ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart40g08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
2dbj|AP003685.3| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
3dbj|AK065261.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 1e-06
4dbj|AK110292.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
5emb|BX053495.1|CNS09DFV Single read from an extremity of a full-... 46 0.088
6emb|BX053494.1|CNS09DFU Single read from an extremity of a full-... 46 0.088
7emb|BX069275.1|CNS09PM7 Single read from an extremity of a full-... 46 0.088
8emb|BX059546.1|CNS09I3Y Single read from an extremity of a full-... 46 0.088
9emb|BX045917.1|CNS097LD Single read from an extremity of a full-... 46 0.088
10emb|BX045916.1|CNS097LC Single read from an extremity of a full-... 46 0.088
11emb|BX043476.1|CNS095PK Single read from an extremity of a full-... 46 0.088
12emb|BX043545.1|CNS095RH Single read from an extremity of a full-... 46 0.088
13emb|BX043544.1|CNS095RG Single read from an extremity of a full-... 46 0.088
14emb|BX032973.1|CNS08XLT Single read from an extremity of a full-... 46 0.088
15emb|BX032972.1|CNS08XLS Single read from an extremity of a full-... 46 0.088
16emb|BX027425.1|CNS08TBP Single read from an extremity of a full-... 46 0.088
17emb|BX025264.1|CNS08RNO Single read from an extremity of a full-... 46 0.088
18emb|BX025263.1|CNS08RNN Single read from an extremity of a full-... 46 0.088
19emb|BX023395.1|CNS08Q7R Single read from an extremity of a full-... 46 0.088
20emb|BX023394.1|CNS08Q7Q Single read from an extremity of a full-... 46 0.088
21emb|BX010692.1|CNS08GEW Single read from an extremity of a full-... 46 0.088
22emb|BX010691.1|CNS08GEV Single read from an extremity of a full-... 46 0.088
23emb|BX470072.8| Zebrafish DNA sequence from clone DKEY-163I6 in ... 46 0.088
24ref|XM_308669.2| Anopheles gambiae str. PEST ENSANGP00000011257 ... 46 0.088
25gb|AC098849.9| Mus musculus chromosome 3, clone RP23-12L23, comp... 44 0.35
26gb|AC116728.12| Mus musculus chromosome 3, clone RP23-345H12, co... 44 0.35
27ref|NM_130144.3| Arabidopsis thaliana ATP binding / ATP-dependen... 42 1.4
28gb|AC153973.33| Mus musculus 10 BAC RP24-158P6 (Roswell Park Can... 42 1.4
29gb|BC072999.1| Xenopus laevis MGC82580 protein, mRNA (cDNA clone... 42 1.4
30ref|XM_722374.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 42 1.4
31ref|XM_670717.1| Plasmodium berghei strain ANKA ribosomal large ... 42 1.4
32gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map... 42 1.4
33gb|AC160147.6| Mus musculus 10 BAC RP24-576A6 (Roswell Park Canc... 42 1.4
34gb|AC113448.14| Mus musculus chromosome 15, clone RP23-1N23, com... 40 5.4
35gb|AC099415.4| Mus musculus BAC clone RP23-122D8 from chromosome... 40 5.4
36gb|AY999090.1| Bubalus bubalis acyl-CoA 1,2-diacylglycerol O-tra... 40 5.4
37emb|AJ318490.1|BTA318490 Bos taurus dgat gene for Acyl-CoA:1,2-d... 40 5.4
38gb|AC126672.3| Mus musculus BAC clone RP24-473A18 from chromosom... 40 5.4
39gb|AC160461.3| Mus musculus chromosome 15, clone RP23-174B9, com... 40 5.4
40gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 40 5.4
41gb|AE005856.1| Caulobacter crescentus CB15 section 182 of 359 of... 40 5.4
42dbj|AK137118.1| Mus musculus 12 days embryo embryonic body betwe... 40 5.4
43gb|AY065621.1| Bos taurus diacylglycerol acyltransferase 1 (DGAT... 40 5.4
44emb|AL935286.14| Zebrafish DNA sequence from clone CH211-198E14 ... 40 5.4
45gb|AC105762.4| Homo sapiens BAC clone RP11-689P15 from 2, comple... 40 5.4
46gb|AC135112.5| Mus musculus BAC clone RP23-477F17 from chromosom... 40 5.4
47gb|AC009232.3| Homo sapiens BAC clone RP11-352J11 from 2, comple... 40 5.4
48gb|AC007685.2|AC007685 Homo sapiens BAC clone RP11-558O12 from Y... 40 5.4
49gb|AC131568.5| Homo sapiens chromosome 8, clone RP11-1146N6, com... 40 5.4
50emb|BX571734.7| Mouse DNA sequence from clone RP23-334P23 on chr... 40 5.4
51dbj|AK057900.1| Homo sapiens cDNA FLJ25171 fis, clone CBR08758 40 5.4
52emb|BX950190.12| Zebrafish DNA sequence from clone DKEY-190N7 in... 40 5.4
53dbj|AP005715.3| Homo sapiens genomic DNA, chromosome 8q24, clone... 40 5.4
54gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 40 5.4
55gb|AC122220.4| Mus musculus BAC clone RP23-122B15 from 9, comple... 40 5.4
56emb|AL627302.20| Mouse DNA sequence from clone RP23-272D10 on ch... 40 5.4
57emb|AL117209.7|CNS01DRH Human chromosome 14 DNA sequence BAC R-3... 40 5.4
58dbj|AP000886.3| Homo sapiens genomic DNA, chromosome 6q25.2, clo... 40 5.4 
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                                
Query: 220      ccctccgcgcccaacctcccgctcccgcagcacgcgctatcggcgttc 267
                ||||||||||||| ||||||||  |||||||||||||| |||||||||
Sbjct: 30312812 ccctccgcgcccagcctcccgccgccgcagcacgcgctgtcggcgttc 30312859



