ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart41a09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AJ495769.1|HVU495769 Hordeum vulgare mRNA for putative immun... 922 0.0
2dbj|AK063115.1| Oryza sativa (japonica cultivar-group) cDNA clon... 196 5e-47
3gb|AY105607.1| Zea mays PCO107138 mRNA sequence 176 5e-41
4gb|AC108763.2| Oryza sativa (japonica cultivar-group) chromosome... 103 6e-19
5dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 103 6e-19
6gb|U52045.1|VFU52045 Vicia faba immunophilin precursor (FKBP15) ... 80 8e-12
7ref|XM_367309.1| Magnaporthe grisea 70-15 hypothetical protein (... 48 0.028
8gb|AC171266.22| Medicago truncatula clone mth2-14o4, complete se... 48 0.028
9dbj|AB227133.1| Aspergillus oryzae cDNA, contig sequence: AoEST3996 44 0.44
10emb|AL112386.1|CNS01A22 Botrytis cinerea strain T4 cDNA library 44 0.44
11gb|AC083845.15| Homo sapiens, clone RP11-459L5, complete sequence 42 1.8
12dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005 42 1.8
13gb|AC103817.6| Homo sapiens chromosome 8, clone CTD-3083F21, com... 42 1.8
14gb|AC108828.17| Mus musculus chromosome 5, clone RP23-153H17, co... 42 1.8
15gb|AY423023.1| Danio rerio KIAA1376-like protein mRNA, complete cds 40 6.9
16ref|XM_636926.1| Dictyostelium discoideum hypothetical protein (... 40 6.9
17gb|AC008337.8| Drosophila melanogaster clone BACR02B03, complete... 40 6.9
18gb|AC012376.12| Drosophila melanogaster clone BACR48C12, complet... 40 6.9
19gb|AC158586.8| Mus musculus chromosome 5, clone RP24-372A2, comp... 40 6.9
20gb|AC124418.4| Mus musculus BAC clone RP24-318G17 from chromosom... 40 6.9
21gb|AC125402.3| Mus musculus BAC clone RP24-539G2 from chromosome... 40 6.9
22ref|XM_664590.1| Plasmodium berghei strain ANKA hypothetical pro... 40 6.9
23emb|AL162853.17| Human DNA sequence from clone RP11-363G2 on chr... 40 6.9
24gb|AC069223.15| Homo sapiens 3 BAC RP11-398O21 (Roswell Park Can... 40 6.9
25emb|BX530062.10| Zebrafish DNA sequence from clone DKEY-13M1 in ... 40 6.9
26gb|AC123021.9| Homo sapiens 12 BAC RP11-255P23 (Roswell Park Can... 40 6.9
27gb|AC068763.11| Homo sapiens 3 BAC RP11-133K20 (Roswell Park Can... 40 6.9
28gb|AC090679.5| Homo sapiens 12 BAC RP11-80O3 (Roswell Park Cance... 40 6.9
29ref|NM_133149.2| Drosophila melanogaster CG8051-RA (CG8051), mRNA 40 6.9
30gb|AC021873.24| Homo sapiens 3 BAC RP11-475J9 (Roswell Park Canc... 40 6.9
31gb|AC021118.6| Homo sapiens BAC clone RP11-332D24 from 4, comple... 40 6.9
32gb|AY069861.1| Drosophila melanogaster SD10554 full length cDNA 40 6.9
33gb|AC159628.2| Mus musculus BAC clone RP24-206C4 from chromosome... 40 6.9
34gb|AC102411.12| Mus musculus chromosome 18, clone RP24-374D7, co... 40 6.9
35gb|AC157276.2| Mus musculus BAC clone RP23-426N20 from chromosom... 40 6.9
36gb|AF080439.1|AF080439 Plasmodium berghei merozoite surface prot... 40 6.9
37gb|AE003511.4| Drosophila melanogaster chromosome X, section 63 ... 40 6.9
38gb|AC161481.4| Mus musculus chromosome 18, clone RP23-336C20, co... 40 6.9
39gb|BC068345.1| Danio rerio arrestin domain containing 2, mRNA (c... 40 6.9
40ref|NM_199939.1| Danio rerio arrestin domain containing 2 (arrdc... 40 6.9 
>emb|AJ495769.1|HVU495769 Hordeum vulgare mRNA for putative immunophilin
          Length = 835

