.24\| Homo sapiens 3 BAC RP11-441D23 (Roswell Park Can...	44	0.46
95	gb\|AC010618.9\| Homo sapiens chromosome 19 clone CTD-3131K8, comp...	44	0.46
96	gb\|AC008761.8\| Homo sapiens chromosome 19 clone CTD-3149D2, comp...	44	0.46
97	gb\|AC022276.35\| Homo sapiens 12 BAC RP11-161A14 (Roswell Park Ca...	44	0.46
98	gb\|AC117476.6\| Homo sapiens 3 BAC RP11-726H11 (Roswell Park Canc...	44	0.46
99	emb\|CR626911.1\| Human DNA sequence from clone XX-NCIH2171_16G22,...	44	0.46
100	gb\|AC099842.2\| Homo sapiens chromosome 11, clone RP11-747E23, co...	44	0.46
101	gb\|AC183387.3\| Pan troglodytes BAC clone CH251-113M12 from chrom...	44	0.46
102	gb\|AC107074.5\| Homo sapiens BAC clone RP11-424M21 from 4, comple...	44	0.46
103	gb\|AC124148.15\| Pan troglodytes clone rp43-71k6, complete sequence	44	0.46
104	gb\|AC114969.2\| Homo sapiens chromosome 5 clone RP11-356D23, comp...	44	0.46
105	gb\|AC067718.20\| Homo sapiens 3 BAC RP11-198M8 (Roswell Park Canc...	44	0.46
106	gb\|AC104333.2\| Homo sapiens chromosome 1 clone RP11-348H3, compl...	44	0.46
107	gb\|AC104441.2\| Homo sapiens chromosome 3 clone RP11-901H12, comp...	44	0.46
108	gb\|AC112505.5\| Homo sapiens 3 BAC RP11-282M5 (Roswell Park Cance...	44	0.46
109	gb\|AC025465.5\| Homo sapiens chromosome 5 clone CTD-2308B18, comp...	44	0.46
110	gb\|AC013242.8\| Homo sapiens chromosome 10 clone RP11-315E23, com...	44	0.46
111	gb\|AC006509.15\| Homo sapiens 2p16 PAC RPCI5-960D23 (Roswell Park...	44	0.46
112	gb\|AC148829.3\| Pan troglodytes BAC clone CH251-483L24 from chrom...	44	0.46
113	gb\|AC007537.3\| Homo sapiens 12 BAC RPCI11-267J23 (Roswell Park C...	44	0.46
114	gb\|AC011124.9\| Homo sapiens chromosome 8, clone RP11-45K10, comp...	44	0.46
115	gb\|AC093431.2\| Homo sapiens chromosome 1 clone RP11-574N2, compl...	44	0.46
116	gb\|AC020980.6\| Homo sapiens chromosome 5 clone RPCI-1_167G20, co...	44	0.46
117	gb\|AC069306.6\| Homo sapiens BAC clone RP11-654F3 from 4, complet...	44	0.46
118	gb\|AC104444.2\| Homo sapiens chromosome 3 clone RP11-420K5, compl...	44	0.46
119	gb\|AC112654.2\| Homo sapiens X BAC RP11-44F2 (Roswell Park Cancer...	44	0.46
120	gb\|AC091814.10\| Homo sapiens 12p BAC RP11-290C10 (Roswell Park C...	44	0.46
121	gb\|AC079824.25\| Homo sapiens Xp BAC RP11-750F16 (Roswell Park Ca...	44	0.46
122	gb\|AC098976.2\| Homo sapiens BAC clone RP11-751L19 from 4, comple...	44	0.46
123	gb\|AC096763.2\| Homo sapiens BAC clone RP11-625A6 from 4, complet...	44	0.46
124	gb\|AC021118.6\| Homo sapiens BAC clone RP11-332D24 from 4, comple...	44	0.46
125	gb\|AC022960.13\| Homo sapiens chromosome 18, clone RP11-210K20, c...	44	0.46
126	gb\|AC096536.2\| Homo sapiens chromosome 1 clone RP11-67L3, comple...	44	0.46
127	gb\|AC025480.7\| Homo sapiens chromosome 18, clone RP11-12N19, com...	44	0.46
128	gb\|AC027506.12\| Homo sapiens chromosome 18, clone RP11-762J3, co...	44	0.46
129	gb\|AC091894.2\| Homo sapiens chromosome 5 clone RP11-138J23, comp...	44	0.46
130	gb\|AC022140.6\| Homo sapiens chromosome 5 clone CTD-2306M5, compl...	44	0.46
131	gb\|AC078850.5\| Homo sapiens BAC clone RP11-184M15 from 4, comple...	44	0.46
132	gb\|AC020701.8\| Homo sapiens BAC clone RP11-200K10 from 4, comple...	44	0.46
133	gb\|AC091577.9\| Homo sapiens chromosome 18, clone RP11-704J2, com...	44	0.46
134	gb\|AC093581.2\| Homo sapiens chromosome 1 clone RP11-22M7, comple...	44	0.46
135	gb\|AC012410.10\| Homo sapiens chromosome 8, clone RP11-354A3, com...	44	0.46
136	ref\|XM_944391.1\| PREDICTED: Homo sapiens hypothetical LOC388755 ...	44	0.46
137	ref\|XM_373896.3\| PREDICTED: Homo sapiens hypothetical LOC388755 ...	44	0.46
138	gb\|AC158242.4\| Pan troglodytes BAC clone CH251-354C10 from chrom...	44	0.46
139	gb\|AC010506.7\| Homo sapiens chromosome 19 clone LLNLF-128A4, com...	44	0.46
140	gb\|AC027017.5\| Homo sapiens chromosome 8, clone RP11-450M17, com...	44	0.46
141	gb\|AC023307.9\| Homo sapiens chromosome 15, clone RP11-327M11, co...	44	0.46
142	gb\|AC008872.6\| Homo sapiens chromosome 5 clone CTD-2198D21, comp...	44	0.46
143	gb\|AC016879.6\| Homo sapiens chromosome 8, clone RP11-97P19, comp...	44	0.46
144	gb\|AC020784.8\| Homo sapiens chromosome 8, clone RP11-82I19, comp...	44	0.46
145	gb\|AC128690.5\| Homo sapiens 3 BAC RP11-399P20 (Roswell Park Canc...	44	0.46
146	gb\|AC008514.8\| Homo sapiens chromosome 5 clone CTC-455F18, compl...	44	0.46
147	gb\|AC163760.3\| Pan troglodytes BAC clone CH251-180O13 from chrom...	44	0.46
148	gb\|AC060788.11\| Homo sapiens chromosome 8, clone CTD-2008O4, com...	44	0.46
149	gb\|AC026742.3\| Homo sapiens chromosome 5 clone CTD-3103E19, comp...	44	0.46
150	gb\|AC090044.3\| Homo sapiens chromosome 3 clone RP11-86C13 map 3p...	44	0.46
151	gb\|AC011811.42\| Homo sapiens clone b250a12, complete sequence	44	0.46
152	gb\|AF212831.2\|AF212831 Homo sapiens chromosome 21 clone BAC R-45...	44	0.46
153	gb\|AF130359.3\|AF130359 Homo sapiens chromosome 21 clone PAC K156...	44	0.46
154	gb\|AC016080.5\|AC016080 Homo sapiens, clone RP11-23N14, complete ...	44	0.46
155	gb\|AC161475.6\| Pan troglodytes BAC clone CH251-252J1 from chromo...	44	0.46
156	gb\|AC015963.8\|AC015963 Homo sapiens chromosome , clone RP11-112B...	44	0.46
157	gb\|AC024164.6\|AC024164 Homo sapiens chromosome 3 clone RP11-350A...	44	0.46
158	gb\|AC068339.6\| Homo sapiens chromosome 11, clone RP11-328E22, co...	44	0.46
159	gb\|AF165423.6\| Homo sapiens chromosome 3 clone CTB-402G2 map q, ...	44	0.46
160	gb\|AC141554.5\| Homo sapiens 12 BAC RP11-488P21 (Roswell Park Can...	44	0.46
161	gb\|AC143342.3\| Homo sapiens fosmid clone XXFOS-84029D6 from 4, c...	44	0.46
162	gb\|AC092834.3\| Homo sapiens BAC clone RP13-497K6 from 4, complet...	44	0.46
163	gb\|AC093722.2\| Homo sapiens BAC clone CTD-2012I17 from 4, comple...	44	0.46
164	gb\|AC084866.5\| Homo sapiens BAC clone RP11-6E9 from 4, complete ...	44	0.46
165	gb\|AC074378.4\| Homo sapiens BAC clone RP11-4I17 from 4, complete...	44	0.46
166	gb\|AC096651.1\| Homo sapiens BAC clone RP11-16J15 from 4, complet...	44	0.46
167	gb\|AC114741.3\| Homo sapiens BAC clone RP11-62N21 from 4, complet...	44	0.46
168	gb\|AC104686.2\| Homo sapiens BAC clone RP11-74M11 from 4, complet...	44	0.46
169	gb\|AC119070.3\| Homo sapiens BAC clone RP11-164M13 from 4, comple...	44	0.46
170	gb\|AC011754.8\| Homo sapiens BAC clone RP11-546P22 from 2, comple...	44	0.46
171	gb\|AC104634.5\| Homo sapiens BAC clone RP11-793L24 from 2, comple...	44	0.46
172	gb\|AC062039.3\| Homo sapiens BAC clone RP11-814A15 from 2, comple...	44	0.46
173	gb\|AC104667.5\| Homo sapiens BAC clone RP11-810D14 from 2, comple...	44	0.46
174	gb\|AC147289.3\| Pan troglodytes BAC clone RP43-75A12 from chromos...	44	0.46
175	gb\|AC146091.2\| Pan troglodytes BAC clone RP43-47P19 from chromos...	44	0.46
176	gb\|AC146178.2\| Pan troglodytes BAC clone RP43-35P14 from chromos...	44	0.46
177	gb\|AF315100.1\|AF315100 Homo sapiens isolate HERV-H-MP20 long ter...	44	0.46
178	gb\|AC018648.5\|AC018648 Homo sapiens chromosome 7 clone RP11-265E...	44	0.46
179	gb\|AC068716.8\|AC068716 Homo sapiens chromosome 15 clone RP11-6L1...	44	0.46
180	gb\|AC083906.23\| Homo sapiens 3 BAC RP11-93K22 (Roswell Park Canc...	44	0.46
181	gb\|AC092490.10\| Homo sapiens 12 BAC RP11-20D14 (Roswell Park Can...	44	0.46
182	gb\|AC134507.2\| Homo sapiens 3 BAC RP11-674K24 (Roswell Park Canc...	44	0.46
183	gb\|AC009229.5\| Homo sapiens BAC clone RP11-314C9 from 2, complet...	44	0.46
184	gb\|AC007250.2\| Homo sapiens BAC clone RP11-334G22 from 2, comple...	44	0.46
185	gb\|AC021849.5\| Homo sapiens BAC clone RP11-366G5 from 2, complet...	44	0.46
186	gb\|AC008072.3\| Homo sapiens BAC clone RP11-408N22 from 2, comple...	44	0.46
187	gb\|AC104802.4\| Homo sapiens BAC clone RP11-456I21 from 2, comple...	44	0.46
188	gb\|AC013445.8\| Homo sapiens BAC clone RP11-489J10 from 2, comple...	44	0.46
189	gb\|AC139453.10\| Homo sapiens 3 BAC RP11-803B1 (Roswell Park Canc...	44	0.46
190	gb\|AC140484.1\| Homo sapiens BAC clone RP11-806A6 from 4, complet...	44	0.46
191	gb\|AF042089.1\|AF042089 Homo sapiens chromosome 3, olfactory rece...	44	0.46
192	gb\|AC139705.4\| Homo sapiens X BAC RP11-102M2 (Roswell Park Cance...	44	0.46
193	gb\|AC066598.5\|AC066598 Homo sapiens chromosome 3 clone RP11-542K...	44	0.46
194	gb\|AC093633.3\| Homo sapiens BAC clone RP11-157M22 from 2, comple...	44	0.46
195	gb\|AC060812.15\| Homo sapiens chromosome 11, clone RP11-120E20, c...	44	0.46
196	gb\|AC092150.4\| Homo sapiens BAC clone RP11-109J11 from 2, comple...	44	0.46
197	gb\|AC068195.6\| Homo sapiens BAC clone RP11-114B24 from 2, comple...	44	0.46
198	gb\|AC016697.8\| Homo sapiens BAC clone RP11-140C4 from 2, complet...	44	0.46
199	gb\|AC078883.6\| Homo sapiens BAC clone RP11-227L6 from 2, complet...	44	0.46
200	gb\|AC109925.4\| Homo sapiens BAC clone RP11-398J16 from 4, comple...	44	0.46
201	gb\|AC138089.2\| Homo sapiens chromosome 1 clone RP11-407H12, comp...	44	0.46
202	gb\|AC026316.16\| Homo sapiens 3 BAC RP11-373E16 (Roswell Park Can...	44	0.46
203	gb\|AC105029.7\| Homo sapiens chromosome 8, clone CTD-2210A23, com...	44	0.46
204	gb\|AC026950.15\| Homo sapiens chromosome 8, clone RP11-555E9, com...	44	0.46
205	gb\|AC072023.9\| Homo sapiens 3 BAC RP11-3J2 (Roswell Park Cancer ...	44	0.46
206	gb\|AC008062.3\| Homo sapiens BAC clone RP11-68L6 from 2, complete...	44	0.46
207	gb\|AC017004.4\| Homo sapiens BAC clone RP11-88C6 from 2, complete...	44	0.46
208	gb\|AC093496.2\| Homo sapiens chromosome 3 clone RP11-536I6 map 3p...	44	0.46
209	gb\|AC064878.9\|AC064878 Homo sapiens chromosome 6 clone RP11-13I1...	44	0.46
210	gb\|AC104257.12\| Homo sapiens chromosome 8, clone CTD-2501M5, com...	44	0.46
211	gb\|AC099066.3\| Homo sapiens chromosome 1 clone RP11-145A3, compl...	44	0.46
212	gb\|AC092058.3\| Homo sapiens chromosome 3 clone RP11-667E17, comp...	44	0.46
213	gb\|AC073895.22\| Homo sapiens 3 BAC RP11-622L21 (Roswell Park Can...	44	0.46
214	gb\|AC122683.4\| Homo sapiens 3 RP11-528N21 (Roswell Park Cancer I...	44	0.46
215	gb\|AC129505.8\| Homo sapiens chromosome 11, clone RP11-1205H24, c...	44	0.46
216	gb\|AC123788.7\| Homo sapiens chromosome 11, clone RP5-1173A5, com...	44	0.46
217	gb\|AC091951.3\| Homo sapiens chromosome 5 clone RP11-404K5, compl...	44	0.46
218	gb\|AC092573.2\| Homo sapiens BAC clone RP11-1O7 from 2, complete ...	44	0.46
219	gb\|AC113377.2\| Homo sapiens chromosome 5 clone RP11-26N10, compl...	44	0.46
220	dbj\|BS000031.1\| Pan troglodytes chromosome 22 clone:PTB-082B23, ...	44	0.46
221	gb\|AC004025.1\|AC004025 Homo sapiens Xp22 BAC GS-321G17 (Genome S...	44	0.46
222	gb\|AC004817.2\|AC004817 Homo sapiens PAC clone RP6-91H8 from 14q2...	44	0.46
223	emb\|AL163213.2\|HS21C013 Homo sapiens chromosome 21 segment HS21C013	44	0.46
224	gb\|AC007870.3\|AC007870 Genomic sequence for Homo sapiens clone 4...	44	0.46
225	emb\|AL162471.3\|CNS01RHU Human chromosome 14 DNA sequence Partial...	44	0.46
226	gb\|AC005150.2\|AC005150 Homo sapiens chromosome 4 clone B55B24 ma...	44	0.46
227	emb\|AL356804.4\|CNS05TDM Human chromosome 14 DNA sequence BAC R-7...	44	0.46
228	dbj\|AP000943.5\| Homo sapiens genomic DNA, chromosome 11 clone:RP...	44	0.46
229	dbj\|AP002376.4\| Homo sapiens genomic DNA, chromosome 11 clone:RP...	44	0.46