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                                   
Query: 221      cctccgcgcccaacctcccgctcccgcagcacgcg 255
                |||||||||||| ||||||||||||||||||||||
Sbjct: 30322609 cctccgcgcccagcctcccgctcccgcagcacgcg 30322643
to top
>dbj|AP003685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0548E04
          Length = 138037

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                             
Query: 220   ccctccgcgcccaacctcccgctcccgcagcacgcgctatcggcgttc 267
             ||||||||||||| ||||||||  |||||||||||||| |||||||||
Sbjct: 59407 ccctccgcgcccagcctcccgccgccgcagcacgcgctgtcggcgttc 59454



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                                
Query: 221   cctccgcgcccaacctcccgctcccgcagcacgcg 255
             |||||||||||| ||||||||||||||||||||||
Sbjct: 69204 cctccgcgcccagcctcccgctcccgcagcacgcg 69238
to top
>dbj|AK065261.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002J21, full
           insert sequence
          Length = 1430

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 221 cctccgcgcccaacctcccgctcccgcagcacgcg 255
           |||||||||||| ||||||||||||||||||||||
Sbjct: 987 cctccgcgcccagcctcccgctcccgcagcacgcg 953
to top
>dbj|AK110292.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-163-G01, full
            insert sequence
          Length = 1588

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 220  ccctccgcgcccaacctcccgctcccgcagcacgcgctatcggcgttc 267
            ||||||||||||| ||||||||  ||| |||||||||| |||||||||
Sbjct: 1148 ccctccgcgcccagcctcccgccgccgtagcacgcgctgtcggcgttc 1101
to top
>emb|BX053495.1|CNS09DFV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 53  tcttctcggccagctccttgaag 75
           |||||||||||||||||||||||
Sbjct: 492 tcttctcggccagctccttgaag 514
to top
>emb|BX053494.1|CNS09DFU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 53  tcttctcggccagctccttgaag 75
           |||||||||||||||||||||||
Sbjct: 322 tcttctcggccagctccttgaag 300
to top
>emb|BX069275.1|CNS09PM7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 415

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 53  tcttctcggccagctccttgaag 75
           |||||||||||||||||||||||
Sbjct: 319 tcttctcggccagctccttgaag 297
to top
>emb|BX059546.1|CNS09I3Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 53  tcttctcggccagctccttgaag 75
           |||||||||||||||||||||||
Sbjct: 318 tcttctcggccagctccttgaag 296
to top
>emb|BX045917.1|CNS097LD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 791