 Score =  922 bits (465), Expect = 0.0
 Identities = 503/513 (98%), Gaps = 2/513 (0%)
 Strand = Plus / Minus

                                                                       
Query: 2   ttcaaatccaaatcgacatgacttgtctttataaccattccacgaacaa-aagcaaatgt 60
           |||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 819 ttcagatccaaatcgacatgacttgtctttataaccattccacgaacaataagcaaatgt 760

                                                                       
Query: 61  aacatggtagataggagaattattccagagaattacataggataacaaaagtcacttgat 120
           ||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 759 aacatggtagatatgagaattattccagagaattacataggataactaaagtcacttgat 700

                                                                       
Query: 121 ctattcgattttgacaactaaactcctttgtttgaccatggtaataaaatgttcatgtct 180
           |||||||||||||||||| | ||||||||||||||||||||||||| |||||||||||||
Sbjct: 699 ctattcgattttgacaaccagactcctttgtttgaccatggtaatagaatgttcatgtct 640

                                                                       
Query: 181 cattgcgtctgccctacaagagtaagttcccc-atacatagtcctattcgatttggtaac 239
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 639 cattgcgtctgccctacaagagtaagttcccctatacatagtcctattcgatttggtaac 580

                                                                       
Query: 240 tgggcgaacttgctgcgccgagctgcctacagatcactatcagcgacatcctcgtctgat 299
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 579 tgggcgaacttgctgcgccgagctgcctacagatcactatcagcgacatcctcgtctgat 520

                                                                       
Query: 300 ttgctaaaaggctcgccattgactgcgacaagctctgtgtcgaatatgaaagttgctccg 359
           |||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 519 ttgctagaaggctcgccattgactgcgacaagctctgtgtcgaatatgagagttgctccg 460

                                                                       
Query: 360 cctggaatggtaggtggtgatccctgatccccgtagccgagctttgaagggatcttcagc 419
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 459 cctggaatggtaggtggtgatccctgatccccgtagccgagctttgaagggatcttcagc 400

                                                                       
Query: 420 ttcctcttctcaccaatgcacatgcccaaaattccctgatcccatcctttgatcacttga 479
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 399 ttcctcttctcaccaatgcacatgcccaaaattccctgatcccatcctttgatcacttga 340

                                            
Query: 480 ccagtgcccaattcaaattcaattgggtcaccc 512
           |||||||||||||||||||||||||||||||||
Sbjct: 339 ccagtgcccaattcaaattcaattgggtcaccc 307
to top
>dbj|AK063115.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-111-D12, full
           insert sequence
          Length = 683

 Score =  196 bits (99), Expect = 5e-47
 Identities = 177/203 (87%)
 Strand = Plus / Minus

                                                                       
Query: 309 ggctcgccattgactgcgacaagctctgtgtcgaatatgaaagttgctccgcctggaatg 368
           |||||||||||||| || |||||||| || ||||| |||| ||| ||||| || || |||
Sbjct: 464 ggctcgccattgacagcaacaagctcggtatcgaaaatgagagtcgctccaccagggatg 405

                                                                       
Query: 369 gtaggtggtgatccctgatccccgtagccgagctttgaagggatcttcagcttcctcttc 428
           || || ||||| || ||| | || || |||||||||||||||||||||||||||||||||
Sbjct: 404 gtcggcggtgacccttgagcaccataaccgagctttgaagggatcttcagcttcctcttc 345

                                                                       
Query: 429 tcaccaatgcacatgcccaaaattccctgatcccatcctttgatcacttgaccagtgccc 488
           || |||| ||||||||||| ||| ||||||||||| |||||||||||||| |||||||||
Sbjct: 344 tcgccaacgcacatgcccagaatgccctgatcccaccctttgatcacttggccagtgccc 285

