ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbart41c05 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_677326.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN9149.2), mRNA Length = 4428 Score = 61.9 bits (31), Expect = 2e-06 Identities = 31/31 (100%) Strand = Plus / Plus Query: 369 gaagaggaggaggctgaggctgaggccgagg 399 ||||||||||||||||||||||||||||||| Sbjct: 2644 gaagaggaggaggctgaggctgaggccgagg 2674
>ref|NM_189957.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 561 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 291 gcctgcgcggccatggcgagctcgaactgccgc 323 |||||||| |||||||||||||||||||||||| Sbjct: 530 gcctgcgccgccatggcgagctcgaactgccgc 498 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 444 gcggcgcggttccaggagcgga 465 |||||||||||||||||||||| Sbjct: 389 gcggcgcggttccaggagcgga 368
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 291 gcctgcgcggccatggcgagctcgaactgccgc 323 |||||||| |||||||||||||||||||||||| Sbjct: 40023564 gcctgcgccgccatggcgagctcgaactgccgc 40023596 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 444 gcggcgcggttccaggagcgga 465 |||||||||||||||||||||| Sbjct: 40023705 gcggcgcggttccaggagcgga 40023726 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 239 gtggcggtggcgccgggcggcgcc 262 |||||||||||| ||||||||||| Sbjct: 4063116 gtggcggtggcggcgggcggcgcc 4063139
>dbj|AP003451.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0413C03 Length = 162161 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 291 gcctgcgcggccatggcgagctcgaactgccgc 323 |||||||| |||||||||||||||||||||||| Sbjct: 115015 gcctgcgccgccatggcgagctcgaactgccgc 115047 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 444 gcggcgcggttccaggagcgga 465 |||||||||||||||||||||| Sbjct: 115156 gcggcgcggttccaggagcgga 115177
>ref|XM_677657.1| PREDICTED: Danio rerio similar to SH3 domain and tetratricopeptide repeats containing protein 2 (LOC555205), partial mRNA Length = 4263 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 377 ggaggctgaggctgaggccgaggtgga 403 ||||||||||||||||||||||||||| Sbjct: 270 ggaggctgaggctgaggccgaggtgga 296
>ref|XM_625629.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd4_200), partial mRNA Length = 5502 Score = 48.1 bits (24), Expect = 0.026 Identities = 30/32 (93%) Strand = Plus / Plus Query: 368 agaagaggaggaggctgaggctgaggccgagg 399 |||| |||||||||||||||||||||| |||| Sbjct: 2499 agaaaaggaggaggctgaggctgaggctgagg 2530
>gb|AF049923.1|AF049923 Petunia x hybrida PGPS/D7 (PGPS/D7) mRNA, complete cds Length = 868 Score = 48.1 bits (24), Expect = 0.026 Identities = 27/28 (96%) Strand = Plus / Minus Query: 369 gaagaggaggaggctgaggctgaggccg 396 |||||||||||||||||||| ||||||| Sbjct: 199 gaagaggaggaggctgaggccgaggccg 172
>ref|XM_510999.1| PREDICTED: Pan troglodytes LOC454127 (LOC454127), mRNA Length = 846 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggccgagg 399 |||||||| |||||||||||||||||| Sbjct: 482 aggaggagcctgaggctgaggccgagg 508
>ref|XM_470511.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2602 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 372 gaggaggaggctgaggctgaggc 394 ||||||||||||||||||||||| Sbjct: 488 gaggaggaggctgaggctgaggc 466
>gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 11, complete sequence Length = 1019846 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 392 ggccgaggtggacgcggacgcgg 414 ||||||||||||||||||||||| Sbjct: 267804 ggccgaggtggacgcggacgcgg 267826
>ref|NM_001297.1| Homo sapiens cyclic nucleotide gated channel beta 1 (CNGB1), mRNA Length = 4382 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggccgagg 399 |||||||| |||||||||||||||||| Sbjct: 1383 aggaggagcctgaggctgaggccgagg 1409
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 372 gaggaggaggctgaggctgaggc 394 ||||||||||||||||||||||| Sbjct: 36036894 gaggaggaggctgaggctgaggc 36036872 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 380 ggctgaggctgaggccgagg 399 |||||||||||||||||||| Sbjct: 22033883 ggctgaggctgaggccgagg 22033864 Score = 40.1 bits (20), Expect = 6.3 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 351 ggcggtggaggagcggcagaagaggagg 378 ||||||||||||||||| |||||||||| Sbjct: 6147495 ggcggtggaggagcggc-gaagaggagg 6147521
>ref|XM_567646.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein (CNK00830) partial mRNA Length = 1943 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 392 ggccgaggtggacgcggacgcgg 414 ||||||||||||||||||||||| Sbjct: 1552 ggccgaggtggacgcggacgcgg 1574
>emb|CT009535.6| M.truncatula DNA sequence from clone MTH2-68D12 on chromosome 3, complete sequence Length = 82241 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 377 ggaggctgaggctgaggccgagg 399 ||||||||||||||||||||||| Sbjct: 12123 ggaggctgaggctgaggccgagg 12101
>gb|AC145343.3| Homo sapiens chromosome 17, clone XXfos-8207C6, complete sequence Length = 40272 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 377 ggaggctgaggctgaggccgaggtgga 403 |||||||||||||||||| |||||||| Sbjct: 904 ggaggctgaggctgaggctgaggtgga 878
>gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genomic sequence, complete sequence Length = 164179 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 372 gaggaggaggctgaggctgaggc 394 ||||||||||||||||||||||| Sbjct: 98405 gaggaggaggctgaggctgaggc 98383
>gb|AC012182.7| Homo sapiens chromosome 16 clone RP11-332G1, complete sequence Length = 188926 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 373 aggaggaggctgaggctgaggccgagg 399 |||||||| |||||||||||||||||| Sbjct: 14680 aggaggagcctgaggctgaggccgagg 14654
>gb|AC139882.29| Medicago truncatula clone mth2-32f21, complete sequence Length = 115770 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 377 ggaggctgaggctgaggccgagg 399 ||||||||||||||||||||||| Sbjct: 472 ggaggctgaggctgaggccgagg 494
>gb|AC012464.25| Homo sapiens 12 BAC RP11-1060G2 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 173765 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 376 aggaggctgaggctgaggccgaggtgg 402 ||||||||||||||||||| ||||||| Sbjct: 74086 aggaggctgaggctgaggctgaggtgg 74060
>gb|AC010543.9| Homo sapiens chromosome 16 clone RP11-440K14, complete sequence Length = 180286 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 373 aggaggaggctgaggctgaggccgagg 399 |||||||| |||||||||||||||||| Sbjct: 102339 aggaggagcctgaggctgaggccgagg 102313
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 372 gaggaggaggctgaggctgaggc 394 ||||||||||||||||||||||| Sbjct: 36126968 gaggaggaggctgaggctgaggc 36126946 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 380 ggctgaggctgaggccgagg 399 |||||||||||||||||||| Sbjct: 22026912 ggctgaggctgaggccgagg 22026893 Score = 40.1 bits (20), Expect = 6.3 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 351 ggcggtggaggagcggcagaagaggagg 378 ||||||||||||||||| |||||||||| Sbjct: 6146708 ggcggtggaggagcggc-gaagaggagg 6146734
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 359 aggagcggcagaagaggaggagg 381 ||||||||||||||||||||||| Sbjct: 20122052 aggagcggcagaagaggaggagg 20122030 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 241 ggcggtggcgccgggcggcg 260 |||||||||||||||||||| Sbjct: 26119265 ggcggtggcgccgggcggcg 26119246
>gb|AC132812.9| Homo sapiens chromosome 17, clone RP13-104F24, complete sequence Length = 161139 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 377 ggaggctgaggctgaggccgaggtgga 403 |||||||||||||||||| |||||||| Sbjct: 42248 ggaggctgaggctgaggctgaggtgga 42222
>dbj|AP004847.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1298_H07 Length = 106434 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 359 aggagcggcagaagaggaggagg 381 ||||||||||||||||||||||| Sbjct: 70575 aggagcggcagaagaggaggagg 70553
>dbj|AK111575.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013079H15, full insert sequence Length = 2812 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 372 gaggaggaggctgaggctgaggc 394 ||||||||||||||||||||||| Sbjct: 429 gaggaggaggctgaggctgaggc 407
>dbj|AK107551.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-A09, full insert sequence Length = 604 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 359 aggagcggcagaagaggaggagg 381 ||||||||||||||||||||||| Sbjct: 44 aggagcggcagaagaggaggagg 22