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 53  tcttctcggccagctccttgaag 75
           |||||||||||||||||||||||
Sbjct: 717 tcttctcggccagctccttgaag 739
to top
>emb|BX045916.1|CNS097LC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 53  tcttctcggccagctccttgaag 75
           |||||||||||||||||||||||
Sbjct: 291 tcttctcggccagctccttgaag 269
to top
>emb|BX043476.1|CNS095PK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC16AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 872

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 53  tcttctcggccagctccttgaag 75
           |||||||||||||||||||||||
Sbjct: 492 tcttctcggccagctccttgaag 514
to top
>emb|BX043545.1|CNS095RH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC16BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 53  tcttctcggccagctccttgaag 75
           |||||||||||||||||||||||
Sbjct: 492 tcttctcggccagctccttgaag 514
to top
>emb|BX043544.1|CNS095RG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 53  tcttctcggccagctccttgaag 75
           |||||||||||||||||||||||
Sbjct: 341 tcttctcggccagctccttgaag 319
to top
>emb|BX032973.1|CNS08XLT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 53  tcttctcggccagctccttgaag 75
           |||||||||||||||||||||||
Sbjct: 721 tcttctcggccagctccttgaag 743
to top
>emb|BX032972.1|CNS08XLS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 53  tcttctcggccagctccttgaag 75
           |||||||||||||||||||||||
Sbjct: 328 tcttctcggccagctccttgaag 306
to top
>emb|BX027425.1|CNS08TBP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 53  tcttctcggccagctccttgaag 75
           |||||||||||||||||||||||
Sbjct: 267 tcttctcggccagctccttgaag 245
to top
>emb|BX025264.1|CNS08RNO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38CH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 667

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 53  tcttctcggccagctccttgaag 75
           |||||||||||||||||||||||
Sbjct: 492 tcttctcggccagctccttgaag 514
to top
>emb|BX025263.1|CNS08RNN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38CH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 53  tcttctcggccagctccttgaag 75
           |||||||||||||||||||||||
Sbjct: 309 tcttctcggccagctccttgaag 287
to top
>emb|BX023395.1|CNS08Q7R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA35DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 825

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 53  tcttctcggccagctccttgaag 75
           |||||||||||||||||||||||
Sbjct: 726 tcttctcggccagctccttgaag 748
to top
>emb|BX023394.1|CNS08Q7Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 53  tcttctcggccagctccttgaag 75
           |||||||||||||||||||||||
Sbjct: 332 tcttctcggccagctccttgaag 310
to top
>emb|BX010692.1|CNS08GEW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17AF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 53  tcttctcggccagctccttgaag 75
           |||||||||||||||||||||||
Sbjct: 739 tcttctcggccagctccttgaag 761
to top
>emb|BX010691.1|CNS08GEV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17AF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 53  tcttctcggccagctccttgaag 75
           |||||||||||||||||||||||
Sbjct: 329 tcttctcggccagctccttgaag 307
to top
>emb|BX470072.8| Zebrafish DNA sequence from clone DKEY-163I6 in linkage group 21,
              complete sequence
          Length = 211164

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 23     aattttcaaggattcaatcaatcaatc 49
              ||||||| |||||||||||||||||||
Sbjct: 117970 aattttccaggattcaatcaatcaatc 117944
to top
>ref|XM_308669.2| Anopheles gambiae str. PEST ENSANGP00000011257
           (ENSANGG00000008768), mRNA
          Length = 1064

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 53  tcttctcggccagctccttgaag 75
           |||||||||||||||||||||||
Sbjct: 332 tcttctcggccagctccttgaag 310
to top
>gb|AC098849.9| Mus musculus chromosome 3, clone RP23-12L23, complete sequence
          Length = 210441

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 22    gaattttcaaggattcaatcaa 43
             ||||||||||||||||||||||
Sbjct: 57348 gaattttcaaggattcaatcaa 57369
to top
>gb|AC116728.12| Mus musculus chromosome 3, clone RP23-345H12, complete sequence
          Length = 192916

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 22    gaattttcaaggattcaatcaa 43
             ||||||||||||||||||||||
Sbjct: 28197 gaattttcaaggattcaatcaa 28176
to top
>ref|NM_130144.3| