>dbj|AK071397.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023097A13, full
           insert sequence
          Length = 1001

 Score =  151 bits (76), Expect = 3e-33
 Identities = 115/128 (89%)
 Strand = Plus / Minus

                                                                       
Query: 388 gacttgacgatgagaacggggcagttggcgttgctgacgcagtaatcgctgacactcccg 447
           ||||||||||||||||| || ||||||||||| |||||||||||||| |||||||| || 
Sbjct: 620 gacttgacgatgagaactggacagttggcgttcctgacgcagtaatcactgacacttcca 561

                                                                       
Query: 448 aggagagccctcttgaaaaagccatagccatggctccccatgaccagcacgttggctccg 507
           || |||||||||||||| | |||||||||||||||| |||| |||||||||| ||| |||
Sbjct: 560 agcagagccctcttgaacaggccatagccatggctctccatcaccagcacgtcggcgccg 501

                   
Query: 508 agcttgtc 515
           ||||||||
Sbjct: 500 agcttgtc 493

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 64/71 (90%)
 Strand = Plus / Plus

                                                                            
Query: 388      gacttgacgatgagaacggggcagttggcgttgctgacgcagtaatcgctgacactcccg 447
                ||||||||||||||||| || ||||||||||| |||||||||||||| |||||||| || 
Sbjct: 10811627 gacttgacgatgagaactggacagttggcgttcctgacgcagtaatcactgacacttcca 10811686

                           
Query: 448      aggagagccct 458
                || ||||||||
Sbjct: 10811687 agcagagccct 10811697



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Plus

                                                                            
Query: 456      cctcttgaaaaagccatagccatggctccccatgaccagcacgttggctccgagcttgtc 515
                ||||||||| | ||||||||||||||||||||| |||||||||| ||| |||||||||||
Sbjct: 10811841 cctcttgaacaggccatagccatggctccccatcaccagcacgtcggcgccgagcttgtc 10811900

>gb|AC135908.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1275B08,
             from chromosome 3, complete sequence
          Length = 108833

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 64/71 (90%)
 Strand = Plus / Minus

                                                                         
Query: 388   gacttgacgatgagaacggggcagttggcgttgctgacgcagtaatcgctgacactcccg 447
             ||||||||||||||||| || ||||||||||| |||||||||||||| |||||||| || 
Sbjct: 43260 gacttgacgatgagaactggacagttggcgttcctgacgcagtaatcactgacacttcca 43201

                        
Query: 448   aggagagccct 458
             || ||||||||
Sbjct: 43200 agcagagccct 43190



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                         
Query: 456   cctcttgaaaaagccatagccatggctccccatgaccagcacgttggctccgagcttgtc 515
             ||||||||| | ||||||||||||||||||||| |||||||||| ||| |||||||||||
Sbjct: 43046 cctcttgaacaggccatagccatggctccccatcaccagcacgtcggcgccgagcttgtc 42987

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 64/71 (90%)
 Strand = Plus / Plus

                                                                            
Query: 388      gacttgacgatgagaacggggcagttggcgttgctgacgcagtaatcgctgacactcccg 447
                ||||||||||||||||| || ||||||||||| |||||||||||||| |||||||| || 
Sbjct: 10809728 gacttgacgatgagaactggacagttggcgttcctgacgcagtaatcactgacacttcca 10809787

                           
Query: 448      aggagagccct 458
                || ||||||||
Sbjct: 10809788 agcagagccct 10809798



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Plus

                                                                            
Query: 456      cctcttgaaaaagccatagccatggctccccatgaccagcacgttggctccgagcttgtc 515
                ||||||||| | ||||||||||||||||||||| |||||||||| ||| |||||||||||
Sbjct: 10809942 cctcttgaacaggccatagccatggctccccatcaccagcacgtcggcgccgagcttgtc 10810001

>gb|AC146766.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
            B1112E06, complete sequence
          Length = 177488