230	gb\|AC006539.1\|AC006539 Homo sapiens chromosome 19, BAC 39498 (CI...	44	0.46
231	emb\|AL159140.4\|CNS01RGP Human chromosome 14 DNA sequence BAC R-1...	44	0.46
232	dbj\|AP003716.4\| Homo sapiens genomic DNA, chromosome 11 clone:RP...	44	0.46
233	dbj\|AP006292.2\| Homo sapiens genomic DNA, chromosome 9 clone:RP1...	44	0.46
234	dbj\|AP001695.1\| Homo sapiens genomic DNA, chromosome 21q, sectio...	44	0.46
235	dbj\|AP006294.1\| Homo sapiens genomic DNA, chromosome 11 clone:CT...	44	0.46
236	dbj\|AP002346.3\| Homo sapiens genomic DNA, chromosome 11q clone:C...	44	0.46
237	dbj\|AP003395.1\| Homo sapiens genomic DNA, chromosome 11q clone:R...	44	0.46
238	dbj\|AP003393.1\| Homo sapiens genomic DNA, chromosome 11q clone:R...	44	0.46
239	dbj\|AP002954.1\| Homo sapiens genomic DNA, chromosome 11q, clons:...	44	0.46
240	dbj\|AP000879.4\| Homo sapiens genomic DNA, chromosome 11q, clone:...	44	0.46
241	dbj\|AP000941.6\| Homo sapiens genomic DNA, chromosome 11 clone:RP...	44	0.46
242	dbj\|AP002762.4\| Homo sapiens genomic DNA, chromosome 11 clone:RP...	44	0.46
243	dbj\|AP005976.2\| Homo sapiens genomic DNA, chromosome 8qtel, clon...	44	0.46
244	gb\|AC005837.1\|AC005837 Homo sapiens chromosome 17, clone hRPK.31...	44	0.46
245	emb\|AL450303.10\| Human DNA sequence from clone RP11-245D2 on chr...	44	0.46
246	gb\|U95997.1\|HSU95997 Homo sapiens endogenous retrovirus-H family...	44	0.46
247	gb\|AC000378.1\|AC000378 Human Chromosome 11 pac pDJ1173a5, comple...	44	0.46
248	gb\|AC002326.1\|AC002326 Genomic sequence from Human 6, complete s...	44	0.46
249	emb\|AL133224.4\|CNS01DU9 Human chromosome 14 DNA sequence BAC R-1...	44	0.46
250	emb\|AL109967.2\|HS22F01 Homo sapiens chromosome 21 PAC LLNCO21F01...	44	0.46
251	emb\|AL512311.3\|CNS07EF2 Human chromosome 14 DNA sequence BAC R-3...	44	0.46
252	emb\|AL137062.13\| Human DNA sequence from clone RP11-198M22 on ch...	44	0.46
253	emb\|AL603885.17\| Human DNA sequence from clone RP11-722N5 on chr...	44	0.46
254	emb\|AJ291363.1\|OEN291363 Orangutan endogenous retrovirus partial...	44	0.46
255	emb\|AJ291362.1\|OEN291362 Orangutan endogenous retrovirus partial...	44	0.46
256	emb\|AJ291359.1\|GEN291359 Gorilla endogenous retrovirus partial p...	44	0.46
257	emb\|AJ291358.1\|GEN291358 Gorilla endogenous retrovirus partial p...	44	0.46
258	gb\|AC018832.5\| Homo sapiens chromosome 3 clone RP11-481O7 map 3p...	44	0.46
259	gb\|AC087589.3\| Homo sapiens chromosome 3 clone RP11-1102N22 map ...	44	0.46
260	gb\|K01891.1\|HUMHBB31 Human beta globin retrovirus-like repetitiv...	44	0.46
261	gb\|AC133110.2\| Homo sapiens BAC clone RP11-761N10 from 4, comple...	44	0.46
262	dbj\|AP000230.2\| Homo sapiens genomic DNA, chromosome 21q21.1-q21...	44	0.46
263	dbj\|AP000144.1\| Homo sapiens genomic DNA, chromosome 21q21.2, LL...	44	0.46
264	dbj\|AP002078.3\| Homo sapiens genomic DNA, chromosome 4q22-q24, c...	44	0.46
265	dbj\|AP001595.1\| Homo sapiens genomic DNA, chromosome 21, clone:K...	44	0.46
266	dbj\|AP003385.2\| Homo sapiens genomic DNA, chromosome 11q clone:R...	44	0.46
267	dbj\|AP001788.5\| Homo sapiens genomic DNA, chromosome 11q, clone:...	44	0.46
268	ref\|XM_640477.1\| Dictyostelium discoideum putative polyketide sy...	42	1.8
269	ref\|XM_640474.1\| Dictyostelium discoideum hypothetical protein (...	42	1.8
270	ref\|XM_640467.1\| Dictyostelium discoideum hypothetical protein (...	42	1.8
271	gb\|AF411059.1\| Homo sapiens clone BAC_22608 inducible T-cell co-...	42	1.8
272	emb\|CR956355.2\| Pan troglodytes chromosome X BAC RP43-051D20, co...	42	1.8
273	gb\|AC119733.2\| Homo sapiens 3 RP11-159G9 (Roswell Park Cancer In...	42	1.8
274	emb\|Z99495.1\|HS441J1 Human DNA sequence from clone RP3-441J1 on ...	42	1.8
275	emb\|AL732437.12\| Human DNA sequence from clone RP11-116G8 on chr...	42	1.8
276	emb\|AL589923.11\| Human DNA sequence from clone RP11-374O2 on chr...	42	1.8
277	emb\|AL358972.13\| Human DNA sequence from clone RP11-347L18 on ch...	42	1.8
278	emb\|AL355596.21\| Human DNA sequence from clone RP11-63E9 on chro...	42	1.8
279	emb\|AL355581.14\| Human DNA sequence from clone RP11-73O6 on chro...	42	1.8
280	gb\|AC109927.4\| Homo sapiens BAC clone RP11-577B7 from 4, complet...	42	1.8
281	gb\|AC109352.3\| Homo sapiens BAC clone RP11-489P20 from 4, comple...	42	1.8
282	gb\|AC011328.11\| Homo sapiens chromosome 10 clone RP11-295O23, co...	42	1.8
283	gb\|AC099753.2\| Homo sapiens chromosome 3 clone RP11-466A13, comp...	42	1.8
284	gb\|AC090017.18\| Homo sapiens 12q BAC RP11-471N19 (Roswell Park C...	42	1.8
285	gb\|AC095063.2\| Homo sapiens BAC clone RP11-533K12 from 4, comple...	42	1.8
286	gb\|AC092631.1\| Homo sapiens BAC clone RP11-326P21 from 4, comple...	42	1.8
287	gb\|AC008916.7\| Homo sapiens chromosome 5 clone CTD-2271P9, compl...	42	1.8
288	ref\|NG_002400.1\| Homo sapiens piggyBac transposable element deri...	42	1.8
289	gb\|AC093759.3\| Homo sapiens BAC clone RP11-67M1 from 4, complete...	42	1.8
290	gb\|AC093522.4\| Homo sapiens chromosome 16 clone RP11-172I18, com...	42	1.8
291	gb\|AF289204.1\|AF289203S2 Homo sapiens odorant receptor HOR3'beta...	42	1.8
292	gb\|AC009965.9\| Homo sapiens BAC clone RP11-388A17 from 2, comple...	42	1.8
293	gb\|AC116982.2\| Dictyostelium discoideum chromosome 2 map 3622643...	42	1.8
294	gb\|AC023115.6\| Homo sapiens BAC clone RP11-269A16 from 2, comple...	42	1.8
295	gb\|AC008959.4\|AC008959 Homo sapiens chromosome 5 clone CTD-2354D...	42	1.8
296	emb\|BX247948.4\| Zebrafish DNA sequence from clone DKEY-34E4 in l...	42	1.8
297	emb\|AJ535718.1\|HSA535718 Homo sapiens partial ICOS gene for indu...	42	1.8
298	emb\|BX248103.7\| Zebrafish DNA sequence from clone CH211-226C13 i...	42	1.8
299	dbj\|BS000207.2\| Pan troglodytes chromosome 22 clone:PTB-155J22, ...	42	1.8
300	dbj\|AP000446.5\| Homo sapiens genomic DNA, chromosome 11q, clone:...	42	1.8
301	emb\|AL929590.15\| Zebrafish DNA sequence from clone DKEY-46K8 in ...	42	1.8
302	emb\|AL512358.2\|CNS07EF7 Human chromosome 14 DNA sequence BAC R-1...	42	1.8
303	gb\|K01892.1\|HUMHBB32 Human beta globin retrovirus-like repetitiv...	42	1.8
304	gb\|CP000025.1\| Campylobacter jejuni RM1221, complete genome	40	7.2
305	gb\|AC101743.5\| Mus musculus chromosome 1, clone RP23-278E1, comp...	40	7.2
306	gb\|AE017355.1\| Bacillus thuringiensis serovar konkukian str. 97-...	40	7.2
307	gb\|AC084800.5\| Mus musculus strain C57BL6/J chromosome 6 clone R...	40	7.2
308	gb\|AE017334.2\| Bacillus anthracis str. 'Ames Ancestor', complete...	40	7.2
309	gb\|AC183529.4\| Pan troglodytes BAC clone CH251-669H19 from chrom...	40	7.2
310	gb\|AE017225.1\| Bacillus anthracis str. Sterne, complete genome	40	7.2
311	gb\|AE006872.1\| Sulfolobus solfataricus P2 section 231 of 272 of ...	40	7.2
312	gb\|AC183269.3\| Pan troglodytes BAC clone CH251-685E7 from chromo...	40	7.2
313	gb\|AC163025.3\| Mus musculus chromosome 1, clone RP23-80N7, compl...	40	7.2
314	gb\|AY422197.1\| Campylobacter jejuni putative ABC-type transport ...	40	7.2
315	gb\|AF167344.2\| Campylobacter jejuni HS:19 lipooligosaccharide bi...	40	7.2
316	gb\|AC145132.2\| Homo sapiens chromosome 5 clone RP11-1113N2, comp...	40	7.2
317	gb\|AC130821.3\| Mus musculus BAC clone RP23-205K12 from chromosom...	40	7.2
318	gb\|AC124562.4\| Mus musculus BAC clone RP23-175B1 from 13, comple...	40	7.2
319	gb\|AC122887.2\| Mus musculus BAC clone RP23-91L6 from 10, complet...	40	7.2
320	gb\|AC121808.2\| Mus musculus BAC clone RP23-449M23 from 13, compl...	40	7.2
321	gb\|AC123043.2\| Mus musculus BAC clone RP24-547G7 from 13, comple...	40	7.2
322	gb\|AC145145.2\| Homo sapiens chromosome 5 clone RP11-14E21, compl...	40	7.2
323	gb\|CP000001.1\| Bacillus cereus E33L, complete genome	40	7.2
324	emb\|AL592212.8\| Human DNA sequence from clone RP11-116N2 on chro...	40	7.2
325	emb\|AL590666.8\| Human DNA sequence from clone RP11-66D17 on chro...	40	7.2
326	emb\|AL078604.10\|HSJ393E18 Human DNA sequence from clone RP3-393E...	40	7.2
327	emb\|CR382138.1\| Debaryomyces hansenii chromosome F of strain CBS...	40	7.2
328	emb\|AL645527.20\| Mouse DNA sequence from clone RP23-26L6 on chro...	40	7.2
329	emb\|AL139077.2\|CJ11168X4 Campylobacter jejuni subsp. jejuni NCTC...	40	7.2
330	gb\|AC156268.10\| Mus musculus 10 BAC RP24-336P23 (Roswell Park Ca...	40	7.2
331	gb\|BC041906.1\| Homo sapiens cDNA clone IMAGE:5299000	40	7.2
332	gb\|AC011353.5\| Homo sapiens chromosome 5 clone CTC-328A6, comple...	40	7.2
333	gb\|AC010156.6\| Drosophila melanogaster 3L NOVECTOR RP98-27H3 (Ro...	40	7.2
334	gb\|AC093223.3\| Homo sapiens chromosome 5 clone CTD-2220G6, compl...	40	7.2
335	gb\|AC104826.5\| Homo sapiens BAC clone RP11-775M3 from 4, complet...	40	7.2
336	gb\|AC015729.10\| Homo sapiens, clone RP11-1A20, complete sequence	40	7.2
337	gb\|AC012103.6\| Homo sapiens, clone RP11-44D19, complete sequence	40	7.2
338	dbj\|AK158363.1\| Mus musculus adult inner ear cDNA, RIKEN full-le...	40	7.2
339	gb\|AC160964.1\| Mus musculus BAC clone RP24-316G24 from chromosom...	40	7.2
340	gb\|AC090054.2\|AC090054 Oryza sativa chromosome 9 clone PAC0645D0...	40	7.2
341	gb\|AC148663.1\| Macaca mulatta Major Histocompatibility Complex B...	40	7.2
342	gb\|AC148661.1\| Macaca mulatta Major Histocompatibility Complex B...	40	7.2
343	gb\|AC018683.4\|AC018683 Homo sapiens BAC clone RP11-423P14 from 4...	40	7.2
344	dbj\|AP008215.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.2
345	gb\|AC146160.3\| Pan troglodytes BAC clone RP43-1E22 from chromoso...	40	7.2
346	dbj\|AB190773.1\| Mesembryanthemum crystallinum PTL1 mRNA for plas...	40	7.2
347	gb\|AC010092.4\| Homo sapiens BAC clone RP11-306M1 from 2, complet...	40	7.2
348	gb\|AC008555.5\|AC008555 Homo sapiens chromosome 19 clone CTC-523E...	40	7.2
349	dbj\|AP006727.2\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.2
350	dbj\|AP006527.3\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.2
351	dbj\|AP005725.4\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.2
352	gb\|AC003983.1\|AC003983 Human PAC clone RP1-93I3 from Xq23, compl...	40	7.2
353	emb\|AL512360.2\|CNS07EF9 Human chromosome 14 DNA sequence BAC R-7...	40	7.2
354	emb\|AL390816.4\|CNS06C7V Human chromosome 14 DNA sequence BAC R-3...	40	7.2
355	emb\|BX548009.4\| Zebrafish DNA sequence from clone CH211-237K17 i...	40	7.2
356	gb\|AY913983.1\| Hylaeus connectens isolate conMw_54 cytochrome ox...	40	7.2
357	gb\|AY913982.1\| Hylaeus connectens isolate conH_32 cytochrome oxi...	40	7.2
358	emb\|CT571245.12\| Mouse DNA sequence from clone RP23-2N7 on chrom...	40	7.2
359	gb\|AE003549.4\| Drosophila melanogaster chromosome 3L, section 36...	40	7.2
360	emb\|AJ550784.1\|PCA550784 Procavia capensis partial hspb3 gene fo...	40	7.2
361	gb\|AE016879.1\| Bacillus anthracis str. Ames, complete genome	40	7.2
362	gb\|AE017143.1\| Haemophilus ducreyi strain 35000HP complete genome	40	7.2
363	gb\|AE008384.1\| Methanosarcina mazei strain Goe1, complete genome	40	7.2
364	dbj\|AP006382.1\| Lotus japonicus genomic DNA, chromosome 4, clone...	40	7.2
365	gb\|AC155340.1\| Brassica rapa subsp. pekinensis chromosome Cytoge...	40	7.2
366	emb\|AL137538.1\|HSM802275 Homo sapiens mRNA; cDNA DKFZp434N2019 (...	40	7.2

>gb|AC022144.8| Homo sapiens chromosome 19 clone CTD-2540F13, complete sequence
          Length = 149271

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| ||||||||
Sbjct: 50261 cttaactgatgacattgtcttgtcaaattc 50232

to top

>gb|AC022120.7| Homo sapiens chromosome 5 clone CTC-570I13, complete sequence
          Length = 169513

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||||| ||||||
Sbjct: 91610 cttaactgatgacattgtcttctgaaattc 91581



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 85410 cttaactgatgacattgtcttgtgaaattc 85381

to top

>gb|AC146106.3| Pan troglodytes BAC clone RP43-5I17 from 7, complete sequence
          Length = 221821

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 475    tcttaactgatgacattgtcttctcaaattc 505
              |||||||||||||||||||||| | ||||||
Sbjct: 131019 tcttaactgatgacattgtcttgtgaaattc 131049

to top

>gb|DP000012.1| Macropus eugenii target 1 genomic scaffold
          Length = 1996640

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 49     tgatcacataatttcaacattat 71
              |||||||||||||||||||||||
Sbjct: 799829 tgatcacataatttcaacattat 799807

to top

>gb|AC117411.3| Homo sapiens 3 BAC RP11-55O2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 124524

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 475   tcttaactgatgacattgtcttctcaaattc 505
             |||||||||||||||||||||| | ||||||
Sbjct: 39369 tcttaactgatgacattgtcttgtgaaattc 39399

to top

>gb|AC093916.2| Homo sapiens BAC clone RP11-789C2 from 4, complete sequence
          Length = 162632

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 476   cttaactgatgacattgtcttct 498
             |||||||||||||||||||||||
Sbjct: 46232 cttaactgatgacattgtcttct 46254



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 51538 cttaactgatgacattgtcttgtgaaattc 51567

to top

>gb|AC091895.2| Homo sapiens chromosome 5 clone RP11-143A12, complete sequence
          Length = 127329

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                             
Query: 476    cttaactgatgacattgtcttctcaaattca 506
              ||||||||||||||||||||| | |||||||
Sbjct: 123970 cttaactgatgacattgtcttgtgaaattca 123940

to top

>gb|AC021088.5| Homo sapiens chromosome 5 clone CTD-2144A5, complete sequence
          Length = 106129

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 476   cttaactgatgacattgtcttctcaaattca 506
             ||||||||||||||||||||| | |||||||
Sbjct: 36191 cttaactgatgacattgtcttgtgaaattca 36161

to top

>gb|AC152506.2| Pan troglodytes BAC clone RP43-4B9 from chromosome 7, complete sequence
          Length = 181146

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 475   tcttaactgatgacattgtcttctcaaattc 505
             |||||||||||||||||||||| | ||||||
Sbjct: 94023 tcttaactgatgacattgtcttgtgaaattc 94053

to top

>gb|AC010140.3|AC010140 Homo sapiens BAC clone RP11-218E11 from Y, complete sequence
          Length = 148342

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 475   tcttaactgatgacattgtcttctcaaattc 505
             |||||||||||||||||||||| | ||||||
Sbjct: 51586 tcttaactgatgacattgtcttgtgaaattc 51616



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 56857 cttaactgatgacattgtcttgtgaaattc 56886

to top

>gb|AC147533.3| Macropus eugenii clone ME_KBa-311C4, complete sequence
          Length = 153357

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 49     tgatcacataatttcaacattat 71
              |||||||||||||||||||||||
Sbjct: 102835 tgatcacataatttcaacattat 102813

to top

>ref|XM_530240.1| PREDICTED: Pan troglodytes LOC457850 (LOC457850), mRNA
          Length = 1648

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 476  cttaactgatgacattgtcttctcaaattc 505
            ||||||||||||||||||||| | ||||||
Sbjct: 1419 cttaactgatgacattgtcttgtgaaattc 1448

to top

>gb|AC185978.2| Pan troglodytes BAC clone CH251-508B17 from chromosome 4, complete
             sequence
          Length = 198914

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 66994 cttaactgatgacattgtcttgtgaaattc 67023

to top

>gb|AC146259.4| Pan troglodytes BAC clone RP43-28H17 from 7, complete sequence
          Length = 156725

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 29937 cttaactgatgacattgtcttgtgaaattc 29966



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 23959 cttaactgatgacattgtcttgtgaaattc 23988

to top

>gb|AC147382.3| Pan troglodytes BAC clone RP43-171M24 from 7, complete sequence
          Length = 198872

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 152739 cttaactgatgacattgtcttgtgaaattc 152710

to top

>gb|AC146098.3| Pan troglodytes BAC clone RP43-51J12 from 7, complete sequence
          Length = 195811

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 18794 cttaactgatgacattgtcttgtgaaattc 18765

to top

>gb|AC146088.2| Pan troglodytes BAC clone RP43-46I21 from 7, complete sequence
          Length = 165433

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 154871 cttaactgatgacattgtcttgtgaaattc 154900

to top

>gb|AF235103.5| Homo sapiens chromosome 8 multiple clones map q24.3, complete sequence
          Length = 345524

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 262834 cttaactgatgacattgtcttgtgaaattc 262805



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 257155 cttaactgatgacattgtcttgtgaaattc 257126

to top

>gb|AC007237.3| Homo sapiens PAC clone RP5-911M23 from 7, complete sequence
          Length = 130815

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 109045 cttaactgatgacattgtcttgtgaaattc 109016

to top

>gb|AC004925.1| Homo sapiens PAC clone RP5-907C10 from 7, complete sequence
          Length = 154959

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 120526 cttaactgatgacattgtcttgtgaaattc 120497