>emb|AL840629.24| Mouse DNA sequence from clone RP23-334A5 on chromosome 4, complete sequence Length = 214140 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Plus Query: 365 ggcagaagaggaggaggctgaggctgaggccgagg 399 |||||||||||||||||| ||||| ||||| |||| Sbjct: 190092 ggcagaagaggaggaggcggaggcggaggcagagg 190126
>gb|AC003663.1|AC003663 Homo sapiens chromosome 17, clone HCIT87G17, complete sequence Length = 132070 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 377 ggaggctgaggctgaggccgaggtgga 403 |||||||||||||||||| |||||||| Sbjct: 104794 ggaggctgaggctgaggctgaggtgga 104768
>gb|AF042498.1|AF042498 Homo sapiens rod photoreceptor CNG-channel beta subunit (RCNC2) mRNA, complete cds Length = 4382 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggccgagg 399 |||||||| |||||||||||||||||| Sbjct: 1383 aggaggagcctgaggctgaggccgagg 1409
>gb|U58837.1|HSU58837 Human cGMP-gated cation channel beta subunit (CNCG2) mRNA, complete cds Length = 4033 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggccgagg 399 |||||||| |||||||||||||||||| Sbjct: 1388 aggaggagcctgaggctgaggccgagg 1414
>gb|L15296.1|HUMCNGCCA Homo sapiens clone hRCNC2b retinal rod cyclic nucleotide-gated cation channel gene, complete cds Length = 3408 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggccgagg 399 |||||||| |||||||||||||||||| Sbjct: 409 aggaggagcctgaggctgaggccgagg 435
>gb|AC021573.10| Homo sapiens chromosome 11, clone RP11-411D10, complete sequence Length = 144656 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 376 aggaggctgaggctgaggccgaggtgg 402 ||||||||||||||||||| ||||||| Sbjct: 90989 aggaggctgaggctgaggctgaggtgg 90963
>ref|XM_482973.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1880 Score = 44.1 bits (22), Expect = 0.40 Identities = 25/26 (96%) Strand = Plus / Minus Query: 367 cagaagaggaggaggctgaggctgag 392 |||| ||||||||||||||||||||| Sbjct: 1114 cagaggaggaggaggctgaggctgag 1089
>ref|NM_001008423.1| Mus musculus gene model 1568, (NCBI) (Gm1568), mRNA Length = 4032 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 378 gaggctgaggctgaggccgagg 399 |||||||||||||||||||||| Sbjct: 852 gaggctgaggctgaggccgagg 831
>gb|AC134537.3| Mus musculus BAC clone RP24-388M1 from chromosome 12, complete sequence Length = 221662 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 378 gaggctgaggctgaggccgagg 399 |||||||||||||||||||||| Sbjct: 193274 gaggctgaggctgaggccgagg 193295
>ref|NM_152285.2| Homo sapiens arrestin domain containing 1 (ARRDC1), mRNA Length = 1621 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 1015 aggaggaggctgaggctgaggc 1036
>ref|XM_846325.1| PREDICTED: Canis familiaris similar to tropomyosin 3 isoform 2 (LOC609121), mRNA Length = 648 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 378 gaggctgaggctgaggccgagg 399 |||||||||||||||||||||| Sbjct: 193 gaggctgaggctgaggccgagg 214
>emb|CT025478.2| Xenopus tropicalis finished cDNA, clone TGas123m22 Length = 1085 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 75 accaaacaaaaatcctcgggaa 96 |||||||||||||||||||||| Sbjct: 342 accaaacaaaaatcctcgggaa 321
>gb|AC127337.4| Mus musculus BAC clone RP23-168F21 from 12, complete sequence Length = 209066 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 378 gaggctgaggctgaggccgagg 399 |||||||||||||||||||||| Sbjct: 23302 gaggctgaggctgaggccgagg 23323
>gb|BC022399.1| Homo sapiens protease inhibitor 16, mRNA (cDNA clone MGC:24129 IMAGE:4691115), complete cds Length = 2026 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 1083 aggaggaggctgaggctgaggc 1104
>gb|AY358422.1| Homo sapiens clone DNA40587 HGSC289 (UNQ289) mRNA, complete cds Length = 1875 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 1075 aggaggaggctgaggctgaggc 1096
>ref|NM_001007940.1| Xenopus tropicalis aprt protein (aprt), mRNA Length = 1298 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 75 accaaacaaaaatcctcgggaa 96 |||||||||||||||||||||| Sbjct: 333 accaaacaaaaatcctcgggaa 312
>gb|BC080448.1| Xenopus tropicalis aprt protein, mRNA (cDNA clone MGC:89543 IMAGE:6993401), complete cds Length = 1298 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 75 accaaacaaaaatcctcgggaa 96 |||||||||||||||||||||| Sbjct: 333 accaaacaaaaatcctcgggaa 312
>emb|AL365502.57| Human DNA sequence from clone RP11-48C7 on chromosome 9q34.2-34.3 Contains the gene for nasal embryonic luteinizing hormone-releasing hormone factor (DKFZP586J1624), a novel gene (FLJ31318), the MRPL41 gene for mitochondrial ribosomal protein L41 (RPML27, MRP-L270), a novel gene (LOC9271), the gene for melanin-concentrating hormone receptor 1 interacting zinc-finger protein (ZMYND17) (MIZIP), a novel gene (MGC40555), a novel protein and eleven CpG islands, complete sequence Length = 174995 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 169405 aggaggaggctgaggctgaggc 169426
>gb|AF451983.1| Homo sapiens hepatoma-derived growth factor 4a (HDGF) mRNA, complete cds Length = 870 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 378 gaggctgaggctgaggccgagg 399 |||||||||||||||||||||| Sbjct: 572 gaggctgaggctgaggccgagg 593
>emb|AL122034.29|HSDJ90K10 Human DNA sequence from clone RP1-90K10 on chromosome 6 Contains the PPIL1 gene for peptidylprolyl isomerase (cyclophilin)-like 1 (CYPL1, CGI-124), gene FLJ25357, a novel gene, a novel pseudogene, the gene for a novel SCP-like extracellular protein, the gene for mitochondrial carrier homolog 1 (MTCH1) (CGI-64) and two CpG islands, complete sequence Length = 133154 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 94538 aggaggaggctgaggctgaggc 94559
>gb|BC067044.1| Mus musculus gene model 1568, (NCBI), mRNA (cDNA clone MGC:91363 IMAGE:30531780), complete cds Length = 4032 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 378 gaggctgaggctgaggccgagg 399 |||||||||||||||||||||| Sbjct: 852 gaggctgaggctgaggccgagg 831
>emb|AL662807.8| Mouse DNA sequence from clone RP23-138O19 on chromosome 13 Contains the Hdgfrp1 gene for hepatoma-derived growth factor related protein 1 and a ribosomal protein 27A (Rpl27a) pseudogene, complete sequence Length = 188325 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 378 gaggctgaggctgaggccgagg 399 |||||||||||||||||||||| Sbjct: 99392 gaggctgaggctgaggccgagg 99371
>gb|BC035634.1| Homo sapiens protease inhibitor 16, mRNA (cDNA clone MGC:45378 IMAGE:5217121), complete cds Length = 2228 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 1389 aggaggaggctgaggctgaggc 1410
>emb|CR625126.1| full-length cDNA clone CS0DL007YE06 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human) Length = 758 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 175 aggaggaggctgaggctgaggc 196
>emb|CR623487.1| full-length cDNA clone CS0DL009YA20 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human) Length = 1488 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 947 aggaggaggctgaggctgaggc 968
>emb|CR621522.1| full-length cDNA clone CS0DI084YA21 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1817 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 1218 aggaggaggctgaggctgaggc 1239
>emb|CR618757.1| full-length cDNA clone CS0DE008YN17 of Placenta of Homo sapiens (human) Length = 1528 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 1015 aggaggaggctgaggctgaggc 1036
>emb|CR617572.1| full-length cDNA clone CS0DI039YL06 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1571 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 947 aggaggaggctgaggctgaggc 968
>emb|CR611460.1| full-length cDNA clone CS0DA009YL24 of Neuroblastoma of Homo sapiens (human) Length = 1510 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 959 aggaggaggctgaggctgaggc 980
>emb|CR610824.1| full-length cDNA clone CS0DK006YC20 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 1508 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 957 aggaggaggctgaggctgaggc 978
>emb|CR609326.1| full-length cDNA clone CS0DJ014YB13 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 1605 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 1052 aggaggaggctgaggctgaggc 1073
>emb|CR608402.1| full-length cDNA clone CL0BA005ZF05 of Placenta of Homo sapiens (human) Length = 1516 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 937 aggaggaggctgaggctgaggc 958
>emb|CR605706.1| full-length cDNA clone CS0DI087YF14 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1560 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 1016 aggaggaggctgaggctgaggc 1037
>emb|CR604807.1| full-length cDNA clone CS0DM009YD21 of Fetal liver of Homo sapiens (human) Length = 1504 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 941 aggaggaggctgaggctgaggc 962
>emb|CR603835.1| full-length cDNA clone CS0DJ011YI02 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 1607 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 1001 aggaggaggctgaggctgaggc 1022
>emb|CR603736.1| full-length cDNA clone CS0DK012YO07 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 1555 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 1004 aggaggaggctgaggctgaggc 1025
>emb|CR603444.1| full-length cDNA clone CS0DI049YM04 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1560 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 1011 aggaggaggctgaggctgaggc 1032
>emb|CR603346.1| full-length cDNA clone CS0DK009YC20 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 1510 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 957 aggaggaggctgaggctgaggc 978
>dbj|AK075470.1| Homo sapiens cDNA PSEC0164 fis, clone PLACE1010482, weakly similar to GLIOMA PATHOGENESIS-RELATED PROTEIN Length = 1877 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 1084 aggaggaggctgaggctgaggc 1105
>emb|CR597743.1| full-length cDNA clone CS0DI076YC21 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1531 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 962 aggaggaggctgaggctgaggc 983
>emb|CR597223.1| full-length cDNA clone CS0DB008YF22 of Neuroblastoma Cot 10-normalized of Homo sapiens (human) Length = 862 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 381 aggaggaggctgaggctgaggc 402
>emb|CR596964.1| full-length cDNA clone CS0DK008YH16 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 1494 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 946 aggaggaggctgaggctgaggc 967
>emb|CR596744.1| full-length cDNA clone CS0DF019YP02 of Fetal brain of Homo sapiens (human) Length = 1127 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 508 aggaggaggctgaggctgaggc 529
>emb|CR596578.1| full-length cDNA clone CS0DL009YP21 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human) Length = 1592 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 1041 aggaggaggctgaggctgaggc 1062
>emb|CR596025.1| full-length cDNA clone CS0DI055YB14 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1553 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 1001 aggaggaggctgaggctgaggc 1022
>emb|CR595686.1| full-length cDNA clone CS0DM009YN18 of Fetal liver of Homo sapiens (human) Length = 1554 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 1010 aggaggaggctgaggctgaggc 1031
>dbj|AK001822.1| Homo sapiens cDNA FLJ10960 fis, clone PLACE1000564 Length = 2196 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 1541 aggaggaggctgaggctgaggc 1562
>dbj|AK133257.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4932425C17 product:unclassifiable, full insert sequence Length = 3339 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 378 gaggctgaggctgaggccgagg 399 |||||||||||||||||||||| Sbjct: 139 gaggctgaggctgaggccgagg 118
>dbj|AK141165.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, clone:C230079P04 product:unclassifiable, full insert sequence Length = 2279 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 378 gaggctgaggctgaggccgagg 399 |||||||||||||||||||||| Sbjct: 563 gaggctgaggctgaggccgagg 584
>dbj|AK147473.1| Mus musculus adult male brain UNDEFINED_CELL_LINE cDNA, RIKEN full-length enriched library, clone:M5C1049E04 product:hypothetical Glutamic acid-rich region profile/Arginine-rich region profile/Serine-rich region profile containing protein, full insert sequence Length = 5628 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 378 gaggctgaggctgaggccgagg 399 |||||||||||||||||||||| Sbjct: 707 gaggctgaggctgaggccgagg 686
>ref|NM_001024487.1| Bos taurus protease inhibitor 16 (PI16), mRNA Length = 2369 Score = 44.1 bits (22), Expect = 0.40 Identities = 25/26 (96%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggccgag 398 ||||||||| |||||||||||||||| Sbjct: 1124 aggaggagggtgaggctgaggccgag 1149
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 44.1 bits (22), Expect = 0.40 Identities = 25/26 (96%) Strand = Plus / Minus Query: 367 cagaagaggaggaggctgaggctgag 392 |||| ||||||||||||||||||||| Sbjct: 23643065 cagaggaggaggaggctgaggctgag 23643040 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 411 gcggcggccggagcggtggtg 431 ||||||||||||||||||||| Sbjct: 8530441 gcggcggccggagcggtggtg 8530421
>ref|NM_153370.2| Homo sapiens peptidase inhibitor 16 (PI16), mRNA Length = 2205 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 1389 aggaggaggctgaggctgaggc 1410
>gb|AF180109.1|AF180109 Mus musculus hepatoma-derived growth factor (Hrp1) mRNA, partial cds Length = 1856 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 378 gaggctgaggctgaggccgagg 399 |||||||||||||||||||||| Sbjct: 486 gaggctgaggctgaggccgagg 507
>dbj|AP004643.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1113_A10 Length = 160089 Score = 44.1 bits (22), Expect = 0.40 Identities = 25/26 (96%) Strand = Plus / Minus Query: 367 cagaagaggaggaggctgaggctgag 392 |||| ||||||||||||||||||||| Sbjct: 50661 cagaggaggaggaggctgaggctgag 50636
>gb|BT021763.1| Bos taurus protease inhibitor 16 (PI16), mRNA, complete cds Length = 2369 Score = 44.1 bits (22), Expect = 0.40 Identities = 25/26 (96%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggccgag 398 ||||||||| |||||||||||||||| Sbjct: 1124 aggaggagggtgaggctgaggccgag 1149
>dbj|AK070025.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023039C11, full insert sequence Length = 1880 Score = 44.1 bits (22), Expect = 0.40 Identities = 25/26 (96%) Strand = Plus / Minus Query: 367 cagaagaggaggaggctgaggctgag 392 |||| ||||||||||||||||||||| Sbjct: 1114 cagaggaggaggaggctgaggctgag 1089
>gb|BC032346.1| Homo sapiens arrestin domain containing 1, mRNA (cDNA clone MGC:40555 IMAGE:5211669), complete cds Length = 1610 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 1005 aggaggaggctgaggctgaggc 1026
>emb|AL136293.5|CNS01DVX Human chromosome 14 DNA sequence BAC C-2555C10 of library CalTech-D from chromosome 14 of Homo sapiens (Human), complete sequence Length = 226035 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 372 gaggaggaggctgaggctgagg 393 |||||||||||||||||||||| Sbjct: 134934 gaggaggaggctgaggctgagg 134955
>emb|CR761604.2| Xenopus tropicalis finished cDNA, clone TGas144d17 Length = 1195 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 75 accaaacaaaaatcctcgggaa 96 |||||||||||||||||||||| Sbjct: 344 accaaacaaaaatcctcgggaa 323
>gb|BC108388.1| Mus musculus hepatoma derived growth factor-like 1, mRNA (cDNA clone MGC:118278 IMAGE:30920044), complete cds Length = 2046 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 378 gaggctgaggctgaggccgagg 399 |||||||||||||||||||||| Sbjct: 586 gaggctgaggctgaggccgagg 607
>gb|AE015925.1| Chlamydophila caviae GPIC, complete genome Length = 1173390 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 381 gctgaggctgaggccgaggtgg 402 |||||||||||||||||||||| Sbjct: 376624 gctgaggctgaggccgaggtgg 376645
>ref|NM_008232.1| Mus musculus hepatoma derived growth factor-like 1 (Hdgfl1), mRNA Length = 1333 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 378 gaggctgaggctgaggccgagg 399 |||||||||||||||||||||| Sbjct: 590 gaggctgaggctgaggccgagg 611
>dbj|AB209523.1| Homo sapiens mRNA for arrestin domain containing 1 variant protein Length = 3233 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 1732 aggaggaggctgaggctgaggc 1753
>emb|AJ420420.1|HSA420420 Homo sapiens mRNA full length insert cDNA clone EUROIMAGE 703547 Length = 1585 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggc 394 |||||||||||||||||||||| Sbjct: 982 aggaggaggctgaggctgaggc 1003
>dbj|D63663.1| Mus musculus mRNA for hepatoma-derived growth factor, complete cds, strain:RAIB/c Length = 1333 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 378 gaggctgaggctgaggccgagg 399 |||||||||||||||||||||| Sbjct: 590 gaggctgaggctgaggccgagg 611
>gb|AC166652.6| Mus musculus chromosome 8, clone RP24-129F24, complete sequence Length = 164098 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 375 gaggaggctgaggctgaggccgagg 399 |||||||||||||||||||| |||| Sbjct: 47249 gaggaggctgaggctgaggctgagg 47273
>ref|XM_522201.1| PREDICTED: Pan troglodytes similar to forkhead box R1 (LOC466801), mRNA Length = 1602 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 367 cagaagaggaggaggctgagg 387 ||||||||||||||||||||| Sbjct: 1097 cagaagaggaggaggctgagg 1117
>ref|NM_181721.2| Homo sapiens forkhead box R1 (FOXR1), mRNA Length = 1215 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 367 cagaagaggaggaggctgagg 387 ||||||||||||||||||||| Sbjct: 614 cagaagaggaggaggctgagg 634
>gb|AC128644.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0009F15, complete sequence Length = 142289 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 331 gcgacggcggctgcgcctgtggcggtggaggag 363 ||||||||||| ||||| ||||||| ||||||| Sbjct: 29408 gcgacggcggcggcgcccgtggcggaggaggag 29376
>gb|AC161373.4| Mus musculus BAC clone RP23-308E4 from chromosome 6, complete sequence Length = 189028 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 371 agaggaggaggctgaggctgaggccgaggtgga 403 |||||||||||| ||||| ||||| |||||||| Sbjct: 18083 agaggaggaggcagaggcggaggcagaggtgga 18115
>gb|BC043113.1| Mus musculus TBC1 domain family, member 5, mRNA (cDNA clone MGC:58037 IMAGE:6407234), complete cds Length = 5597 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 374 ggaggaggctgaggctgaggc 394 ||||||||||||||||||||| Sbjct: 2536 ggaggaggctgaggctgaggc 2516
>ref|XM_614113.2| PREDICTED: Bos taurus similar to splicing factor, arginine/serine-rich 15 (LOC541016), mRNA Length = 3702 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 360 ggagcggcagaagaggaggag 380 ||||||||||||||||||||| Sbjct: 330 ggagcggcagaagaggaggag 350
>ref|NM_028162.2| Mus musculus TBC1 domain family, member 5 (Tbc1d5), mRNA Length = 5764 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 374 ggaggaggctgaggctgaggc 394 ||||||||||||||||||||| Sbjct: 2703 ggaggaggctgaggctgaggc 2683
>gb|AY064406.2| Canis familiaris UDP-galactose transporter (ugt) mRNA, complete cds, alternatively spliced Length = 1194 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 371 agaggaggaggctgaggctgaggccgaggtgga 403 ||||| |||||| ||||||||||| |||||||| Sbjct: 1080 agaggtggaggccgaggctgaggcggaggtgga 1048
>gb|BC038969.1| Homo sapiens hypothetical protein LOC283150, mRNA (cDNA clone IMAGE:5164198), partial cds Length = 1090 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 367 cagaagaggaggaggctgagg 387 ||||||||||||||||||||| Sbjct: 489 cagaagaggaggaggctgagg 509
>gb|BC028191.1| Homo sapiens hypothetical protein LOC283150, mRNA (cDNA clone IMAGE:5167039), partial cds Length = 1227 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 367 cagaagaggaggaggctgagg 387 ||||||||||||||||||||| Sbjct: 613 cagaagaggaggaggctgagg 633
>gb|AC115911.14| Mus musculus chromosome 6, clone RP24-481I20, complete sequence Length = 168641 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 371 agaggaggaggctgaggctgaggccgaggtgga 403 |||||||||||| ||||| ||||| |||||||| Sbjct: 133932 agaggaggaggcagaggcggaggcagaggtgga 133964
>gb|AC125140.3| Mus musculus chromosome 17 clone RP24-327D1, complete sequence Length = 146052 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 374 ggaggaggctgaggctgaggc 394 ||||||||||||||||||||| Sbjct: 130936 ggaggaggctgaggctgaggc 130916
>gb|AC105066.12| Mus musculus chromosome 8, clone RP23-158A22, complete sequence Length = 238527 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 357 ggaggagcggcagaagaggaggagg 381 |||||||| |||||||||||||||| Sbjct: 212203 ggaggagcagcagaagaggaggagg 212179
>gb|AC055872.23| Homo sapiens chromosome 17, clone RP11-636N17, complete sequence Length = 202360 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 375 gaggaggctgaggctgaggccgagg 399 |||||||||||||||||||| |||| Sbjct: 98268 gaggaggctgaggctgaggctgagg 98292
>gb|AC072028.14| Homo sapiens 3 BAC RP11-190C21 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 186739 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 376 aggaggctgaggctgaggccg 396 ||||||||||||||||||||| Sbjct: 124071 aggaggctgaggctgaggccg 124051
>gb|AC098738.2| Mus musculus BAC clone RP23-122F7 from 8, complete sequence Length = 216974 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 375 gaggaggctgaggctgaggccgagg 399 |||||||||||||||||||| |||| Sbjct: 146348 gaggaggctgaggctgaggctgagg 146372 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 375 gaggaggctgaggctgaggc 394 |||||||||||||||||||| Sbjct: 146369 gaggaggctgaggctgaggc 146388
>ref|XM_546494.2| PREDICTED: Canis familiaris similar to forkhead box R1 (LOC489376), mRNA Length = 1128 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 367 cagaagaggaggaggctgagg 387 ||||||||||||||||||||| Sbjct: 638 cagaagaggaggaggctgagg 658
>ref|XM_546136.2| PREDICTED: Canis familiaris similar to suppressor of var1, 3-like 1, transcript variant 1 (LOC489018), mRNA Length = 2367 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 365 ggcagaagaggaggaggctgaggct 389 |||||||||||||||||| |||||| Sbjct: 162 ggcagaagaggaggaggcggaggct 138
>ref|XM_855911.1| PREDICTED: Canis familiaris similar to suppressor of var1, 3-like 1, transcript variant 2 (LOC489018), mRNA Length = 726 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 365 ggcagaagaggaggaggctgaggct 389 |||||||||||||||||| |||||| Sbjct: 162 ggcagaagaggaggaggcggaggct 138
>gb|AC157609.6| Mus musculus chromosome 8, clone RP23-94H5, complete sequence Length = 239452 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 375 gaggaggctgaggctgaggccgagg 399 |||||||||||||||||||| |||| Sbjct: 153123 gaggaggctgaggctgaggctgagg 153099
>gb|DQ231456.1| Bos taurus zygote arrest 1 variant 1 (ZAR1) mRNA, complete cds Length = 1478 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 360 ggagcggcagaagaggaggag 380 ||||||||||||||||||||| Sbjct: 1276 ggagcggcagaagaggaggag 1256
>gb|DQ231455.1| Bos taurus zygote arrest 1 (ZAR1) gene, complete cds, alternatively spliced Length = 4138 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 360 ggagcggcagaagaggaggag 380 ||||||||||||||||||||| Sbjct: 3936 ggagcggcagaagaggaggag 3916
>gb|DQ231449.1| Bos taurus zygote arrest 1 (ZAR1) mRNA, partial cds, alternatively spliced Length = 648 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 360 ggagcggcagaagaggaggag 380 ||||||||||||||||||||| Sbjct: 446 ggagcggcagaagaggaggag 426
>gb|DQ231448.1| Bos taurus zygote arrest 1 (ZAR1) mRNA, partial cds, alternatively spliced Length = 522 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 360 ggagcggcagaagaggaggag 380 ||||||||||||||||||||| Sbjct: 446 ggagcggcagaagaggaggag 426
>ref|NM_001003059.2| Canis familiaris solute carrier family 35 (UDP-galactose transporter), member A2 (SLC35A2), mRNA Length = 1194 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 371 agaggaggaggctgaggctgaggccgaggtgga 403 ||||| |||||| ||||||||||| |||||||| Sbjct: 1080 agaggtggaggccgaggctgaggcggaggtgga 1048
>emb|Z85996.1|HS431A14 Human DNA sequence from clone RP3-431A14 on chromosome 6p21 Contains the CDKN1A gene for cyclin-dependent kinase inhibitor 1A, the gene for a novel protein similar to ras family protein, the gene for a novel copine-like protein (KIA1599), a galanin receptor pseudogene, the 3' end of the PPIL1 gene for peptidylprolyl isomerase protein and 2 CpG islands, complete sequence Length = 195364 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 370 aagaggaggaggctgaggctgaggc 394 ||||| ||||||||||||||||||| Sbjct: 172996 aagagaaggaggctgaggctgaggc 172972