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                        
Query: 456  cctcttgaaaaagccatagccatggctccccatgaccagcacgttggctccgagcttgtc 515
            ||||||||| | ||||||||||||||||||||| || ||||||| ||| |||||||||||
Sbjct: 4737 cctcttgaacaggccatagccatggctccccatcacgagcacgtcggcgccgagcttgtc 4796



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 61/70 (87%)
 Strand = Plus / Plus

                                                                        
Query: 389  acttgacgatgagaacggggcagttggcgttgctgacgcagtaatcgctgacactcccga 448
            |||||||||||||||| || ||| ||||||| |||||||||||||| || || ||||| |
Sbjct: 4571 acttgacgatgagaactggacagctggcgttcctgacgcagtaatcactcactctcccaa 4630

                      
Query: 449  ggagagccct 458
            | ||||||||
Sbjct: 4631 gcagagccct 4640

>gb|AC104845.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
             OSJNBb0091E08, complete sequence
          Length = 119526

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                         
Query: 456   cctcttgaaaaagccatagccatggctccccatgaccagcacgttggctccgagcttgtc 515
             ||||||||| | ||||||||||||||||||||| || ||||||| ||| |||||||||||
Sbjct: 29590 cctcttgaacaggccatagccatggctccccatcacgagcacgtcggcgccgagcttgtc 29649



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 61/70 (87%)
 Strand = Plus / Plus

                                                                         
Query: 389   acttgacgatgagaacggggcagttggcgttgctgacgcagtaatcgctgacactcccga 448
             |||||||||||||||| || ||| ||||||| |||||||||||||| || || ||||| |
Sbjct: 29424 acttgacgatgagaactggacagctggcgttcctgacgcagtaatcactcactctcccaa 29483

                       
Query: 449   ggagagccct 458
             | ||||||||
Sbjct: 29484 gcagagccct 29493

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                            
Query: 456      cctcttgaaaaagccatagccatggctccccatgaccagcacgttggctccgagcttgtc 515
                ||||||||| | ||||||||||||||||||||| || ||||||| ||| |||||||||||
Sbjct: 23414077 cctcttgaacaggccatagccatggctccccatcacgagcacgtcggcgccgagcttgtc 23414136



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 61/70 (87%)
 Strand = Plus / Plus

                                                                            
Query: 389      acttgacgatgagaacggggcagttggcgttgctgacgcagtaatcgctgacactcccga 448
                |||||||||||||||| || ||| ||||||| |||||||||||||| || || ||||| |
Sbjct: 23413911 acttgacgatgagaactggacagctggcgttcctgacgcagtaatcactcactctcccaa 23413970

                          
Query: 449      ggagagccct 458
                | ||||||||
Sbjct: 23413971 gcagagccct 23413980

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                            
Query: 456      cctcttgaaaaagccatagccatggctccccatgaccagcacgttggctccgagcttgtc 515
                ||||||||| | ||||||||||||||||||||| || ||||||| ||| |||||||||||
Sbjct: 23723987 cctcttgaacaggccatagccatggctccccatcacgagcacgtcggcgccgagcttgtc 23724046



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 61/70 (87%)
 Strand = Plus / Plus

                                                                            
Query: 389      acttgacgatgagaacggggcagttggcgttgctgacgcagtaatcgctgacactcccga 448
                |||||||||||||||| || ||| ||||||| |||||||||||||| || || ||||| |
Sbjct: 23723821 acttgacgatgagaactggacagctggcgttcctgacgcagtaatcactcactctcccaa 23723880

                          
Query: 449      ggagagccct 458
                | ||||||||
Sbjct: 23723881 gcagagccct 23723890

>gb|AE017226.1| Treponema denticola ATCC 35405, complete genome
          Length = 2843201

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 134     tccgcttgaagatgccctaaa 154
               |||||||||||||||||||||
Sbjct: 1733749 tccgcttgaagatgccctaaa 1733729

>ref|XM_458958.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0D12408g)
            partial mRNA
          Length = 1701