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 115358 cttaactgatgacattgtcttgtgaaattc 115329

to top

>gb|AC006322.2| Homo sapiens PAC clone RP5-1060B11 from 7, complete sequence
          Length = 179640

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 165058 cttaactgatgacattgtcttgtgaaattc 165087

to top

>gb|AC147024.2| Pan troglodytes BAC clone RP43-89L5 from 7, complete sequence
          Length = 162174

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 143698 cttaactgatgacattgtcttgtgaaattc 143669



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 138489 cttaactgatgacattgtcttgtgaaattc 138460

to top

>gb|AC005748.10| Homo sapiens X BAC GS1-293I18 (Genome Systems Human BAC Library) complete
              sequence
          Length = 130615

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 101590 cttaactgatgacattgtcttgtgaaattc 101619

to top

>gb|AC104964.12| Homo sapiens chromosome 8, clone RP11-981G7, complete sequence
          Length = 212226

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 75326 cttaactgatgacattgtcttgtgaaattc 75297

to top

>gb|AC134099.2| Homo sapiens 3 BAC RP11-221B6 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 153726

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 112026 cttaactgatgacattgtcttgtgaaattc 112055



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 110380 cttaactgatgacattgtcttgtgaaattc 110351

to top

>gb|AC107399.6| Homo sapiens BAC clone RP11-755N14 from 4, complete sequence
          Length = 152877

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 57539 cttaactgatgacattgtcttgtgaaattc 57568



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 52259 cttaactgatgacattgtcttgtgaaattc 52288

to top

>gb|AC004456.1| Homo sapiens PAC clone RP5-1100F23 from 7, complete sequence
          Length = 143436

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 117419 cttaactgatgacattgtcttgtgaaattc 117390



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 476  cttaactgatgacattgtcttctcaaattc 505
            ||||||||||||||||||||| | ||||||
Sbjct: 3051 cttaactgatgacattgtcttgtgaaattc 3022

to top

>gb|AC003078.1| Homo sapiens BAC clone GS1-117O10 from 7, complete sequence
          Length = 182433

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 476  cttaactgatgacattgtcttctcaaattc 505
            ||||||||||||||||||||| | ||||||
Sbjct: 8244 cttaactgatgacattgtcttgtgaaattc 8273

to top

>gb|AC096752.4| Homo sapiens BAC clone RP11-454E2 from 7, complete sequence
          Length = 131629

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 110808 cttaactgatgacattgtcttgtgaaattc 110837

to top

>gb|AC005090.2| Homo sapiens BAC clone CTA-315L10 from 7, complete sequence
          Length = 116218

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             |||||||||||||||| |||||| ||||||
Sbjct: 62451 cttaactgatgacattatcttctgaaattc 62422



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             |||||||||||||||| |||||| ||||||
Sbjct: 57332 cttaactgatgacattatcttctgaaattc 57303

to top

>gb|AC005024.2| Homo sapiens BAC clone GS1-438P6 from 7, complete sequence
          Length = 89494

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 71943 cttaactgatgacattgtcttgtgaaattc 71972



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 66731 cttaactgatgacattgtcttgtgaaattc 66760

to top

>gb|AC004875.2| Homo sapiens PAC clone RP4-745K6 from 7, complete sequence
          Length = 130607

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 17230 cttaactgatgacattgtcttgtaaaattc 17201



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 11609 cttaactgatgacattgtcttgtgaaattc 11580

to top

>emb|Z82210.2|HS431C21 Human DNA sequence from clone RP3-431C21 on chromosome Xq21 Contains a
             ribosomal protein L7 (RPL7) pseudogene, complete sequence
          Length = 118426

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 95799 cttaactgatgacattgtcttgtgaaattc 95828



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 476    cttaactgatgacattgtct 495
              ||||||||||||||||||||
Sbjct: 101002 cttaactgatgacattgtct 101021

to top

>emb|AL807246.11| Human DNA sequence from clone RP11-461H3 on chromosome 6 Contains the
             5' end of the UST gene for uronyl-2-sulfotransferase, a
             laminin receptor 1 (ribosomal protein SA, 67 kDa) (LAMR1)
             pseudogene and a CpG island, complete sequence
          Length = 124214

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 13960 cttaactgatgacattgtcttgtgaaattc 13989

to top

>emb|AL954680.5| Human DNA sequence from clone RP4-803E15 on chromosome 1, complete
            sequence
          Length = 11230

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 476  cttaactgatgacattgtcttctcaaattc 505
            ||||||||||||||||||||| | ||||||
Sbjct: 2205 cttaactgatgacattgtcttgtgaaattc 2176

to top

>emb|AL627427.11| Human DNA sequence from clone RP11-350G11 on chromosome 13, complete
             sequence
          Length = 102564

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 64524 cttaactgatgacattgtcttatgaaattc 64553

to top

>emb|AL606527.6| Human DNA sequence from clone RP11-454G24 on chromosome 1 Contains a
              alcohol dehydrogenase 5 (class III) chi polypeptide (ADH5)
              pseudogene, complete sequence
          Length = 179964

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 130749 cttaactgatgacattgtcttgtgaaattc 130720

to top

>emb|AL591502.10| Human DNA sequence from clone RP11-199C17 on chromosome 9 Contains the
             5' end of the TBC1D2 gene for TBC1 domain family, member 2
             (PARIS1, PARIS-1,DKFZP761D1823, DKFZp761D1823), the 3' end
             of the GPR51 gene for G protein-coupled receptor 51 (HG20,
             GABBR2, GPRC3B, GABABR2) and a CpG island, complete
             sequence
          Length = 156753

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 34543 cttaactgatgacattgtcttgtgaaattc 34514

to top

>emb|AL592104.6| Human DNA sequence from clone RP11-428K13 on chromosome 1 Contains a
             pseudogene similar to part of caspase 3 apoptosis-related
             cysteine protease (CASP3), complete sequence
          Length = 131489

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 44301 cttaactgatgacattgtcttgtgaaattc 44330

to top

>emb|AL592067.4| Human DNA sequence from clone RP11-361H7 on chromosome 13, complete
             sequence
          Length = 83141

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 79359 cttaactgatgacattgtcttgtgaaattc 79330



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 74108 cttaactgatgacattgtcttgtgaaattc 74079

to top

>emb|AL590394.7| Human DNA sequence from clone RP11-435I7 on chromosome X Contains part
             of the gene for a novel protein (FLJ31204), complete
             sequence
          Length = 62195

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 45610 cttaactgatgacattgtcttgtgaaattc 45639

to top

>emb|AL591030.6| Human DNA sequence from clone RP11-35J1 on chromosome 6 Contains putative
              novel gene, complete sequence
          Length = 152361

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 114318 cttaactgatgacattgtcttgtgaaattc 114347

to top

>emb|AL589904.2| Human DNA sequence from clone RP11-115B7 on chromosome 6, complete
             sequence
          Length = 67797

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 57777 cttaactgatgacattgtcttgtgaaattc 57748



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 52599 cttaactgatgacattgtcttgtgaaattc 52570

to top

>emb|AL513547.16| Human DNA sequence from clone RP11-160E12 on chromosome 6 Contains the
             5' end of a novel gene, a novel gene, a PHD zinc finger
             protein XAP135 (XAP135) and three CpG islands, complete
             sequence
          Length = 91814

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 42022 cttaactgatgacattgtcttgtgaaattc 41993

to top

>emb|AL513479.12| Human DNA sequence from clone RP11-329N22 on chromosome 1, complete
              sequence
          Length = 193826

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 136945 cttaactgatgacattgtcttgtgaaattc 136974



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 131690 cttaactgatgacattgtcttgtgaaattc 131719

to top

>emb|AL512303.10| Human DNA sequence from clone RP1-249I4 on chromosome 6 Contains the
             KIAA0441 gene and a putative novel gene, complete sequence
          Length = 106408

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 98026 cttaactgatgacattgtcttgtgaaattc 97997



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 476    cttaactgatgacattgtctt 496
              |||||||||||||||||||||
Sbjct: 103420 cttaactgatgacattgtctt 103400

to top

>emb|AL512446.8| Human DNA sequence from clone RP11-268K9 on chromosome 6, complete
             sequence
          Length = 61258

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 46183 cttaactgatgacattgtcttgtgaaattc 46212

to top

>emb|AL513243.1| Human DNA sequence from clone RP11-453F18 on chromosome Xq25-26.3
             Contains the 3' end of gene LOC286467, complete sequence
          Length = 58976

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 19532 cttaactgatgacattgtcttgtgaaattc 19561



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 14202 cttaactgatgacattgtcttgtgaaattc 14231

to top

>emb|AL392088.12| Human DNA sequence from clone RP5-964H19 on chromosome 1 Contains the
             3' end of the gene for a novel protein similar to FLJ32883
             containing DUF1220 domains, a suppression of
             tumorigenicity 13 (colon carcinoma) (Hsp70 interacting
             protein) (ST13) pseudogene, a novel pseudogene and two CpG
             islands, complete sequence
          Length = 74877

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 13815 cttaactgatgacattgtcttgtgaaattc 13844

to top

>emb|AL445591.10| Human DNA sequence from clone RP11-314N2 on chromosome 1 Contains a
             novel processed pseudogene, the GJA8 gene for gap junction
             protein alpha 8, 50kDa (connexin 50) protein,  the 5' end
             of the gene for putative G-protein coupled receptor
             (SH120) and a CpG island, complete sequence
          Length = 140092

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 99746 cttaactgatgacattgtcttgtgaaattc 99717

to top

>emb|AL391838.9| Human DNA sequence from clone RP11-307O11 on chromosome 13, complete
             sequence
          Length = 146127

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 91804 cttaactgatgacattgtcttgtgaaattc 91833



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 86232 cttaactgatgacattgtcttgtgaaattc 86261

to top

>emb|AL360011.19| Human DNA sequence from clone RP11-103A2 on chromosome 10 Contains the
             HTR7 gene for 5-hydroxytryptamine receptor 7 (adenylate
             cyclase-coupled) and a CpG island, complete sequence
          Length = 157636

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 98917 cttaactgatgacattgtcttgtgaaattc 98946



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 93396 cttaactgatgacattgtcttgtgaaattc 93425

to top

>emb|AL365189.15| Human DNA sequence from clone RP11-595C20 on chromosome 6, complete
             sequence
          Length = 97534

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 20309 cttaactgatgacattgtcttgtgaaattc 20280

to top

>emb|AL359919.11| Human DNA sequence from clone RP11-15K3 on chromosome 10 Contains the
             3' end of a novel gene, complete sequence
          Length = 66059

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 23852 cttaactgatgacattgtcttgtgaaattc 23881

to top

>emb|AL390758.6| Human DNA sequence from clone RP11-540C21 on chromosome 10,
           complete sequence
          Length = 15250

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 476 cttaactgatgacattgtcttctcaaattc 505
           ||||||||||||||||||||| | ||||||
Sbjct: 613 cttaactgatgacattgtcttgtgaaattc 584

to top

>emb|AL359764.18| Human DNA sequence from clone RP11-527D7 on chromosome 1 Contains the
             5' end of the RGS7 gene for regulator of G-protein
             signalling 7, a novel gene, the 5' end of the FH gene for
             fumarate hydratase and two CpG islands, complete sequence
          Length = 156707

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 84802 cttaactgatgacattgtcttgtgaaattc 84831

to top

>emb|AL359703.13| Human DNA sequence from clone RP11-389N12 on chromosome X, complete
             sequence
          Length = 187779

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 45170 cttaactgatgacattgtcttgtgaaattc 45141



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 39891 cttaactgatgacattgtcttgtgaaattc 39862



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 34056 cttaactgatgacattgtcttgtgaaattc 34085



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 476   cttaactgatgacattgtct 495
             ||||||||||||||||||||
Sbjct: 39497 cttaactgatgacattgtct 39516

to top

>emb|AL357149.13| Human DNA sequence from clone RP11-352E13 on chromosome 6 Contains the
             3' end of the UTRN gene for utrophin (homologous to
             dystrophin), complete sequence
          Length = 201399

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 61814 cttaactgatgacattgtcttgtgaaattc 61785

to top

>emb|AL359746.8| Human DNA sequence from clone RP11-315G12 on chromosome 13, complete
             sequence
          Length = 41069

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 29478 cttaactgatgacattgtcttgtgaaattc 29507



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 23984 cttaactgatgacattgtcttgtgaaattc 24013

to top

>emb|AL358533.6| Human DNA sequence from clone RP11-456F13 on chromosome 1, complete
             sequence
          Length = 103390