>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence Length = 4895836 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 248 gcgccgggcggcgccgctcgtgctg 272 |||||| |||||||||||||||||| Sbjct: 2143097 gcgccgcgcggcgccgctcgtgctg 2143121
>emb|BX031497.1|CNS08WGT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46DH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 183 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggccggag 423 |||||||||||||||||||| |||| Sbjct: 131 gtggacgcggacgcggcggcaggag 155
>gb|AC161410.3| Mus musculus chromosome 8, clone RP23-399J5, complete sequence Length = 196119 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 375 gaggaggctgaggctgaggccgagg 399 |||||||||||||||||||| |||| Sbjct: 184272 gaggaggctgaggctgaggctgagg 184296
>gb|BC098328.1| Mus musculus TBC1 domain family, member 5, mRNA (cDNA clone MGC:106461 IMAGE:30357143), complete cds Length = 4282 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 374 ggaggaggctgaggctgaggc 394 ||||||||||||||||||||| Sbjct: 2066 ggaggaggctgaggctgaggc 2046
>dbj|AK220251.1| Mus musculus mRNA for mKIAA0210 protein Length = 5579 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 374 ggaggaggctgaggctgaggc 394 ||||||||||||||||||||| Sbjct: 2687 ggaggaggctgaggctgaggc 2667
>dbj|AK096023.1| Homo sapiens cDNA FLJ38704 fis, clone KIDNE2002483, weakly similar to Homo sapiens copine I mRNA Length = 2715 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 370 aagaggaggaggctgaggctgaggc 394 ||||| ||||||||||||||||||| Sbjct: 127 aagagaaggaggctgaggctgaggc 151
>gb|AC084356.23| Homo sapiens 12 BAC RP11-266E14 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 179721 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 369 gaagaggaggaggctgaggctgagg 393 ||||||||||||| ||||||||||| Sbjct: 63568 gaagaggaggaggatgaggctgagg 63592
>gb|AF168681.1| Homo sapiens CRIM1 protein gene, partial cds; and FEZ2 gene, partial sequence Length = 236303 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 378 gaggctgaggctgaggccgaggtgg 402 ||||||||||||||||| ||||||| Sbjct: 147547 gaggctgaggctgaggctgaggtgg 147523
>dbj|AK154975.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630113I18 product:TBC1 domain family, member 5, full insert sequence Length = 4765 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 374 ggaggaggctgaggctgaggc 394 ||||||||||||||||||||| Sbjct: 2746 ggaggaggctgaggctgaggc 2726
>ref|XM_941378.1| PREDICTED: Homo sapiens forkhead box R1 (FOXR1), mRNA Length = 912 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 367 cagaagaggaggaggctgagg 387 ||||||||||||||||||||| Sbjct: 377 cagaagaggaggaggctgagg 397
>ref|NM_001039560.1| Mus musculus RIKEN cDNA A330041C17 gene (A330041C17Rik), mRNA Length = 2223 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 375 gaggaggctgaggctgaggccgagg 399 |||||||||||||||||||| |||| Sbjct: 260 gaggaggctgaggctgaggctgagg 284
>dbj|AK039414.1| Mus musculus adult male spinal cord cDNA, RIKEN full-length enriched library, clone:A330041C17 product:weakly similar to DJ1153D9.2 (Novel protein similar to beta 1,6-N-acetylglucosaminyltransferase) (Fragment) [Homo sapiens], full insert sequence Length = 2223 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 375 gaggaggctgaggctgaggccgagg 399 |||||||||||||||||||| |||| Sbjct: 260 gaggaggctgaggctgaggctgagg 284
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 331 gcgacggcggctgcgcctgtggcggtggaggag 363 ||||||||||| ||||| ||||||| ||||||| Sbjct: 4378045 gcgacggcggcggcgcccgtggcggaggaggag 4378013 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 363 gcggcagaagaggaggaggc 382 |||||||||||||||||||| Sbjct: 3309599 gcggcagaagaggaggaggc 3309618
>gb|AC156541.7| Mus musculus chromosome 1, clone RP23-478I8, complete sequence Length = 173297 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 365 ggcagaagaggaggaggctgaggctgagg 393 ||||||||||||||||| |||||||||| Sbjct: 18296 ggcagaagaggaggaggaagaggctgagg 18268
>gb|AC154214.1| Mus musculus BAC clone RP24-129M18 from chromosome 17, complete sequence Length = 176792 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 374 ggaggaggctgaggctgaggc 394 ||||||||||||||||||||| Sbjct: 73036 ggaggaggctgaggctgaggc 73016
>gb|AC079921.5| Homo sapiens BAC clone RP11-360F5 from 4, complete sequence Length = 189796 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 378 gaggctgaggctgaggccgaggtgg 402 ||||||||||||||||| ||||||| Sbjct: 174492 gaggctgaggctgaggctgaggtgg 174468
>gb|AC007378.4| Homo sapiens BAC clone RP11-78I14 from 2, complete sequence Length = 179357 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 378 gaggctgaggctgaggccgaggtgg 402 ||||||||||||||||| ||||||| Sbjct: 31615 gaggctgaggctgaggctgaggtgg 31639
>emb|BX294006.4| Zebrafish DNA sequence from clone CH211-145M1 in linkage group 8, complete sequence Length = 171051 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 5 actagtaaaatattacgtact 25 ||||||||||||||||||||| Sbjct: 119043 actagtaaaatattacgtact 119063
>dbj|AP005249.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0087F21 Length = 187401 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 411 gcggcggccggagcggtggtg 431 ||||||||||||||||||||| Sbjct: 42352 gcggcggccggagcggtggtg 42332
>dbj|AP004657.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0031C02 Length = 138843 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 411 gcggcggccggagcggtggtg 431 ||||||||||||||||||||| Sbjct: 59984 gcggcggccggagcggtggtg 59964
>dbj|AP001725.1| Homo sapiens genomic DNA, chromosome 21q, section 69/105 Length = 340000 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 371 agaggaggaggctgaggctgaggccgagg 399 ||||| |||||||||||||||||| |||| Sbjct: 261328 agaggcggaggctgaggctgaggctgagg 261356
>dbj|AB094092.1| Homo sapiens DLNB13 mRNA, complete cds Length = 1159 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 367 cagaagaggaggaggctgagg 387 ||||||||||||||||||||| Sbjct: 614 cagaagaggaggaggctgagg 634
>emb|AM110117.1| Canis familiaris mRNA for UDP-galactose transporter (short form) (ugt gene) Length = 1011 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 371 agaggaggaggctgaggctgaggccgaggtgga 403 ||||| |||||| ||||||||||| |||||||| Sbjct: 897 agaggtggaggccgaggctgaggcggaggtgga 865
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 331 gcgacggcggctgcgcctgtggcggtggaggag 363 ||||||||||| ||||| ||||||| ||||||| Sbjct: 4386739 gcgacggcggcggcgcccgtggcggaggaggag 4386707 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 363 gcggcagaagaggaggaggc 382 |||||||||||||||||||| Sbjct: 3318312 gcggcagaagaggaggaggc 3318331
>dbj|AB037899.1| Oryza sativa (japonica cultivar-group) OspolD1 mRNA for OsPol delta large subunit, complete cds Length = 3706 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 331 gcgacggcggctgcgcctgtggcggtggaggag 363 ||||||||||| ||||| ||||||| ||||||| Sbjct: 162 gcgacggcggcggcgcccgtggcggaggaggag 194
>dbj|AP003392.2| Homo sapiens genomic DNA, chromosome 11 clone:RP11-110I1, complete sequence Length = 178341 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 367 cagaagaggaggaggctgagg 387 ||||||||||||||||||||| Sbjct: 70511 cagaagaggaggaggctgagg 70531
>gb|AC151909.5| Mus musculus BAC clone RP23-60H14 from chromosome 8, complete sequence Length = 208855 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 357 ggaggagcggcagaagaggaggagg 381 |||||||| |||||||||||||||| Sbjct: 139062 ggaggagcagcagaagaggaggagg 139086
>emb|AL662818.16| Mouse DNA sequence from clone RP23-266O8 on chromosome 4, complete sequence Length = 137323 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 375 gaggaggctgaggctgaggccgagg 399 |||||||||||||||||||| |||| Sbjct: 37805 gaggaggctgaggctgaggctgagg 37781
>emb|AL833787.8| Mouse DNA sequence from clone RP23-228E2 on chromosome 2, complete sequence Length = 237055 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 375 gaggaggctgaggctgaggccgagg 399 |||||||||||||||||||| |||| Sbjct: 97840 gaggaggctgaggctgaggctgagg 97816
>dbj|AP000692.1| Homo sapiens genomic DNA, chromosome 21q22.2, PAC clone:P24J14, CBR1-HLCS region Length = 102714 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 371 agaggaggaggctgaggctgaggccgagg 399 ||||| |||||||||||||||||| |||| Sbjct: 93889 agaggcggaggctgaggctgaggctgagg 93917
>gb|AC138358.12| Mus musculus chromosome 1, clone RP24-147G10, complete sequence Length = 180227 Score = 40.1 bits (20), Expect = 6.3 Identities = 26/28 (92%) Strand = Plus / Minus Query: 372 gaggaggaggctgaggctgaggccgagg 399 |||| |||||||||||||||||| |||| Sbjct: 107196 gaggcggaggctgaggctgaggctgagg 107169
>ref|XM_550378.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1002 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 239 gtggcggtggcgccgggcggcgcc 262 |||||||||||| ||||||||||| Sbjct: 49 gtggcggtggcggcgggcggcgcc 72
>gb|CP000108.1| Chlorobium chlorochromatii CaD3, complete genome Length = 2572079 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cagcaaccaaacaaaaatcc 89 |||||||||||||||||||| Sbjct: 669197 cagcaaccaaacaaaaatcc 669178
>ref|XM_467050.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1887 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 241 ggcggtggcgccgggcggcg 260 |||||||||||||||||||| Sbjct: 696 ggcggtggcgccgggcggcg 715
>ref|NM_184954.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2488 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 380 ggctgaggctgaggccgagg 399 |||||||||||||||||||| Sbjct: 379 ggctgaggctgaggccgagg 398
>gb|AE001274.2| Leishmania major strain Friedlin chromosome 1, complete sequence Length = 268984 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 398 ggtggacgcggacgcggcgg 417 |||||||||||||||||||| Sbjct: 60695 ggtggacgcggacgcggcgg 60676
>gb|AC120527.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0011J22 map R10571S, complete sequence Length = 154441 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 363 gcggcagaagaggaggaggc 382 |||||||||||||||||||| Sbjct: 5386 gcggcagaagaggaggaggc 5367
>gb|AC147812.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0073K23 map near R10571S, complete sequence Length = 161073 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 363 gcggcagaagaggaggaggc 382 |||||||||||||||||||| Sbjct: 104687 gcggcagaagaggaggaggc 104668
>ref|XM_370461.1| Magnaporthe grisea 70-15 chromosome II hypothetical protein (MG06958.4) partial mRNA Length = 1956 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 373 aggaggaggctgaggctgaggccg 396 ||||||||| |||||||||||||| Sbjct: 1574 aggaggaggatgaggctgaggccg 1597
>gb|AC137942.6| Mus musculus chromosome 10, clone RP24-502K6, complete sequence Length = 173848 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 62 aaaacaagcagcaaccaaacaaaa 85 |||||||| ||||||||||||||| Sbjct: 104595 aaaacaagaagcaaccaaacaaaa 104572
>gb|AY576796.1| Actinoplanes phage phiAsp2, complete genome Length = 58638 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 384 gaggctgaggccgaggtggacgcg 407 ||||| |||||||||||||||||| Sbjct: 49030 gaggccgaggccgaggtggacgcg 49007
>ref|XM_958962.1| Neurospora crassa OR74A hypothetical protein (NCU02630.1) partial mRNA Length = 2433 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 375 gaggaggctgaggctgaggc 394 |||||||||||||||||||| Sbjct: 2410 gaggaggctgaggctgaggc 2429
>ref|XM_331828.1| Neurospora crassa OR74A hypothetical protein (NCU02630.1) partial mRNA Length = 2433 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 375 gaggaggctgaggctgaggc 394 |||||||||||||||||||| Sbjct: 2410 gaggaggctgaggctgaggc 2429
>ref|XM_583447.2| PREDICTED: Bos taurus similar to Histone H1.0 (H1(0)) (Histone H1), transcript variant 1 (LOC617975), mRNA Length = 1844 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 365 ggcagaagaggaggaggctgaggc 388 |||||||||||||||||| ||||| Sbjct: 8 ggcagaagaggaggaggcggaggc 31
>gb|AC132307.5| Mus musculus BAC clone RP24-291H9 from chromosome 18, complete sequence Length = 179465 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 62 aaaacaagcagcaaccaaacaaaa 85 |||||||||||||| ||||||||| Sbjct: 75223 aaaacaagcagcaaacaaacaaaa 75246
>ref|XM_655640.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN3128.2), mRNA Length = 4140 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 366 gcagaagaggaggaggctgaggct 389 ||||||||||||||| |||||||| Sbjct: 1153 gcagaagaggaggagtctgaggct 1176
>ref|XM_654797.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN2285.2), mRNA Length = 4839 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 146 tgggagcaagagacaagggctcgt 169 |||||||||||| ||||||||||| Sbjct: 1588 tgggagcaagaggcaagggctcgt 1565
>gb|AC124585.3| Mus musculus BAC clone RP23-130P17 from chromosome 10, complete sequence Length = 198030 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 376 aggaggctgaggctgaggccgagg 399 ||||||||||||||||||| |||| Sbjct: 66890 aggaggctgaggctgaggctgagg 66913
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 334 acggcggctgcgcctgtggcggtg 357 |||||||||||||| ||||||||| Sbjct: 2013699 acggcggctgcgccggtggcggtg 2013722
>gb|AC123944.4| Mus musculus BAC clone RP24-87F18 from chromosome 10, complete sequence Length = 194243 Score = 40.1 bits (20), Expect = 6.3 Identities = 26/28 (92%) Strand = Plus / Minus Query: 354 ggtggaggagcggcagaagaggaggagg 381 ||||| |||| ||||||||||||||||| Sbjct: 1648 ggtgggggaggggcagaagaggaggagg 1621
>gb|AC134559.5| Mus musculus BAC clone RP24-332C4 from chromosome 8, complete sequence Length = 180692 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 376 aggaggctgaggctgaggccgagg 399 |||||||| ||||||||||||||| Sbjct: 25167 aggaggctaaggctgaggccgagg 25144
>gb|AC018738.4| Homo sapiens BAC clone RP11-419H23 from 2, complete sequence Length = 178530 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 375 gaggaggctgaggctgaggc 394 |||||||||||||||||||| Sbjct: 172947 gaggaggctgaggctgaggc 172928
>emb|CR854834.11| Zebrafish DNA sequence from clone DKEYP-92B10 in linkage group 11, complete sequence Length = 140484 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 6 ctagtaaaatattacgtact 25 |||||||||||||||||||| Sbjct: 72186 ctagtaaaatattacgtact 72205
>emb|CR381650.15| Zebrafish DNA sequence from clone CH211-129F24 in linkage group 7, complete sequence Length = 137625 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 6 ctagtaaaatattacgtact 25 |||||||||||||||||||| Sbjct: 72048 ctagtaaaatattacgtact 72067
>ref|XM_759102.1| Theileria parva strain Muguga chromosome 4 hypothetical protein (TP04_0560) partial mRNA Length = 1098 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 378 gaggctgaggctgaggccgaggtg 401 ||||||||||||||||| |||||| Sbjct: 853 gaggctgaggctgaggctgaggtg 830
>gb|AC109214.6| Mus musculus chromosome 10, clone RP23-352E22, complete sequence Length = 175569 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 62 aaaacaagcagcaaccaaacaaaa 85 |||||||| ||||||||||||||| Sbjct: 151164 aaaacaagaagcaaccaaacaaaa 151187
>gb|AC005817.8| Mus musculus strain 129/Sv clone ct7-581i11 map 16, complete sequence Length = 188708 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 378 gaggctgaggctgaggccgaggtg 401 ||||||||||||||||| |||||| Sbjct: 40872 gaggctgaggctgaggctgaggtg 40895 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 378 gaggctgaggctgaggccgaggtg 401 ||||||||||||||||| |||||| Sbjct: 40810 gaggctgaggctgaggctgaggtg 40833 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 378 gaggctgaggctgaggccgaggtg 401 ||||||||||||||||| |||||| Sbjct: 40770 gaggctgaggctgaggctgaggtg 40793 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 378 gaggctgaggctgaggccgaggtg 401 ||||||||||||||||| |||||| Sbjct: 40692 gaggctgaggctgaggctgaggtg 40715 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 378 gaggctgaggctgaggccgaggtg 401 ||||||||||||||||| |||||| Sbjct: 40652 gaggctgaggctgaggctgaggtg 40675 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 378 gaggctgaggctgaggccgaggtg 401 ||||||||||||||||| |||||| Sbjct: 40629 gaggctgaggctgaggctgaggtg 40652 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 378 gaggctgaggctgaggccgaggtg 401 ||||||||||||||||| |||||| Sbjct: 40360 gaggctgaggctgaggctgaggtg 40383 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 378 gaggctgaggctgaggccgaggtg 401 ||||||||||||||||| |||||| Sbjct: 40186 gaggctgaggctgaggctgaggtg 40209 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 378 gaggctgaggctgaggccgaggtg 401 ||||||||||||||||| |||||| Sbjct: 40129 gaggctgaggctgaggctgaggtg 40152 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 378 gaggctgaggctgaggccgaggtg 401 ||||||||||||||||| |||||| Sbjct: 40072 gaggctgaggctgaggctgaggtg 40095 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 378 gaggctgaggctgaggccgaggtg 401 ||||||||||||||||| |||||| Sbjct: 40026 gaggctgaggctgaggctgaggtg 40049