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 467  agccatagccatggctcccc 486
            ||||||||||||||||||||
Sbjct: 1185 agccatagccatggctcccc 1204

>gb|AC133189.3| Mus musculus BAC clone RP23-354M9 from chromosome 15, complete sequence
          Length = 198577

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 220   gcccttagctcctctagcag 239
             ||||||||||||||||||||
Sbjct: 17415 gcccttagctcctctagcag 17396

>emb|AL121580.8|HSBB455A7 Human DNA sequence from clone RP13-455A7 on chromosome 22 Contains an
            STS and GSSs, complete sequence
          Length = 137139

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 365  tgaactgttcatcctgttat 384
            ||||||||||||||||||||
Sbjct: 7896 tgaactgttcatcctgttat 7915

>emb|AL096707.13|HSJ729N16 Human DNA sequence from clone RP4-729N16 on chromosome 10, complete
             sequence
          Length = 154469

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 54    atttgcataagaaatcacat 73
             ||||||||||||||||||||
Sbjct: 94629 atttgcataagaaatcacat 94648

>emb|CR382136.1| Debaryomyces hansenii chromosome D of strain CBS767 of Debaryomyces
              hansenii
          Length = 1602771

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 467    agccatagccatggctcccc 486
              ||||||||||||||||||||
Sbjct: 937071 agccatagccatggctcccc 937052

>gb|AC161455.4| Mus musculus BAC clone RP23-272N23 from chromosome 3, complete sequence
          Length = 165241

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 319   atgccaaggagcacatgcaa 338
             ||||||||||||||||||||
Sbjct: 72588 atgccaaggagcacatgcaa 72607

>gb|AC021193.7| Homo sapiens BAC clone RP11-774G5 from 4, complete sequence
          Length = 217985

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 296   agaacagttcatccagttat 315
             ||||||||||||||||||||
Sbjct: 87661 agaacagttcatccagttat 87680

>gb|AF198527.1|AF198527 Prochlorococcus marinus chlorophyll a/b binding light harvesting
           protein PCB (pcbD) gene, complete cds
          Length = 1705

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 189 ttgcttgacttcttaatgat 208
           ||||||||||||||||||||
Sbjct: 71  ttgcttgacttcttaatgat 90

>gb|AY110786.1| Zea mays CL46754_1 mRNA sequence
          Length = 608

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 435 gctgacactcccgaggagagccct 458
           |||||||||||| |||||||||||
Sbjct: 285 gctgacactcccaaggagagccct 308

>gb|AE017126.1| Prochlorococcus marinus subsp. marinus str. CCMP1375 complete genome
          Length = 1751080

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 189     ttgcttgacttcttaatgat 208
               ||||||||||||||||||||
Sbjct: 1092695 ttgcttgacttcttaatgat 1092676

>gb|AC132115.2| Mus musculus BAC clone RP24-146A13 from 1, complete sequence
          Length = 192659

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 308    ccagttattaaatgccaaggagca 331
              |||||||||||||||||| |||||
Sbjct: 156994 ccagttattaaatgccaacgagca 157017

>dbj|AB217097.1| Equus caballus DNA, microsatellite TKY3154
          Length = 163

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 151 taaaacattataaatacaag 170
           ||||||||||||||||||||
Sbjct: 88  taaaacattataaatacaag 69

>dbj|AB215921.1| Equus caballus DNA, microsatellite TKY1978
          Length = 385

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 151 taaaacattataaatacaag 170
           ||||||||||||||||||||
Sbjct: 88  taaaacattataaatacaag 69


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,404,732
Number of Sequences: 3902068
Number of extensions: 3404732
Number of successful extensions: 71044
Number of sequences better than 10.0: 22
Number of HSP's better than 10.0 without gapping: 22
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 70895
Number of HSP's gapped (non-prelim): 149
length of query: 515
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 492
effective length of database: 17,143,297,704
effective search space: 8434502470368
effective search space used: 8434502470368
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)