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 69007 cttaactgatgacattgtcttgtgaaattc 68978

to top

>emb|AL355506.23| Human DNA sequence from clone RP3-366M24 on chromosome 6q25.3-26
             Contains the 5' end of the SLC22A3 gene for solute carrier
             family 22 (extraneuronal monoamine transporter), member 3
             (extraneuronal monoamine transporter solute carrier family
             22 (organic cation transporter), member 3 (EMT, EMTh,
             OCT3)) and a CpG island, complete sequence
          Length = 82919

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 74335 cttaactgatgacattgtcttgtgaaattc 74364

to top

>emb|AL355601.19| Human DNA sequence from clone RP11-445L6 on chromosome 9 Contains the
             5' UTR of the gene for deleted in esophageal cancer 1
             (DEC1) and the 5' end of a novel gene, complete sequence
          Length = 183104

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 42490 cttaactgatgacattgtcttgtgaaattc 42461



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 37217 cttaactgatgacattgtcttgtgaaattc 37188

to top

>emb|AL356356.17| Human DNA sequence from clone RP11-54A4 on chromosome 1 Contains the 3'
              end of the gene for a novel protein (KIAA0460), the gene
              for threonyl-tRNA synthetase (FLJ12528), the ECM1 gene for
              extracellular matrix protein 1, the TSRC1 gene for
              thrombospondin repeat containing 1, two novel genes, the
              MCL1 gene for myeloid cell leukemia sequence 1
              (BCL2-related), the ENSA gene for endosulfine alpha, the 3'
              end of the gene for GPP34-related protein (GPP34R) and two
              CpG islands, complete sequence
          Length = 176550

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 168767 cttaactgatgacattgtcttgtgaaattc 168796

to top

>emb|AL355375.17| Human DNA sequence from clone RP11-448N11 on chromosome 6 Contains a
              dihydrofolate reductase (DHFR) pseudogene and a ribosomal
              protein S17 (RPS17) pseudogene, complete sequence
          Length = 203501

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 151762 cttaactgatgacattgtcttgtgaaattc 151791



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 146414 cttaactgatgacattgtcttgtgaaattc 146443

to top

>emb|AL354682.22| Human DNA sequence from clone RP11-282L14 on chromosome 9, complete
             sequence
          Length = 108785

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 36581 cttaactgatgacattgtcttgtgaaattc 36610

to top

>emb|AL353801.13| Human DNA sequence from clone RP11-285G1 on chromosome 10 Contains two
              novel genes, the gene for AD037 protein (AD037), the gene
              for a decidual protein induced by progesterone (DEPP), a
              novel gene (FLJ30567), the ZNF22 gene for zinc finger
              protein 22 (KOX 15), a novel gene and two CpG islands,
              complete sequence
          Length = 222490

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 221103 cttaactgatgacattgtcttgtgaaattc 221074

to top

>emb|AL354810.8| Human DNA sequence from clone RP11-527N12 on chromosome 13 Contains a
              novel gene, complete sequence
          Length = 178323

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 170106 cttaactgatgacattgtcttgtgaaattc 170135



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 476    cttaactgatgacattgtctt 496
              |||||||||||||||||||||
Sbjct: 164525 cttaactgatgacattgtctt 164545

to top

>emb|AL158053.14| Human DNA sequence from clone RP11-156J23 on chromosome Xq21.2-21.33
             Contains a discs, large homolog 7 (Drosophila) (DLG7)
             pseudogene, complete sequence
          Length = 177722

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 32049 cttaactgatgacattgtcttgtgaaattc 32078

to top

>emb|AL161637.13| Human DNA sequence from clone RP3-393B19 on chromosome 1p33-34.3
             Contains a CpG island, complete sequence
          Length = 101954

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 80771 cttaactgatgacattgtcttgtgaaattc 80800



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 75531 cttaactgatgacattgtcttgtgaaattc 75560

to top

>gb|AC044849.12| Homo sapiens chromosome 8, clone RP11-489E7, complete sequence
          Length = 149301

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 69228 cttaactgatgacattgtcttgtgaaattc 69257

to top

>emb|AL137122.8| Human DNA sequence from clone RP1-119J15 on chromosome 6, complete
             sequence
          Length = 58484

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 53830 cttaactgatgacattgtcttgtgaaattc 53801

to top

>emb|AL136136.7| Human DNA sequence from clone RP11-141E20 on chromosome 1q31.2-31.3
             Contains GSSs and STSs, complete sequence
          Length = 146158

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 65173 cttaactgatgacattgtcttgtgaaattc 65144

to top

>emb|AL133257.17| Human DNA sequence from clone RP1-166D18 on chromosome 6q22.1-22.33
             Contains part of the TRDN gene for triadin (TDN, TRIADIN),
             complete sequence
          Length = 130748

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 92616 cttaactgatgacattgtcttgtgaaattc 92645

to top

>emb|AL050348.21|HSDJ447F3 Human DNA sequence from clone RP3-447F3 on chromosome 20 Contains the
             HNRPA1P3 gene for heterogenous nuclear ribonucleoprotein
             A1 pseudogene 3, the C20orf168 gene for a novel protein
             with Kunitz/Bovine pancreatic trypsin inhibitor domain,
             the WFDC3 gene for WAP four-disulfide core domain 3, the
             C20orf167 gene for a novel protein similar to
             synaptotagmin 1, the UBE2C gene for ubiquitin-conjugating
             enzyme E2 (H10), the TNNC2 gene for fast troponin C2 and
             two CpG islands, complete sequence
          Length = 97385

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 29144 cttaactgatgacattgtcttgtgaaattc 29173

to top

>emb|AL109659.20|HSJ1024N4 Human DNA sequence from clone RP5-1024N4 on chromosome 1p32.1-33
             Contains two novel genes, a novel pseudogene, a novel gene
             (LOC200010), a novel gene similar to connexin and one CpG
             island, complete sequence
          Length = 181678

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 68768 cttaactgatgacattgtcttgtgaaattc 68797

to top

>emb|AL049643.12|HSJ672M15 Human DNA sequence from clone RP4-672M15 on chromosome Xp21.1-21.3
             Contains the 5' end of three variants of the DMD gene for
             dystrophin (muscular dystrophy, Duchenne and Becker
             types), complete sequence
          Length = 118695

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 32242 cttaactgatgacattgtcttgtgaaattc 32271

to top

>emb|AL031183.4|HS1168A5 Human DNA sequence from clone RP5-1168A5 on chromosome Xq23 Contains a
             novel pseudogene, complete sequence
          Length = 75522

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 58955 cttaactgatgacattgtcttgtgaaattc 58984

to top

>emb|AL009031.1|HS467D16 Human DNA sequence from clone RP3-467D16 on chromosome 6p22.3-24.1
              Contains the 5' end of the SCA1 gene for spinocerebellar
              ataxia 1 (olivopontocerebellar ataxia 1, autosomal
              dominant, ataxin 1) with a poly-glutamine (CAG repeat)
              polymorphism and the 3' part of the GMPR gene for GMP
              reductase, Guanosine 5'-monophosphate oxidoreductase,
              complete sequence
          Length = 143583

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 135111 cttaactgatgacattgtcttgtgaaattc 135140

to top

>emb|AJ289711.1|HSA289711 Human endogenous retrovirus H HERV-H/env59 proviral copy, clone 916F3
          Length = 7721

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 476  cttaactgatgacattgtcttctcaaattc 505
            ||||||||||||||||||||| | ||||||
Sbjct: 7262 cttaactgatgacattgtcttgtgaaattc 7291



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 476 cttaactgatgacattgtcttctcaaattc 505
           ||||||||||||||||||||| | ||||||
Sbjct: 419 cttaactgatgacattgtcttgtgaaattc 448

to top

>gb|AC130509.6| Homo sapiens 3 BAC RP11-429M9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 64418

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 52506 cttaactgatgacattgtcttgtgaaattc 52535



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 47026 cttaactgatgacattgtcttgtgaaattc 47055

to top

>gb|AC112770.4| Homo sapiens 3 BAC RP11-686L6 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 187977

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 123540 cttaactgatgacattgtcttgtgaaattc 123511



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 118085 cttaactgatgacattgtcttgtgaaattc 118056

to top

>gb|AC139103.3| Homo sapiens chromosome 8, clone, complete sequence
          Length = 166920

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 96015 cttaactgatgacattgtcttgtgaaattc 96044



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 92051 cttaactgatgacattgtcttgtgaaattc 92080

to top

>gb|AC104308.3| Homo sapiens chromosome 3 clone RP11-544F21, complete sequence
          Length = 174513

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 120778 cttaactgatgacattgtcttgtgaaattc 120749

to top

>gb|AC105449.8| Homo sapiens chromosome 8, clone RP11-152B5, complete sequence
          Length = 159789

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 48912 cttaactgatgacattgtcttgtgaaattc 48941



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 43050 cttaactgatgacattgtcttgtgaaattc 43079

to top

>emb|AL954247.2| Pan troglodytes chromosome 22 clone CH251-479I13 map 22q22.3, complete
             sequence
          Length = 143192

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 88774 cttaactgatgacattgtcttgtgaaattc 88745

to top

>gb|AC069435.19| Homo sapiens 3 BAC RP11-384L1 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 111861

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 38818 cttaactgatgacattgtcttgtgaaattc 38847



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 33569 cttaactgatgacattgtcttatgaaattc 33598

to top

>gb|AC009318.11| Homo sapiens 12p BAC RP11-996F15 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 203417

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 52264 cttaactgatgacattgtcttgtgaaattc 52293

to top

>gb|AC009635.5| Homo sapiens chromosome 8, clone RP11-21J9, complete sequence
          Length = 171903

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 74409 cttaactgatgacattgtcttgtgaaattc 74380

to top

>gb|AC148832.5| Pan troglodytes BAC clone CH251-48K6 from chromosome 7, complete
             sequence
          Length = 186606

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||| ||||||| ||||||||
Sbjct: 84200 cttaactgatgacgttgtcttgtcaaattc 84171

to top

>gb|AC011476.8| Homo sapiens chromosome 19 clone CTC-550B14, complete sequence
          Length = 187064

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 115040 cttaactgatgacattgtcttgtgaaattc 115011



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 109854 cttaactgatgacattgtcttgtgaaattc 109825

to top

>gb|AC015802.21| Homo sapiens chromosome 17, clone RP11-666A8, complete sequence
          Length = 205753

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 13131 cttaactgatgacattgtcttgtgaaattc 13160



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 476  cttaactgatgacattgtcttctcaaattc 505
            ||||||||||||||||||||| | ||||||
Sbjct: 8018 cttaactgatgacattgtcttgtgaaattc 8047

to top

>gb|AC093298.3| Homo sapiens chromosome 5 clone RP11-543L14, complete sequence
          Length = 198687

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 106275 cttaactgatgacattgtcttgtgaaattc 106246

to top

>gb|AC016044.11| Homo sapiens chromosome 15 clone RP11-209K10 map 15q21.3, complete
             sequence
          Length = 168125

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 19062 cttaactgatgacattgtcttgtgaaattc 19091



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 12846 cttaactgatgacattgtcttgtgaaattc 12875

to top

>gb|AC026101.24| Homo sapiens 3 BAC RP11-441D23 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 164728

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 52482 cttaactgatgacattgtcttgtgaaattc 52511



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 47143 cttaactgatgacattgtcttgtgaaattc 47172

to top

>gb|AC010618.9| Homo sapiens chromosome 19 clone CTD-3131K8, complete sequence
          Length = 107226

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 103884 cttaactgatgacattgtcttgtgaaattc 103913

to top

>gb|AC008761.8| Homo sapiens chromosome 19 clone CTD-3149D2, complete sequence
          Length = 226170

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 476  cttaactgatgacattgtcttctcaaattc 505
            ||||||||||||||||||||| | ||||||
Sbjct: 4041 cttaactgatgacattgtcttgtgaaattc 4070

to top

>gb|AC022276.35| Homo sapiens 12 BAC RP11-161A14 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 177505

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 56385 cttaactgatgacattgtcttgtgaaattc 56356



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 50895 cttaactgatgacattgtcttgtgaaattc 50866

to top

>gb|AC117476.6| Homo sapiens 3 BAC RP11-726H11 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 92001

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 39199 cttaactgatgacattgtcttgtgaaattc 39228

to top

>emb|CR626911.1| Human DNA sequence from clone XX-NCIH2171_16G22, complete sequence
          Length = 121094