                                  
Query: 489 aattcaaattcaattgggtcacc 511
           || |||||||| |||||||||||
Sbjct: 284 aactcaaattcgattgggtcacc 262
to top
>gb|AY105607.1| Zea mays PCO107138 mRNA sequence
          Length = 808

 Score =  176 bits (89), Expect = 5e-41
 Identities = 170/197 (86%)
 Strand = Plus / Minus

                                                                       
Query: 315 ccattgactgcgacaagctctgtgtcgaatatgaaagttgctccgcctggaatggtaggt 374
           |||||||| ||||||||||| ||||| |||||||  |||||||| || ||||| ||||||
Sbjct: 508 ccattgacagcgacaagctccgtgtcaaatatgagggttgctccaccaggaatagtaggt 449

                                                                       
Query: 375 ggtgatccctgatccccgtagccgagctttgaagggatcttcagcttcctcttctcacca 434
           || || || |||  ||| ||||| |||||||| |||||||||| ||||| ||| ||||||
Sbjct: 448 ggcgagccttgaggcccatagccaagctttgatgggatcttcaacttccgcttttcacca 389

                                                                       
Query: 435 atgcacatgcccaaaattccctgatcccatcctttgatcacttgaccagtgcccaattca 494
           | |||||| ||||  |  |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 388 acgcacattcccaggagaccctgatcccatcctttgatcacttgtccagtgcccaattca 329

                            
Query: 495 aattcaattgggtcacc 511
           |||||||| ||||||||
Sbjct: 328 aattcaatcgggtcacc 312
to top
>gb|AC108763.2| Oryza sativa (japonica cultivar-group) chromosome 9 BAC clone
             OSJNBb0004A05, complete sequence
          Length = 157913

 Score =  103 bits (52), Expect = 6e-19
 Identities = 64/68 (94%)
 Strand = Plus / Plus

                                                                         
Query: 396   ccgagctttgaagggatcttcagcttcctcttctcaccaatgcacatgcccaaaattccc 455
             ||||||||||||||||||||||||||||||||||| |||| ||||||||||| ||| |||
Sbjct: 54688 ccgagctttgaagggatcttcagcttcctcttctcgccaacgcacatgcccagaatgccc 54747

                     
Query: 456   tgatccca 463
             ||||||||
Sbjct: 54748 tgatccca 54755



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                            
Query: 465   cctttgatcacttgaccagtgcccaattcaaattcaattgggtcacc 511
             |||||||||||||| ||||||||||| |||||||| |||||||||||
Sbjct: 54865 cctttgatcacttggccagtgcccaactcaaattcgattgggtcacc 54911



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                    
Query: 309   ggctcgccattgactgcgacaagctctgtgtcgaatatgaaagttgctccgcctg 363
             |||||||||||||| || |||||||| || ||||| |||| ||| ||||| ||||
Sbjct: 54371 ggctcgccattgacagcaacaagctcggtatcgaaaatgagagtcgctccacctg 54425
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  103 bits (52), Expect = 6e-19
 Identities = 64/68 (94%)
 Strand = Plus / Plus

                                                                            
Query: 396      ccgagctttgaagggatcttcagcttcctcttctcaccaatgcacatgcccaaaattccc 455
                ||||||||||||||||||||||||||||||||||| |||| ||||||||||| ||| |||
Sbjct: 19124275 ccgagctttgaagggatcttcagcttcctcttctcgccaacgcacatgcccagaatgccc 19124334

                        
Query: 456      tgatccca 463
                ||||||||
Sbjct: 19124335 tgatccca 19124342



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                               
Query: 465      cctttgatcacttgaccagtgcccaattcaaattcaattgggtcacc 511
                |||||||||||||| ||||||||||| |||||||| |||||||||||
Sbjct: 19124452 cctttgatcacttggccagtgcccaactcaaattcgattgggtcacc 19124498



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                       
Query: 309      ggctcgccattgactgcgacaagctctgtgtcgaatatgaaagttgctccgcctg 363
                |||||||||||||| || |||||||| || ||||| |||| ||| ||||| ||||
Sbjct: 19123958 ggctcgccattgacagcaacaagctcggtatcgaaaatgagagtcgctccacctg 19124012
to top
>gb|U52045.1|VFU52045 Vicia faba immunophilin precursor (FKBP15) mRNA, complete cds
          Length = 750

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 127/156 (81%)
 Strand = Plus / Minus

                                                                       
Query: 327 acaagctctgtgtcgaatatgaaagttgctccgcctggaatggtaggtggtgatccctga 386
           |||||||| ||||| ||||| |  ||||| || |||||||| || ||||| || ||||| 
Sbjct: 484 acaagctcagtgtcaaatataagtgttgcaccacctggaatagttggtggggaaccctgc 425

                                                                       
Query: 387 tccccgtagccgagctttgaagggatcttcagcttcctcttctcaccaatgcacatgccc 446
           || || ||||| || ||||  ||||| ||||| || | |||||||||||  ||||| |||
Sbjct: 424 tctccatagccaagttttgctgggattttcagttttcgcttctcaccaagacacattccc 365

                                               
Query: 447 aaaattccctgatcccatcctttgatcacttgacca 482
           || | ||| || ||||||||||||||||||||||||
Sbjct: 364 aataatccttggtcccatcctttgatcacttgacca 329
to top
>ref|XM_367309.1| Magnaporthe grisea 70-15 hypothetical protein (MG07234.4) partial
           mRNA
          Length = 603

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 421 tcctcttctcaccaatgcacatgcccaaaattccctgatcccatcctttgatcact 476
           |||||||||| |||||||||||| |||| | ||| |||||||| || || ||||||
Sbjct: 328 tcctcttctcgccaatgcacatgtccaacaatccttgatcccagcccttaatcact 273
to top
>gb|AC171266.22| Medicago truncatula clone mth2-14o4, complete sequence
          Length = 137052

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 87/108 (80%)
 Strand = Plus / Minus

                                                                         
Query: 360   cctggaatggtaggtggtgatccctgatccccgtagccgagctttgaagggatcttcagc 419
             |||||||| || ||||| || ||||| || ||||||||||| ||||  || || ||||| 
Sbjct: 19873 cctggaatagtgggtggggaaccctgctctccgtagccgagttttgctggtattttcagt 19814

                                                             
Query: 420   ttcctcttctcaccaatgcacatgcccaaaattccctgatcccatcct 467
             || | |||||||||||  ||||| ||||| | ||| || |||||||||
Sbjct: 19813 tttcgcttctcaccaagacacattcccaataatccttggtcccatcct 19766
to top
>dbj|AB227133.1| Aspergillus oryzae cDNA, contig sequence: AoEST3996
          Length = 569

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 425 cttctcaccaatgcacatgcccaaaattccctgatcccatcc 466
           ||||||||||||||||||  ||||||  |||| |||||||||
Sbjct: 366 cttctcaccaatgcacatatccaaaagaccctcatcccatcc 325
to top
>emb|AL112386.1|CNS01A22 Botrytis cinerea strain T4 cDNA library
          Length = 900

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 61  aacatggtagataggagaatta 82
           ||||||||||||||||||||||
Sbjct: 577 aacatggtagataggagaatta 556
to top
>gb|AC083845.15| Homo sapiens, clone RP11-459L5, complete sequence
          Length = 132843

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 188   tctgccctacaagagtaagttcccc 212
             |||||| ||||||||||||||||||
Sbjct: 40449 tctgccttacaagagtaagttcccc 40425
to top
>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005
          Length = 4429080

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                        
Query: 425     cttctcaccaatgcacatgcccaaaattccctgatcccatc 465
               ||||||||||||||||||  ||||||  |||| ||||||||
Sbjct: 4024960 cttctcaccaatgcacatatccaaaagaccctcatcccatc 4024920
to top
>gb|AC103817.6| Homo sapiens chromosome 8, clone CTD-3083F21, complete sequence
          Length = 203148

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 188    tctgccctacaagagtaagttcccc 212
              |||||| ||||||||||||||||||
Sbjct: 164025 tctgccttacaagagtaagttcccc 164001
to top
>gb|AC108828.17| Mus musculus chromosome 5, clone RP23-153H17, complete sequence
          Length = 218103

