ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart41a12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC148025.2| Homo sapiens BAC clone RP11-347N4 from UL, comple... 42 0.81
2gb|AE017261.1| Picrophilus torridus DSM 9790, complete genome 42 0.81
3gb|AC141283.3| Homo sapiens chromosome 16 clone RP11-347N4, comp... 42 0.81
4gb|AC133561.4| Homo sapiens chromosome 16 clone RP11-598D12, com... 42 0.81
5gb|CP000148.1| Geobacter metallireducens GS-15, complete genome 40 3.2
6gb|AC008201.8| Drosophila melanogaster clone BACR11E07, complete... 40 3.2
7gb|AC146632.23| Medicago truncatula clone mth2-57b3, complete se... 40 3.2
8gb|AC123575.10| Medicago truncatula clone mth1-31p6, complete se... 40 3.2
9gb|CP000095.1| Prochlorococcus marinus str. NATL2A, complete genome 40 3.2
10gb|AC023745.3| Drosophila melanogaster X BAC RP98-26N1 (Roswell ... 40 3.2
11gb|AC023693.4| Drosophila melanogaster X BAC RP98-17B23 (Roswell... 40 3.2
12ref|NM_206547.1| Drosophila melanogaster CG10365-RD, transcript ... 40 3.2
13ref|NM_170087.1| Drosophila melanogaster CG10365-RC, transcript ... 40 3.2
14ref|NM_170086.1| Drosophila melanogaster CG10365-RB, transcript ... 40 3.2
15ref|NM_142919.1| Drosophila melanogaster CG10365-RA, transcript ... 40 3.2
16gb|AC025856.13| Homo sapiens chromosome 8, clone RP11-430K7, com... 40 3.2
17gb|AC021393.10| Homo sapiens chromosome 8, clone RP11-27P7, comp... 40 3.2
18gb|AC008223.4|AC008223 Drosophila melanogaster, chromosome 3R, r... 40 3.2
19gb|AC104655.4| Homo sapiens BAC clone RP11-383P6 from 2, complet... 40 3.2
20emb|AL929404.19| Mouse DNA sequence from clone RP23-71H9 on chro... 40 3.2
21gb|AE003744.3| Drosophila melanogaster chromosome 3R, section 82... 40 3.2
22gb|AE003484.3| Drosophila melanogaster chromosome X, section 36 ... 40 3.2
23gb|AE015451.1| Pseudomonas putida KT2440 complete genome 40 3.2
24gb|AC104883.16| Mus musculus chromosome 8, clone RP24-263A8, com... 40 3.2
25dbj|AB046643.1| Macaca fascicularis brain cDNA, clone QccE-16485 40 3.2

>gb|AC148025.2| Homo sapiens BAC clone RP11-347N4 from UL, complete sequence
          Length = 198348

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 105    ggtttaattacataatttaaa 125
              |||||||||||||||||||||
Sbjct: 183768 ggtttaattacataatttaaa 183748



to top

>gb|AE017261.1| Picrophilus torridus DSM 9790, complete genome
          Length = 1545895

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 168    aataaaatacccaagccttgg 188
              |||||||||||||||||||||
Sbjct: 493103 aataaaatacccaagccttgg 493083



to top

>gb|AC141283.3| Homo sapiens chromosome 16 clone RP11-347N4, complete sequence
          Length = 198348

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 105    ggtttaattacataatttaaa 125
              |||||||||||||||||||||
Sbjct: 183768 ggtttaattacataatttaaa 183748



to top

>gb|AC133561.4| Homo sapiens chromosome 16 clone RP11-598D12, complete sequence
          Length = 169866

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 105    ggtttaattacataatttaaa 125
              |||||||||||||||||||||
Sbjct: 142276 ggtttaattacataatttaaa 142256



to top

>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome
          Length = 3997420

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 82      gcctctccacctactcggcccacg 105
               |||||||||||| |||||||||||
Sbjct: 3361507 gcctctccaccttctcggcccacg 3361484



to top

>gb|AC008201.8| Drosophila melanogaster clone BACR11E07, complete sequence
          Length = 190153

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 56    tgagccatctatggtaacca 75
             ||||||||||||||||||||
Sbjct: 48217 tgagccatctatggtaacca 48198



to top

>gb|AC146632.23| Medicago truncatula clone mth2-57b3, complete sequence
          Length = 139216

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 104   cggtttaattacataatttaaaca 127
             ||||||||||||||| ||||||||
Sbjct: 40213 cggtttaattacatagtttaaaca 40236



 Score = 40.1 bits (20), Expect = 3.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 104   cggtttaattacataatttaaaca 127
             ||||||||||||||| ||||||||
Sbjct: 40114 cggtttaattacatagtttaaaca 40137



to top

>gb|AC123575.10| Medicago truncatula clone mth1-31p6, complete sequence
          Length = 83007

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 122   taaacagggttattcgtttt 141
             ||||||||||||||||||||
Sbjct: 19769 taaacagggttattcgtttt 19788



to top

>gb|CP000095.1| Prochlorococcus marinus str. NATL2A, complete genome
          Length = 1842899

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     tccaaactggattgtttggc 44
              ||||||||||||||||||||
Sbjct: 140672 tccaaactggattgtttggc 140691



to top

>gb|AC023745.3| Drosophila melanogaster X BAC RP98-26N1 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 179312

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 188   gtaacaatgacattgtttta 207
             ||||||||||||||||||||
Sbjct: 99470 gtaacaatgacattgtttta 99489



to top

>gb|AC023693.4| Drosophila melanogaster X BAC RP98-17B23 (Roswell Park Cancer
            Institute Drosophila BAC Library) complete sequence
          Length = 164969

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 188  gtaacaatgacattgtttta 207
            ||||||||||||||||||||
Sbjct: 4124 gtaacaatgacattgtttta 4143



to top

>ref|NM_206547.1| Drosophila melanogaster CG10365-RD, transcript variant D (CG10365),
           mRNA
          Length = 1615

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 56  tgagccatctatggtaacca 75
           ||||||||||||||||||||
Sbjct: 493 tgagccatctatggtaacca 474



to top

>ref|NM_170087.1| Drosophila melanogaster CG10365-RC, transcript variant C (CG10365),
           mRNA
          Length = 1686

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 56  tgagccatctatggtaacca 75
           ||||||||||||||||||||
Sbjct: 564 tgagccatctatggtaacca 545



to top

>ref|NM_170086.1| Drosophila melanogaster CG10365-RB, transcript variant B (CG10365),
           mRNA
          Length = 1460

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 56  tgagccatctatggtaacca 75
           ||||||||||||||||||||
Sbjct: 338 tgagccatctatggtaacca 319



to top

>ref|NM_142919.1| Drosophila melanogaster CG10365-RA, transcript variant A (CG10365),
           mRNA
          Length = 1391

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 56  tgagccatctatggtaacca 75
           ||||||||||||||||||||
Sbjct: 269 tgagccatctatggtaacca 250



to top

>gb|AC025856.13| Homo sapiens chromosome 8, clone RP11-430K7, complete sequence
          Length = 167416

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 185    ttggtaacaatgacattgttttaa 208
              ||||||||||||||||| ||||||
Sbjct: 166775 ttggtaacaatgacatttttttaa 166752



to top

>gb|AC021393.10| Homo sapiens chromosome 8, clone RP11-27P7, complete sequence
          Length = 150858

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 185   ttggtaacaatgacattgttttaa 208
             ||||||||||||||||| ||||||
Sbjct: 25701 ttggtaacaatgacatttttttaa 25678



to top

>gb|AC008223.4|AC008223 Drosophila melanogaster, chromosome 3R, region 95A-95A, BAC clone
              BACR16I18, complete sequence
          Length = 161278

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     tgagccatctatggtaacca 75
              ||||||||||||||||||||
Sbjct: 122281 tgagccatctatggtaacca 122262



to top

>gb|AC104655.4| Homo sapiens BAC clone RP11-383P6 from 2, complete sequence
          Length = 95616

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 168   aataaaatacccaagccttg 187
             ||||||||||||||||||||
Sbjct: 22300 aataaaatacccaagccttg 22319



to top

>emb|AL929404.19| Mouse DNA sequence from clone RP23-71H9 on chromosome 2, complete
              sequence
          Length = 187610

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 153    aagcttttgttgttcaataaaata 176
              |||||| |||||||||||||||||
Sbjct: 164013 aagcttctgttgttcaataaaata 164036



to top

>gb|AE003744.3| Drosophila melanogaster chromosome 3R, section 82 of 118 of the complete
              sequence
          Length = 244356

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     tgagccatctatggtaacca 75
              ||||||||||||||||||||
Sbjct: 171524 tgagccatctatggtaacca 171505



to top

>gb|AE003484.3| Drosophila melanogaster chromosome X, section 36 of 74 of the complete
              sequence
          Length = 314111

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 188    gtaacaatgacattgtttta 207
              ||||||||||||||||||||
Sbjct: 154521 gtaacaatgacattgtttta 154540



to top

>gb|AE015451.1| Pseudomonas putida KT2440 complete genome
          Length = 6181863

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 41      tggccatgtaaaggctgagc 60
               ||||||||||||||||||||
Sbjct: 5723122 tggccatgtaaaggctgagc 5723141



to top

>gb|AC104883.16| Mus musculus chromosome 8, clone RP24-263A8, complete sequence
          Length = 198707

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 28     aaactggattgtttggccat 47
              ||||||||||||||||||||
Sbjct: 117492 aaactggattgtttggccat 117511



to top

>dbj|AB046643.1| Macaca fascicularis brain cDNA, clone QccE-16485
          Length = 1916

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 168 aataaaatacccaagccttg 187
           ||||||||||||||||||||
Sbjct: 695 aataaaatacccaagccttg 714


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,498,481
Number of Sequences: 3902068
Number of extensions: 2498481
Number of successful extensions: 45204
Number of sequences better than 10.0: 25
Number of HSP's better than 10.0 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45147
Number of HSP's gapped (non-prelim): 57
length of query: 247
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 225
effective length of database: 17,147,199,772
effective search space: 3858119948700
effective search space used: 3858119948700
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top