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 31312 cttaactgatgacattgtcttgtgaaattc 31341

to top

>gb|AC099842.2| Homo sapiens chromosome 11, clone RP11-747E23, complete sequence
          Length = 159274

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 58589 cttaactgatgacattgtcttgtgaaattc 58618

to top

>gb|AC183387.3| Pan troglodytes BAC clone CH251-113M12 from chromosome unknown, complete
              sequence
          Length = 175955

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 142822 cttaactgatgacattgtcttgtgaaattc 142793

to top

>gb|AC107074.5| Homo sapiens BAC clone RP11-424M21 from 4, complete sequence
          Length = 36933

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 30481 cttaactgatgacattgtcttgtgaaattc 30452

to top

>gb|AC124148.15| Pan troglodytes clone rp43-71k6, complete sequence
          Length = 194187

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 95594 cttaactgatgacattgtcttgtgaaattc 95565

to top

>gb|AC114969.2| Homo sapiens chromosome 5 clone RP11-356D23, complete sequence
          Length = 164526

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 125550 cttaactgatgacattgtcttgtgaaattc 125521

to top

>gb|AC067718.20| Homo sapiens 3 BAC RP11-198M8 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 97995

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 59172 cttaactgatgacattgtcttgtgaaattc 59201



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 53978 cttaactgatgacattgtcttgtgaaattc 54007

to top

>gb|AC104333.2| Homo sapiens chromosome 1 clone RP11-348H3, complete sequence
          Length = 162984

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 139019 cttaactgatgacattgtcttgtgaaattc 138990

to top

>gb|AC104441.2| Homo sapiens chromosome 3 clone RP11-901H12, complete sequence
          Length = 177320

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 121154 cttaactgatgacattgtcttgtgaaattc 121183

to top

>gb|AC112505.5| Homo sapiens 3 BAC RP11-282M5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 55860

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 16908 cttaactgatgacattgtcttgtgaaattc 16879

to top

>gb|AC025465.5| Homo sapiens chromosome 5 clone CTD-2308B18, complete sequence
          Length = 142148

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 54600 cttaactgatgacattgtcttgttaaattc 54629



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 477   ttaactgatgacattgtcttctcaaattc 505
             |||||||||||||||||||| | ||||||
Sbjct: 59899 ttaactgatgacattgtcttgtgaaattc 59927

to top

>gb|AC013242.8| Homo sapiens chromosome 10 clone RP11-315E23, complete sequence
          Length = 170174

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 30888 cttaactgatgacattgtcttgtgaaattc 30859

to top

>gb|AC006509.15| Homo sapiens 2p16 PAC RPCI5-960D23 (Roswell Park Cancer Institute Human
              PAC Library) complete sequence
          Length = 124015

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 118557 cttaactgatgacattgtcttgtgaaattc 118586

to top

>gb|AC148829.3| Pan troglodytes BAC clone CH251-483L24 from chromosome 7, complete
             sequence
          Length = 153598

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 41704 cttaactgatgacattgtcttgtgaaattc 41733

to top

>gb|AC007537.3| Homo sapiens 12 BAC RPCI11-267J23 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 190858

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 33016 cttaactgatgacattgtcttgtgaaattc 33045



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 27720 cttaactgatgacattgtcttgtgaaattc 27749

to top

>gb|AC011124.9| Homo sapiens chromosome 8, clone RP11-45K10, complete sequence
          Length = 185237

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 106354 cttaactgatgacattgtcttgtgaaattc 106383

to top

>gb|AC093431.2| Homo sapiens chromosome 1 clone RP11-574N2, complete sequence
          Length = 164454

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 49194 cttaactgatgacattgtcttgtgaaattc 49223

to top

>gb|AC020980.6| Homo sapiens chromosome 5 clone RPCI-1_167G20, complete sequence
          Length = 175177

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 124168 cttaactgatgacattgtcttgtgaaattc 124197



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 476    cttaactgatgacattgtctt 496
              |||||||||||||||||||||
Sbjct: 119121 cttaactgatgacattgtctt 119141

to top

>gb|AC069306.6| Homo sapiens BAC clone RP11-654F3 from 4, complete sequence
          Length = 49353

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 476  cttaactgatgacattgtcttctcaaattc 505
            ||||||||||||||||||||| | ||||||
Sbjct: 3870 cttaactgatgacattgtcttatgaaattc 3899

to top

>gb|AC104444.2| Homo sapiens chromosome 3 clone RP11-420K5, complete sequence
          Length = 161054

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 36687 cttaactgatgacattgtcttgtgaaattc 36658



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 31310 cttaactgatgacattgtcttgtgaaattc 31281

to top

>gb|AC112654.2| Homo sapiens X BAC RP11-44F2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 107921

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 91292 cttaactgatgacattgtcttgtgaaattc 91321

to top

>gb|AC091814.10| Homo sapiens 12p BAC RP11-290C10 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 149000

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             |||||||||||||||| |||||| ||||||
Sbjct: 41898 cttaactgatgacattatcttctgaaattc 41927

to top

>gb|AC079824.25| Homo sapiens Xp BAC RP11-750F16 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 119386

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 33319 cttaactgatgacattgtcttgtgaaattc 33290

to top

>gb|AC098976.2| Homo sapiens BAC clone RP11-751L19 from 4, complete sequence
          Length = 165221

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 10712 cttaactgatgacattgtcttgtgaaattc 10683

to top

>gb|AC096763.2| Homo sapiens BAC clone RP11-625A6 from 4, complete sequence
          Length = 168710

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 41264 cttaactgatgacattgtcttgtgaaattc 41293



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 476   cttaactgatgacattgtct 495
             ||||||||||||||||||||
Sbjct: 47026 cttaactgatgacattgtct 47045

to top

>gb|AC021118.6| Homo sapiens BAC clone RP11-332D24 from 4, complete sequence
          Length = 194612

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 160612 cttaactgatgacattgtcttgtgaaattc 160583

to top

>gb|AC022960.13| Homo sapiens chromosome 18, clone RP11-210K20, complete sequence
          Length = 171051

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 79570 cttaactgatgacattgtcttgtgaaattc 79599



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 73697 cttaactgatgacattgtcttgtgaaattc 73726

to top

>gb|AC096536.2| Homo sapiens chromosome 1 clone RP11-67L3, complete sequence
          Length = 155925

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 120168 cttaactgatgacattgtcttgtgaaattc 120139



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 477    ttaactgatgacattgtctt 496
              ||||||||||||||||||||
Sbjct: 114882 ttaactgatgacattgtctt 114863

to top

>gb|AC025480.7| Homo sapiens chromosome 18, clone RP11-12N19, complete sequence
          Length = 169594

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 91907 cttaactgatgacattgtcttgtgaaattc 91936

to top

>gb|AC027506.12| Homo sapiens chromosome 18, clone RP11-762J3, complete sequence
          Length = 189781

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 82365 cttaactgatgacattgtcttgtgaaattc 82394

to top

>gb|AC091894.2| Homo sapiens chromosome 5 clone RP11-138J23, complete sequence
          Length = 175552

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 103540 cttaactgatgacattgtcttgtgaaattc 103511

to top

>gb|AC022140.6| Homo sapiens chromosome 5 clone CTD-2306M5, complete sequence
          Length = 93133

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 48055 cttaactgatgacattgtcttgtgaaattc 48026

to top

>gb|AC078850.5| Homo sapiens BAC clone RP11-184M15 from 4, complete sequence
          Length = 180194

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 82058 cttaactgatgacattgtcttgtgaaattc 82029



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 76752 cttaactgatgacattgtcttgtgaaattc 76723

to top

>gb|AC020701.8| Homo sapiens BAC clone RP11-200K10 from 4, complete sequence
          Length = 129572

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 25991 cttaactgatgacattgtcttgtgaaattc 25962



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 20811 cttaactgatgacattgtcttgtgaaattc 20782

to top

>gb|AC091577.9| Homo sapiens chromosome 18, clone RP11-704J2, complete sequence
          Length = 158840

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 149137 cttaactgatgacattgtcttgtgaaattc 149108

to top

>gb|AC093581.2| Homo sapiens chromosome 1 clone RP11-22M7, complete sequence
          Length = 156992

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 78752 cttaactgatgacattgtcttgtgaaattc 78781



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 73436 cttaactgatgacattgtcttgtgaaattc 73465

to top

>gb|AC012410.10| Homo sapiens chromosome 8, clone RP11-354A3, complete sequence
          Length = 220715

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 38209 cttaactgatgacattgtcttgtgaaattc 38180

to top

>ref|XM_944391.1| PREDICTED: Homo sapiens hypothetical LOC388755 (LOC388755), mRNA
          Length = 1411

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 476  cttaactgatgacattgtcttctcaaattc 505
            ||||||||||||||||||||| | ||||||
Sbjct: 1188 cttaactgatgacattgtcttgtgaaattc 1217

to top

>ref|XM_373896.3| PREDICTED: Homo sapiens hypothetical LOC388755 (LOC388755), mRNA
          Length = 1411

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 476  cttaactgatgacattgtcttctcaaattc 505
            ||||||||||||||||||||| | ||||||
Sbjct: 1188 cttaactgatgacattgtcttgtgaaattc 1217

to top

>gb|AC158242.4| Pan troglodytes BAC clone CH251-354C10 from chromosome unknown, complete
              sequence
          Length = 182200

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 161396 cttaactgatgacattgtcttgtgaaattc 161367



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 156373 cttaactgatgacattgtcttgtgaaattc 156344

to top

>gb|AC010506.7| Homo sapiens chromosome 19 clone LLNLF-128A4, complete sequence
          Length = 36430

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 13763 cttaactgatgacattgtcttgtgaaattc 13792

to top

>gb|AC027017.5| Homo sapiens chromosome 8, clone RP11-450M17, complete sequence
          Length = 163266

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 104436 cttaactgatgacattgtcttgtgaaattc 104407

to top

>gb|AC023307.9| Homo sapiens chromosome 15, clone RP11-327M11, complete sequence
          Length = 168197

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 28881 cttaactgatgacattgtcttgtgaaattc 28852

to top

>gb|AC008872.6| Homo sapiens chromosome 5 clone CTD-2198D21, complete sequence
          Length = 128703

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 76589 cttaactgatgacattgtcttgtgaaattc 76618

to top

>gb|AC016879.6| Homo sapiens chromosome 8, clone RP11-97P19, complete sequence
          Length = 182556

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 119161 cttaactgatgacattgtcttgtgaaattc 119132

to top

>gb|AC020784.8| Homo sapiens chromosome 8, clone RP11-82I19, complete sequence
          Length = 183111

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 152580 cttaactgatgacattgtcttgtgaaattc 152551

to top

>gb|AC128690.5| Homo sapiens 3 BAC RP11-399P20 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 164809

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 77050 cttaactgatgacattgtcttgtgaaattc 77021

to top

>gb|AC008514.8| Homo sapiens chromosome 5 clone CTC-455F18, complete sequence
          Length = 172525

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 159843 cttaactgatgacattgtcttgtgaaattc 159872

to top

>gb|AC163760.3| Pan troglodytes BAC clone CH251-180O13 from chromosome unknown, complete
              sequence
          Length = 174147

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 122650 cttaactgatgacattgtcttgtgaaattc 122621



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 117325 cttaactgatgacattgtcttgtgaaattc 117296

to top

>gb|AC060788.11| Homo sapiens chromosome 8, clone CTD-2008O4, complete sequence
          Length = 177717

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 122668 cttaactgatgacattgtcttgtgaaattc 122639

to top

>gb|AC026742.3| Homo sapiens chromosome 5 clone CTD-3103E19, complete sequence
          Length = 149710

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 130011 cttaactgatgacattgtcttgtgaaattc 130040



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 123165 cttaactgatgacattgtcttgtgaaattc 123194

to top

>gb|AC090044.3| Homo sapiens chromosome 3 clone RP11-86C13 map 3p, complete sequence
          Length = 189939

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 144630 cttaactgatgacattgtcttgtgaaattc 144601

to top

>gb|AC011811.42| Homo sapiens clone b250a12, complete sequence
          Length = 231739

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 194479 cttaactgatgacattgtcttgtgaaattc 194450

to top

>gb|AF212831.2|AF212831 Homo sapiens chromosome 21 clone BAC R-45M19 map 21q21, complete
             sequence
          Length = 159255

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 39397 cttaactgatgacattgtcttgtgaaattc 39426

to top

>gb|AF130359.3|AF130359 Homo sapiens chromosome 21 clone PAC K15697 map 21q21, complete sequence
          Length = 146412

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 131182 cttaactgatgacattgtcttgtgaaattc 131211

to top

>gb|AC016080.5|AC016080 Homo sapiens, clone RP11-23N14, complete sequence
          Length = 176921

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 161602 cttaactgatgacattgtcttgtgaaattc 161631

to top

>gb|AC161475.6| Pan troglodytes BAC clone CH251-252J1 from chromosome unknown, complete
             sequence
          Length = 177925

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 29165 cttaactgatgacattgtcttgtgaaattc 29194

to top

>gb|AC015963.8|AC015963 Homo sapiens chromosome , clone RP11-112B21, complete sequence
          Length = 172657

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 62397 cttaactgatgacattgtcttgtgaaattc 62426

to top

>gb|AC024164.6|AC024164 Homo sapiens chromosome 3 clone RP11-350A17 map 3p, complete sequence
          Length = 152580

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 109171 cttaactgatgacattgtcttgtgaaattc 109142



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 103896 cttaactgatgacattgtcttgtgaaattc 103867

to top

>gb|AC068339.6| Homo sapiens chromosome 11, clone RP11-328E22, complete sequence
          Length = 155491

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 75335 cttaactgatgacattgtcttgtgaaattc 75364

to top

>gb|AF165423.6| Homo sapiens chromosome 3 clone CTB-402G2 map q, complete sequence
          Length = 125891

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 79292 cttaactgatgacattgtcttgtgaaattc 79263



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 73881 cttaactgatgacattgtcttgtgaaattc 73852

to top

>gb|AC141554.5| Homo sapiens 12 BAC RP11-488P21 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 141736

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 126534 cttaactgatgacattgtcttgtgaaattc 126563



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 120388 cttaactgatgacattgtcttgtgaaattc 120417

to top

>gb|AC143342.3| Homo sapiens fosmid clone XXFOS-84029D6 from 4, complete sequence
          Length = 40637

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 21997 cttaactgatgacattgtcttgtgaaattc 22026



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 16773 cttaactgatgacattgtcttgtgaaattc 16802

to top

>gb|AC092834.3| Homo sapiens BAC clone RP13-497K6 from 4, complete sequence
          Length = 146708

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 20278 cttaactgatgacattgtcttgtgaaattc 20307

to top

>gb|AC093722.2| Homo sapiens BAC clone CTD-2012I17 from 4, complete sequence
          Length = 163353

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 15222 cttaactgatgacattgtcttgtgaaattc 15193



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 10016 cttaactgatgacattgtcttgtgaaattc 9987

to top

>gb|AC084866.5| Homo sapiens BAC clone RP11-6E9 from 4, complete sequence
          Length = 196852

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 193402 cttaactgatgacattgtcttgtgaaattc 193431

to top

>gb|AC074378.4| Homo sapiens BAC clone RP11-4I17 from 4, complete sequence
          Length = 154112

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 101663 cttaactgatgacattgtcttgtgaaattc 101692

to top

>gb|AC096651.1| Homo sapiens BAC clone RP11-16J15 from 4, complete sequence
          Length = 158661

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 23556 cttaactgatgacattgtcttgtgaaattc 23585



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 22540 cttaactgatgacattgtcttgtgaaattc 22569

to top

>gb|AC114741.3| Homo sapiens BAC clone RP11-62N21 from 4, complete sequence
          Length = 119575

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 89392 cttaactgatgacattgtcttgtgaaattc 89421

to top

>gb|AC104686.2| Homo sapiens BAC clone RP11-74M11 from 4, complete sequence
          Length = 149964

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 79701 cttaactgatgacattgtcttgtgaaattc 79730

to top

>gb|AC119070.3| Homo sapiens BAC clone RP11-164M13 from 4, complete sequence
          Length = 34461

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 21109 cttaactgatgacattgtcttgtgaaattc 21138

to top

>gb|AC011754.8| Homo sapiens BAC clone RP11-546P22 from 2, complete sequence
          Length = 141704

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             |||||||||||||||| |||||| ||||||
Sbjct: 41145 cttaactgatgacattatcttctgaaattc 41116

to top

>gb|AC104634.5| Homo sapiens BAC clone RP11-793L24 from 2, complete sequence
          Length = 115758

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 11256 cttaactgatgacattgtcttgtgaaattc 11285

to top

>gb|AC062039.3| Homo sapiens BAC clone RP11-814A15 from 2, complete sequence
          Length = 141040

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 476  cttaactgatgacattgtcttctcaaattc 505
            ||||||||||||||||||||| | ||||||
Sbjct: 9118 cttaactgatgacattgtcttgtgaaattc 9147



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 476  cttaactgatgacattgtcttctcaaattc 505
            ||||||||||||||||||||| | ||||||
Sbjct: 2427 cttaactgatgacattgtcttgtgaaattc 2456

to top

>gb|AC104667.5| Homo sapiens BAC clone RP11-810D14 from 2, complete sequence
          Length = 95682

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 84689 cttaactgatgacattgtcttgtgaaattc 84718

to top

>gb|AC147289.3| Pan troglodytes BAC clone RP43-75A12 from chromosome 7, complete sequence
          Length = 178199

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 103020 cttaactgatgacattgtcttgtgaaattc 103049

to top

>gb|AC146091.2| Pan troglodytes BAC clone RP43-47P19 from chromosome 7, complete
             sequence
          Length = 139240

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 48711 cttaactgatgacattgtcttgtgaaattc 48682



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 43502 cttaactgatgacattgtcttgtgaaattc 43473

to top

>gb|AC146178.2| Pan troglodytes BAC clone RP43-35P14 from chromosome 7, complete sequence
          Length = 199167

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 163396 cttaactgatgacattgtcttgtgaaattc 163367

to top

>gb|AF315100.1|AF315100 Homo sapiens isolate HERV-H-MP20 long terminal repeat, partial
           sequence
          Length = 326

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 476 cttaactgatgacattgtcttctcaaattc 505
           ||||||||||||||||||||| | ||||||
Sbjct: 110 cttaactgatgacattgtcttgtgaaattc 139

to top

>gb|AC018648.5|AC018648 Homo sapiens chromosome 7 clone RP11-265E18, complete sequence
          Length = 155953

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 43168 cttaactgatgacattgtcttgtgaaattc 43197

to top

>gb|AC068716.8|AC068716 Homo sapiens chromosome 15 clone RP11-6L16 map 15q15, complete sequence
          Length = 159720

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 110900 cttaactgatgacattgtcttgtgaaattc 110929

to top

>gb|AC083906.23| Homo sapiens 3 BAC RP11-93K22 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 167875

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 49217 cttaactgatgacattgtcttgtgaaattc 49188



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 43805 cttaactgatgacattgtcttgtgaaattc 43776

to top

>gb|AC092490.10| Homo sapiens 12 BAC RP11-20D14 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 173911

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 166668 cttaactgatgacattgtcttgtgaaattc 166697



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 163912 cttaactgatgacattgtcttgtgaaattc 163941

to top

>gb|AC134507.2| Homo sapiens 3 BAC RP11-674K24 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 114169

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 70399 cttaactgatgacattgtcttgtgaaattc 70428



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 68753 cttaactgatgacattgtcttgtgaaattc 68724

to top

>gb|AC009229.5| Homo sapiens BAC clone RP11-314C9 from 2, complete sequence
          Length = 209156

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 174920 cttaactgatgacattgtcttgtgaaattc 174949

to top

>gb|AC007250.2| Homo sapiens BAC clone RP11-334G22 from 2, complete sequence
          Length = 180557

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 15239 cttaactgatgacattgtcttgtgaaattc 15210

to top

>gb|AC021849.5| Homo sapiens BAC clone RP11-366G5 from 2, complete sequence
          Length = 168710

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 108485 cttaactgatgacattgtcttgtgaaattc 108456

to top

>gb|AC008072.3| Homo sapiens BAC clone RP11-408N22 from 2, complete sequence
          Length = 206177

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 153379 cttaactgatgacattgtcttgtgaaattc 153350



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 148059 cttaactgatgacattgtcttgtgaaattc 148030

to top

>gb|AC104802.4| Homo sapiens BAC clone RP11-456I21 from 2, complete sequence
          Length = 30108

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 476  cttaactgatgacattgtcttctcaaattc 505
            ||||||||||||||||||||| | ||||||
Sbjct: 9605 cttaactgatgacattgtcttgtgaaattc 9634

to top

>gb|AC013445.8| Homo sapiens BAC clone RP11-489J10 from 2, complete sequence
          Length = 183960

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 126465 cttaactgatgacattgtcttgtgaaattc 126436

to top

>gb|AC139453.10| Homo sapiens 3 BAC RP11-803B1 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 149461

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 112888 cttaactgatgacattgtcttgtgaaattc 112859

to top

>gb|AC140484.1| Homo sapiens BAC clone RP11-806A6 from 4, complete sequence
          Length = 102884

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 48214 cttaactgatgacattgtcttgtgaaattc 48243

to top

>gb|AF042089.1|AF042089 Homo sapiens chromosome 3, olfactory receptor pseudogene cluster 1,
             complete sequence, and myosin light chain kinase (MLCK)
             pseudogene, partial sequence
          Length = 106926

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 20524 cttaactgatgacattgtcttgtgaaattc 20495

to top

>gb|AC139705.4| Homo sapiens X BAC RP11-102M2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 148316

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 24158 cttaactgatgacattgtcttgtgaaattc 24187



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 18896 cttaactgatgacattgtcttgtgaaattc 18925

to top

>gb|AC066598.5|AC066598 Homo sapiens chromosome 3 clone RP11-542K24 map 3p, complete sequence
          Length = 142190

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 125056 cttaactgatgacattgtcttgtgaaattc 125085



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 119781 cttaactgatgacattgtcttgtgaaattc 119810



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 56620 cttaactgatgacattgtcttgtgaaattc 56649

to top

>gb|AC093633.3| Homo sapiens BAC clone RP11-157M22 from 2, complete sequence
          Length = 173066

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 139968 cttaactgatgacattgtcttgtgaaattc 139997



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 133131 cttaactgatgacattgtcttgtgaaattc 133160

to top

>gb|AC060812.15| Homo sapiens chromosome 11, clone RP11-120E20, complete sequence
          Length = 184106

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 132168 cttaactgatgacattgtcttgtgaaattc 132139



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 126838 cttaactgatgacattgtcttgtgaaattc 126809

to top

>gb|AC092150.4| Homo sapiens BAC clone RP11-109J11 from 2, complete sequence
          Length = 82472

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 53591 cttaactgatgacattgtcttgtgaaattc 53562

to top

>gb|AC068195.6| Homo sapiens BAC clone RP11-114B24 from 2, complete sequence
          Length = 178147

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              |||||||||||||||| |||||| ||||||
Sbjct: 130647 cttaactgatgacattatcttctgaaattc 130676



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              |||||||||||||||| |||||| ||||||
Sbjct: 125047 cttaactgatgacattatcttctgaaattc 125076

to top

>gb|AC016697.8| Homo sapiens BAC clone RP11-140C4 from 2, complete sequence
          Length = 163489

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 79744 cttaactgatgacattgtcttgtgaaattc 79715



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 74143 cttaactgatgacattgtcttgtgaaattc 74114

to top

>gb|AC078883.6| Homo sapiens BAC clone RP11-227L6 from 2, complete sequence
          Length = 169586

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 166604 cttaactgatgacattgtcttgtgaaattc 166633

to top

>gb|AC109925.4| Homo sapiens BAC clone RP11-398J16 from 4, complete sequence
          Length = 160855

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 66779 cttaactgatgacattgtcttgtgaaattc 66750

to top

>gb|AC138089.2| Homo sapiens chromosome 1 clone RP11-407H12, complete sequence
          Length = 174987

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 476  cttaactgatgacattgtcttctcaaattc 505
            ||||||||||||||||||||| | ||||||
Sbjct: 4171 cttaactgatgacattgtcttgtgaaattc 4142

to top

>gb|AC026316.16| Homo sapiens 3 BAC RP11-373E16 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 164409

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 86524 cttaactgatgacattgtcttgtgaaattc 86553



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 477   ttaactgatgacattgtcttctcaaattc 505
             |||||||||||||||||||| | ||||||
Sbjct: 80850 ttaactgatgacattgtcttgtgaaattc 80878

to top

>gb|AC105029.7| Homo sapiens chromosome 8, clone CTD-2210A23, complete sequence
          Length = 123934

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 44555 cttaactgatgacattgtcttgtgaaattc 44584

to top

>gb|AC026950.15| Homo sapiens chromosome 8, clone RP11-555E9, complete sequence
          Length = 165051