>gb|BC049687.1| Mus musculus cDNA clone IMAGE:6704509, partial cds Length = 910 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 376 aggaggctgaggctgaggccgagg 399 ||||||||||||||||||| |||| Sbjct: 122 aggaggctgaggctgaggctgagg 145
>emb|AL442125.13| Human DNA sequence from clone RP11-230F18 on chromosome 13 Contains the 5' end of the gene for FLJ10704 (FLJ20092), a novel gene, a novel gene (FLJ20623), the TFDP1 gene for transcription factor Dp-1 (DP-1, DRTF1) and 5 CpG islands, complete sequence Length = 184889 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 358 gaggagcggcagaagaggaggagg 381 ||||||| |||||||||||||||| Sbjct: 120309 gaggagcagcagaagaggaggagg 120332
>emb|AL355980.6| Human DNA sequence from clone RP11-295L12 on chromosome 13, complete sequence Length = 191856 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 89 ctcgggaaaaaaggtatgtc 108 |||||||||||||||||||| Sbjct: 43409 ctcgggaaaaaaggtatgtc 43428
>emb|AL158207.15| Human DNA sequence from clone RP11-409K20 on chromosome 9 Contains the TOR1B gene for torsin family 1 member B (torsin B) (DQ1), the DYT1 gene for dystonia 1, torsion (autosomal dominant; torsin A) (DQ2, TOR1A), the gene for hepatocellular carcinoma-associated antigen 59 (HSPC220, LOC51759), the USP20 gene for ubiquitin specific protease 20 (KIAA1003), the 3' end of the FNBP1 gene for formin-binding protein 17 (FBP17), two novel genes, a 60S ribosomal protein L34 (RPL34) pseudogene and four CpG islands, complete sequence Length = 169963 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 376 aggaggctgaggctgaggcc 395 |||||||||||||||||||| Sbjct: 155016 aggaggctgaggctgaggcc 155035
>emb|AL136984.20| Human DNA sequence from clone RP11-52A20 on chromosome 1q24.1-24.3 Contains part of the POU2F1 gene for POU domain class 2 transcription factor 1, complete sequence Length = 169627 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 376 aggaggctgaggctgaggccgagg 399 ||||||||||||||||||| |||| Sbjct: 51672 aggaggctgaggctgaggctgagg 51649
>gb|AC092908.9| Homo sapiens 3q BAC RP11-757I12 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 174257 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 376 aggaggctgaggctgaggcc 395 |||||||||||||||||||| Sbjct: 18216 aggaggctgaggctgaggcc 18197
>emb|BX053311.1|CNS09DAR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC30DF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 775 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 765 gtggacgcggacgcggcggc 746
>emb|BX053310.1|CNS09DAQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30DF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 879 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 141 gtggacgcggacgcggcggc 160
>emb|BX071943.1|CNS09ROB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9CG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 915 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 869 gtggacgcggacgcggcggc 850
>emb|BX071942.1|CNS09ROA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9CG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1029 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 153 gtggacgcggacgcggcggc 172
>emb|BX071916.1|CNS09RNK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9CF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 889 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 147 gtggacgcggacgcggcggc 166
>emb|BX071881.1|CNS09RML Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9CD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 125 gtggacgcggacgcggcggc 144
>emb|BX071859.1|CNS09RLZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9CC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 829 gtggacgcggacgcggcggc 810
>emb|BX071858.1|CNS09RLY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9CC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 129 gtggacgcggacgcggcggc 148
>emb|BX071840.1|CNS09RLG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9CB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 845 gtggacgcggacgcggcggc 826
>emb|BX071839.1|CNS09RLF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9CB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1034 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 140 gtggacgcggacgcggcggc 159
>emb|BX071831.1|CNS09RL7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 870 gtggacgcggacgcggcggc 851
>emb|BX071830.1|CNS09RL6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1024 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 150 gtggacgcggacgcggcggc 169
>emb|BX071824.1|CNS09RL0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 142 gtggacgcggacgcggcggc 161
>emb|BX071802.1|CNS09RKE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9CA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 778 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 134 gtggacgcggacgcggcggc 153
>emb|BX071636.1|CNS09RFS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 791 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 140 gtggacgcggacgcggcggc 159
>emb|BX071157.1|CNS09R2H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8CC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 773 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 152 gtggacgcggacgcggcggc 171
>emb|BX071130.1|CNS09R1Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8CB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 879 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 826 gtggacgcggacgcggcggc 807
>emb|BX071129.1|CNS09R1P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8CB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 144 gtggacgcggacgcggcggc 163
>emb|BX071127.1|CNS09R1N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8CB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 924 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 862 gtggacgcggacgcggcggc 843
>emb|BX071126.1|CNS09R1M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8CB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 980 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 154 gtggacgcggacgcggcggc 173
>emb|BX071354.1|CNS09R7Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8DD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 923 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 837 gtggacgcggacgcggcggc 818
>emb|BX071353.1|CNS09R7X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8DD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 118 gtggacgcggacgcggcggc 137
>emb|BX071350.1|CNS09R7U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8DD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 316 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 119 gtggacgcggacgcggcggc 138
>emb|BX070993.1|CNS09QXX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 961 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 126 gtggacgcggacgcggcggc 145
>emb|BX070845.1|CNS09QTT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8AF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 782 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 51 gtggacgcggacgcggcggc 70
>emb|BX070796.1|CNS09QSG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 757 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 78 gtggacgcggacgcggcggc 97