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 46     aacaaaagcaaatgtaacatg 66
              |||||||||||||||||||||
Sbjct: 183621 aacaaaagcaaatgtaacatg 183601
to top
>gb|AY423023.1| Danio rerio KIAA1376-like protein mRNA, complete cds
          Length = 2687

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 440  catgcccaaaattccctgat 459
            ||||||||||||||||||||
Sbjct: 1795 catgcccaaaattccctgat 1776
to top
>ref|XM_636926.1| Dictyostelium discoideum hypothetical protein (DDB0204309), partial
           mRNA
          Length = 483

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 453 ccctgatcccatcctttgatcacttgac 480
           |||| ||||||||||||||| |||||||
Sbjct: 341 ccctcatcccatcctttgatgacttgac 314
to top
>gb|AC008337.8| Drosophila melanogaster clone BACR02B03, complete sequence
          Length = 169680

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 432   ccaatgcacatgcccaaaat 451
             ||||||||||||||||||||
Sbjct: 91503 ccaatgcacatgcccaaaat 91522
to top
>gb|AC012376.12| Drosophila melanogaster clone BACR48C12, complete sequence
          Length = 183048

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 432   ccaatgcacatgcccaaaat 451
             ||||||||||||||||||||
Sbjct: 43716 ccaatgcacatgcccaaaat 43735
to top
>gb|AC158586.8| Mus musculus chromosome 5, clone RP24-372A2, complete sequence
          Length = 196167

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 415   tcagcttcctcttctcacca 434
             ||||||||||||||||||||
Sbjct: 60910 tcagcttcctcttctcacca 60891
to top
>gb|AC124418.4| Mus musculus BAC clone RP24-318G17 from chromosome 18, complete
             sequence
          Length = 167998

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 415   tcagcttcctcttctcacca 434
             ||||||||||||||||||||
Sbjct: 16939 tcagcttcctcttctcacca 16958
to top
>gb|AC125402.3| Mus musculus BAC clone RP24-539G2 from chromosome 5, complete sequence
          Length = 163773

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 415   tcagcttcctcttctcacca 434
             ||||||||||||||||||||
Sbjct: 45752 tcagcttcctcttctcacca 45771
to top
>ref|XM_664590.1| Plasmodium berghei strain ANKA hypothetical protein (PB404024.00.0)
           partial mRNA
          Length = 150

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 160 ggtaataaaatgttcatgtc 179
           ||||||||||||||||||||
Sbjct: 12  ggtaataaaatgttcatgtc 31
to top
>emb|AL162853.17| Human DNA sequence from clone RP11-363G2 on chromosome 13 Contains a
             ribosomal protein L7a (RPL7A) pseudogene, a pseudogene
             similar to part of inositol hexakisphosphate kinase 1
             (IHPK1) (KIAA0263), a novel pseudogene, a novel gene and 2
             CpG islands, complete sequence
          Length = 123693

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 400   gctttgaagggatcttcagc 419
             ||||||||||||||||||||
Sbjct: 24830 gctttgaagggatcttcagc 24849
to top
>gb|AC069223.15| Homo sapiens 3 BAC RP11-398O21 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 179767

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 74    ggagaattattccagagaat 93
             ||||||||||||||||||||
Sbjct: 11287 ggagaattattccagagaat 11268
to top
>emb|BX530062.10| Zebrafish DNA sequence from clone DKEY-13M1 in linkage group 11, complete
              sequence
          Length = 144678

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 440    catgcccaaaattccctgat 459
              ||||||||||||||||||||
Sbjct: 132909 catgcccaaaattccctgat 132890
to top
>gb|AC123021.9| Homo sapiens 12 BAC RP11-255P23 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 104395

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 91     aattacataggataacaaaa 110
              ||||||||||||||||||||
Sbjct: 102581 aattacataggataacaaaa 102562
to top
>gb|AC068763.11| Homo sapiens 3 BAC RP11-133K20 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 180638

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 74     ggagaattattccagagaat 93
              ||||||||||||||||||||
Sbjct: 157154 ggagaattattccagagaat 157173
to top
>gb|AC090679.5| Homo sapiens 12 BAC RP11-80O3 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 156596