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 105436 cttaactgatgacattgtcttgtgaaattc 105465

to top

>gb|AC072023.9| Homo sapiens 3 BAC RP11-3J2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 112405

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 93951 cttaactgatgacattgtcttgtgaaattc 93922

to top

>gb|AC008062.3| Homo sapiens BAC clone RP11-68L6 from 2, complete sequence
          Length = 131250

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 24467 cttaactgatgacattgtcttgtgaaattc 24496

to top

>gb|AC017004.4| Homo sapiens BAC clone RP11-88C6 from 2, complete sequence
          Length = 184850

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 112836 cttaactgatgacattgtcttgtgaaattc 112865

to top

>gb|AC093496.2| Homo sapiens chromosome 3 clone RP11-536I6 map 3p, complete sequence
          Length = 184041

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 131185 cttaactgatgacattgtcttgtgaaattc 131214

to top

>gb|AC064878.9|AC064878 Homo sapiens chromosome 6 clone RP11-13I13, complete sequence
          Length = 168654

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 150009 cttaactgatgacattgtcttgtgaaattc 149980

to top

>gb|AC104257.12| Homo sapiens chromosome 8, clone CTD-2501M5, complete sequence
          Length = 167787

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 100609 cttaactgatgacattgtcttgtgaaattc 100638



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 95337 cttaactgatgacattgtcttgtgaaattc 95366

to top

>gb|AC099066.3| Homo sapiens chromosome 1 clone RP11-145A3, complete sequence
          Length = 149549

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 143479 cttaactgatgacattgtcttgtgaaattc 143450

to top

>gb|AC092058.3| Homo sapiens chromosome 3 clone RP11-667E17, complete sequence
          Length = 200898

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 38762 cttaactgatgacattgtcttgtgaaattc 38791



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 476   cttaactgatgacattgtctt 496
             |||||||||||||||||||||
Sbjct: 44139 cttaactgatgacattgtctt 44159

to top

>gb|AC073895.22| Homo sapiens 3 BAC RP11-622L21 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 167311

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 45095 cttaactgatgacattgtcttgtgaaattc 45066



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 39811 cttaactgatgacattgtcttgtgaaattc 39782

to top

>gb|AC122683.4| Homo sapiens 3 RP11-528N21 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 142771

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 45609 cttaactgatgacattgtcttgtgaaattc 45638

to top

>gb|AC129505.8| Homo sapiens chromosome 11, clone RP11-1205H24, complete sequence
          Length = 117817

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 39588 cttaactgatgacattgtcttgtgaaattc 39559



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 476   cttaactgatgacattgtctt 496
             |||||||||||||||||||||
Sbjct: 34178 cttaactgatgacattgtctt 34158

to top

>gb|AC123788.7| Homo sapiens chromosome 11, clone RP5-1173A5, complete sequence
          Length = 133379

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 83935 cttaactgatgacattgtcttgtgaaattc 83964

to top

>gb|AC091951.3| Homo sapiens chromosome 5 clone RP11-404K5, complete sequence
          Length = 160174

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 79310 cttaactgatgacattgtcttgtgaaattc 79281

to top

>gb|AC092573.2| Homo sapiens BAC clone RP11-1O7 from 2, complete sequence
          Length = 171265

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 49641 cttaactgatgacattgtcttgtgaaattc 49612

to top

>gb|AC113377.2| Homo sapiens chromosome 5 clone RP11-26N10, complete sequence
          Length = 134277

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 109637 cttaactgatgacattgtcttgtgaaattc 109608

to top

>dbj|BS000031.1| Pan troglodytes chromosome 22 clone:PTB-082B23, map 22, complete
             sequences
          Length = 218696

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 62939 cttaactgatgacattgtcttgtgaaattc 62968



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 46644 cttaactgatgacattgtcttgtgaaattc 46673



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 41014 cttaactgatgacattgtcttgtgaaattc 41043

to top

>gb|AC004025.1|AC004025 Homo sapiens Xp22 BAC GS-321G17 (Genome Systems Human BAC library)
              complete sequence
          Length = 188730

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 107899 cttaactgatgacattgtcttgtgaaattc 107870



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 102608 cttaactgatgacattgtcttgtgaaattc 102579

to top

>gb|AC004817.2|AC004817 Homo sapiens PAC clone RP6-91H8 from 14q24.3, complete sequence
          Length = 128398

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 114139 cttaactgatgacattgtcttgtgaaattc 114110



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 108747 cttaactgatgacattgtcttgtgaaattc 108718

to top

>emb|AL163213.2|HS21C013 Homo sapiens chromosome 21 segment HS21C013
          Length = 340000

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 200060 cttaactgatgacattgtcttgtgaaattc 200089

to top

>gb|AC007870.3|AC007870 Genomic sequence for Homo sapiens clone 4P6, complete sequence
          Length = 134757

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 102914 cttaactgatgacattgtcttgtgaaattc 102885



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 97578 cttaactgatgacattgtcttgtgaaattc 97549

to top

>emb|AL162471.3|CNS01RHU Human chromosome 14 DNA sequence Partial sequence from BAC R-882I14 of
             library RPCI-11 from chromosome 14 of Homo sapiens
             (Human), complete sequence
          Length = 149326

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 73857 cttaactgatgacattgtcttgtgaaattc 73828

to top

>gb|AC005150.2|AC005150 Homo sapiens chromosome 4 clone B55B24 map 4q25, complete sequence
          Length = 158502

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 50237 cttaactgatgacattgtcttgtgaaattc 50208



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 45073 cttaactgatgacattgtcttgtgaaattc 45044

to top

>emb|AL356804.4|CNS05TDM Human chromosome 14 DNA sequence BAC R-718G2 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 185015

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 36991 cttaactgatgacattgtcttgtgaaattc 36962



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 476   cttaactgatgacattgtctt 496
             |||||||||||||||||||||
Sbjct: 45040 cttaactgatgacattgtctt 45020

to top

>dbj|AP000943.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-867G2, complete
              sequence
          Length = 192299

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 150295 cttaactgatgacattgtcttgtgaaattc 150324



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 144993 cttaactgatgacattgtcttgtgaaattc 145022

to top

>dbj|AP002376.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-349I16, complete
             sequence
          Length = 161406

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 19480 cttaactgatgacattgtcttgtgaaattc 19509



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 14178 cttaactgatgacattgtcttgtgaaattc 14207

to top

>gb|AC006539.1|AC006539 Homo sapiens chromosome 19, BAC 39498 (CIT-B-26L23), complete sequence
          Length = 114739

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 97838 cttaactgatgacattgtcttgtgaaattc 97809

to top

>emb|AL159140.4|CNS01RGP Human chromosome 14 DNA sequence BAC R-131E8 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 164452

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 113266 cttaactgatgacattgtcttgtgaaattc 113295

to top

>dbj|AP003716.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-119D9, complete
            sequence
          Length = 165187

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 476  cttaactgatgacattgtcttctcaaattc 505
            ||||||||||||||||||||| | ||||||
Sbjct: 2347 cttaactgatgacattgtcttgtgaaattc 2376

to top

>dbj|AP006292.2| Homo sapiens genomic DNA, chromosome 9 clone:RP11-1252A13, complete
             sequence
          Length = 208026

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 69334 cttaactgatgacattgtcttgtgaaattc 69305



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 64061 cttaactgatgacattgtcttgtgaaattc 64032

to top

>dbj|AP001695.1| Homo sapiens genomic DNA, chromosome 21q, section 39/105
          Length = 340000

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 301483 cttaactgatgacattgtcttgtgaaattc 301454



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 296277 cttaactgatgacattgtcttgtgaaattc 296248

to top

>dbj|AP006294.1| Homo sapiens genomic DNA, chromosome 11 clone:CTC-342M10, complete
             sequence
          Length = 83489

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 83261 cttaactgatgacattgtcttgtgaaattc 83290



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 77926 cttaactgatgacattgtcttgtgaaattc 77955

to top

>dbj|AP002346.3| Homo sapiens genomic DNA, chromosome 11q clone:CTD-2387M17, complete
              sequences
          Length = 127295

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 113680 cttaactgatgacattgtcttgtgaaattc 113709

to top

>dbj|AP003395.1| Homo sapiens genomic DNA, chromosome 11q clone:RP11-305N23, complete
              sequences
          Length = 205596

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 196495 cttaactgatgacattgtcttgtgaaattc 196466

to top

>dbj|AP003393.1| Homo sapiens genomic DNA, chromosome 11q clone:RP11-196E1, complete
             sequences
          Length = 174303

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 75743 cttaactgatgacattgtcttgtgaaattc 75714

to top

>dbj|AP002954.1| Homo sapiens genomic DNA, chromosome 11q, clons:CTC-89C10, complete
             sequence
          Length = 197215

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 95727 cttaactgatgacattgtcttgtgaaattc 95698

to top

>dbj|AP000879.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-805J14, complete
              sequence
          Length = 169725

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 145573 cttaactgatgacattgtcttgtgaaattc 145544



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 139778 cttaactgatgacattgtcttgtgaaattc 139749

to top

>dbj|AP000941.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-861M13, complete
              sequence
          Length = 199321

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 192526 cttaactgatgacattgtcttgtgaaattc 192497

to top

>dbj|AP002762.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-811I7, complete
              sequence
          Length = 189993

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 184458 cttaactgatgacattgtcttgtgaaattc 184487

to top

>dbj|AP005976.2| Homo sapiens genomic DNA, chromosome 8qtel, clone: KB1585H8, complete
              sequence
          Length = 226221

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 112224 cttaactgatgacattgtcttgtgaaattc 112195



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 106545 cttaactgatgacattgtcttgtgaaattc 106516

to top

>gb|AC005837.1|AC005837 Homo sapiens chromosome 17, clone hRPK.318_A_15, complete sequence
          Length = 163218

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 157220 cttaactgatgacattgtcttgtgaaattc 157249



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 152107 cttaactgatgacattgtcttgtgaaattc 152136

to top

>emb|AL450303.10| Human DNA sequence from clone RP11-245D2 on chromosome 1 Contains four
              genes for novel 7 transmembrane receptor (rhodopsin family)
              proteins, the OR2M7 gene for olfactory receptor, family 2,
              subfamily M, member 7 and the OR5BF1 gene for olfactory
              receptor, family 5, subfamily BF, member 1, complete
              sequence
          Length = 159867

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 148818 cttaactgatgacattgtcttgtgaaattc 148789



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 476    cttaactgatgacattgtctt 496
              |||||||||||||||||||||
Sbjct: 143880 cttaactgatgacattgtctt 143860

to top

>gb|U95997.1|HSU95997 Homo sapiens endogenous retrovirus-H family LTR 18101, partial
           sequence
          Length = 389

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 476 cttaactgatgacattgtcttctcaaattc 505
           ||||||||||||||||||||| | ||||||
Sbjct: 129 cttaactgatgacattgtcttgtgaaattc 158

to top

>gb|AC000378.1|AC000378 Human Chromosome 11 pac pDJ1173a5, complete sequence
          Length = 132783

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 48825 cttaactgatgacattgtcttgtgaaattc 48796

to top

>gb|AC002326.1|AC002326 Genomic sequence from Human 6, complete sequence
          Length = 148750

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 476    cttaactgatgacattgtcttctcaaattc 505
              ||||||||||||||||||||| | ||||||
Sbjct: 145340 cttaactgatgacattgtcttgtgaaattc 145369

to top

>emb|AL133224.4|CNS01DU9 Human chromosome 14 DNA sequence BAC R-16G17 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 187385

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 98205 cttaactgatgacattgtcttgtgaaattc 98234



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 92945 cttaactgatgacattgtcttgtgaaattc 92974

to top

>emb|AL109967.2|HS22F01 Homo sapiens chromosome 21 PAC LLNCO21F0122, complete sequence
          Length = 123631

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 66250 cttaactgatgacattgtcttgtgaaattc 66221



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 476   cttaactgatgacattgtcttctcaaattc 505
             ||||||||||||||||||||| | ||||||
Sbjct: 61048 cttaactgatgacattgtcttgtgaaattc 61019


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,617,419
Number of Sequences: 3902068
Number of extensions: 6617419
Number of successful extensions: 145277
Number of sequences better than 10.0: 366
Number of HSP's better than 10.0 without gapping: 366
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 143170
Number of HSP's gapped (non-prelim): 2108
length of query: 531
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 508
effective length of database: 17,143,297,704
effective search space: 8708795233632
effective search space used: 8708795233632
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result