>emb|BX070740.1|CNS09QQW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7DH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 866 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 134 gtggacgcggacgcggcggc 153
>emb|BX070705.1|CNS09QPX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7DF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 936 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 134 gtggacgcggacgcggcggc 153
>emb|BX070570.1|CNS09QM6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7CH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 945 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 142 gtggacgcggacgcggcggc 161
>emb|BX070282.1|CNS09QE6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7BC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 138 gtggacgcggacgcggcggc 157
>emb|BX070249.1|CNS09QD9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7BB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 688 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 1 gtggacgcggacgcggcggc 20
>emb|BX069976.1|CNS09Q5O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6DD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 890 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 865 gtggacgcggacgcggcggc 846
>emb|BX069935.1|CNS09Q4J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6DB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 844 gtggacgcggacgcggcggc 825
>emb|BX069934.1|CNS09Q4I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 936 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 158 gtggacgcggacgcggcggc 177
>emb|BX069931.1|CNS09Q4F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6DB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 943 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 842 gtggacgcggacgcggcggc 823
>emb|BX069930.1|CNS09Q4E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 989 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 136 gtggacgcggacgcggcggc 155
>emb|BX069898.1|CNS09Q3I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 969 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 114 gtggacgcggacgcggcggc 133
>emb|BX069635.1|CNS09PW7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6BE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 136 gtggacgcggacgcggcggc 155
>emb|BX061068.1|CNS09JA8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1020 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 146 gtggacgcggacgcggcggc 165
>emb|BX061021.1|CNS09J8X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 897 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 851 gtggacgcggacgcggcggc 832
>emb|BX061020.1|CNS09J8W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 998 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 142 gtggacgcggacgcggcggc 161
>emb|BX061000.1|CNS09J8C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 902 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 125 gtggacgcggacgcggcggc 144
>emb|BX069524.1|CNS09PT4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6AH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 626 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 128 gtggacgcggacgcggcggc 147
>emb|BX069320.1|CNS09PNG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53DG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 992 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 157 gtggacgcggacgcggcggc 176
>emb|BX069158.1|CNS09PIY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1036 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 144 gtggacgcggacgcggcggc 163
>emb|BX069055.1|CNS09PG3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 967 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 847 gtggacgcggacgcggcggc 828
>emb|BX069054.1|CNS09PG2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 139 gtggacgcggacgcggcggc 158
>emb|BX068863.1|CNS09PAR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53BC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1033 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 160 gtggacgcggacgcggcggc 179
>emb|BX068807.1|CNS09P97 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 152 gtggacgcggacgcggcggc 171
>emb|BX068767.1|CNS09P83 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 988 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 856 gtggacgcggacgcggcggc 837
>emb|BX068766.1|CNS09P82 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 928 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 49 gtggacgcggacgcggcggc 68
>emb|BX068577.1|CNS09P2T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 963 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 131 gtggacgcggacgcggcggc 150
>emb|BX068555.1|CNS09P27 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52DE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 851 gtggacgcggacgcggcggc 832
>emb|BX068551.1|CNS09P23 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 262 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 130 gtggacgcggacgcggcggc 149
>emb|BX068466.1|CNS09OZQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52DA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 854 gtggacgcggacgcggcggc 835
>emb|BX068465.1|CNS09OZP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 961 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 131 gtggacgcggacgcggcggc 150
>emb|BX068411.1|CNS09OY7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52CE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1034 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 149 gtggacgcggacgcggcggc 168
>emb|BX068251.1|CNS09OTR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 852 gtggacgcggacgcggcggc 833
>emb|BX068250.1|CNS09OTQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1038 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 144 gtggacgcggacgcggcggc 163
>emb|BX068238.1|CNS09OTE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 880 gtggacgcggacgcggcggc 861
>emb|BX068237.1|CNS09OTD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1067 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 155 gtggacgcggacgcggcggc 174
>emb|BX068217.1|CNS09OST Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 497 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 133 gtggacgcggacgcggcggc 152
>emb|BX068121.1|CNS09OQ5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1005 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 151 gtggacgcggacgcggcggc 170
>emb|BX068086.1|CNS09OP6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 144 gtggacgcggacgcggcggc 163
>emb|BX067992.1|CNS09OMK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52AA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 899 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 854 gtggacgcggacgcggcggc 835
>emb|BX067991.1|CNS09OMJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1010 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 152 gtggacgcggacgcggcggc 171
>emb|BX067779.1|CNS09OGN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 821 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 145 gtggacgcggacgcggcggc 164
>emb|BX067716.1|CNS09OEW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 986 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 gtggacgcggacgcggcggc 418 |||||||||||||||||||| Sbjct: 848 gtggacgcggacgcggcggc 829 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,384,991 Number of Sequences: 3902068 Number of extensions: 6384991 Number of successful extensions: 166361 Number of sequences better than 10.0: 945 Number of HSP's better than 10.0 without gapping: 949 Number of HSP's successfully gapped in prelim test: 3 Number of HSP's that attempted gapping in prelim test: 163042 Number of HSP's gapped (non-prelim): 3264 length of query: 466 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 444 effective length of database: 17,147,199,772 effective search space: 7613356698768 effective search space used: 7613356698768 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