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 91     aattacataggataacaaaa 110
              ||||||||||||||||||||
Sbjct: 156377 aattacataggataacaaaa 156396
to top
>ref|NM_133149.2| Drosophila melanogaster CG8051-RA (CG8051), mRNA
          Length = 2567

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 432  ccaatgcacatgcccaaaat 451
            ||||||||||||||||||||
Sbjct: 1964 ccaatgcacatgcccaaaat 1945
to top
>gb|AC021873.24| Homo sapiens 3 BAC RP11-475J9 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 9745

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 74   ggagaattattccagagaat 93
            ||||||||||||||||||||
Sbjct: 3132 ggagaattattccagagaat 3113
to top
>gb|AC021118.6| Homo sapiens BAC clone RP11-332D24 from 4, complete sequence
          Length = 194612

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    catgacttgtctttataacc 37
             ||||||||||||||||||||
Sbjct: 91045 catgacttgtctttataacc 91064
to top
>gb|AY069861.1| Drosophila melanogaster SD10554 full length cDNA
          Length = 2548

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 432  ccaatgcacatgcccaaaat 451
            ||||||||||||||||||||
Sbjct: 1933 ccaatgcacatgcccaaaat 1914
to top
>gb|AC159628.2| Mus musculus BAC clone RP24-206C4 from chromosome 12, complete sequence
          Length = 161791

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 156   ccatggtaataaaatgttca 175
             ||||||||||||||||||||
Sbjct: 94730 ccatggtaataaaatgttca 94711
to top
>gb|AC102411.12| Mus musculus chromosome 18, clone RP24-374D7, complete sequence
          Length = 171918

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 415   tcagcttcctcttctcacca 434
             ||||||||||||||||||||
Sbjct: 99903 tcagcttcctcttctcacca 99922
to top
>gb|AC157276.2| Mus musculus BAC clone RP23-426N20 from chromosome 12, complete sequence
          Length = 220385

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccatggtaataaaatgttca 175
              ||||||||||||||||||||
Sbjct: 216727 ccatggtaataaaatgttca 216746
to top
>gb|AF080439.1|AF080439 Plasmodium berghei merozoite surface protein 4/5 (MSP4/5) gene,
           complete cds
          Length = 704

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 160 ggtaataaaatgttcatgtc 179
           ||||||||||||||||||||
Sbjct: 566 ggtaataaaatgttcatgtc 585
to top
>gb|AE003511.4| Drosophila melanogaster chromosome X, section 63 of 74 of the complete
              sequence
          Length = 297969

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 432    ccaatgcacatgcccaaaat 451
              ||||||||||||||||||||
Sbjct: 246825 ccaatgcacatgcccaaaat 246844
to top
>gb|AC161481.4| Mus musculus chromosome 18, clone RP23-336C20, complete sequence
          Length = 210643

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 415   tcagcttcctcttctcacca 434
             ||||||||||||||||||||
Sbjct: 10144 tcagcttcctcttctcacca 10125
to top
>gb|BC068345.1| Danio rerio arrestin domain containing 2, mRNA (cDNA clone MGC:85652
            IMAGE:6805919), complete cds
          Length = 2522

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 440  catgcccaaaattccctgat 459
            ||||||||||||||||||||
Sbjct: 1639 catgcccaaaattccctgat 1620
to top
>ref|NM_199939.1| Danio rerio arrestin domain containing 2 (arrdc2), mRNA
          Length = 2687

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 440  catgcccaaaattccctgat 459
            ||||||||||||||||||||
Sbjct: 1795 catgcccaaaattccctgat 1776


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,410,987
Number of Sequences: 3902068
Number of extensions: 4410987
Number of successful extensions: 82609
Number of sequences better than 10.0: 40
Number of HSP's better than 10.0 without gapping: 40
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 82479
Number of HSP's gapped (non-prelim): 128
length of query: 512
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 489
effective length of database: 17,143,297,704
effective search space: 8383072577256
effective search space used: 8383072577256
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top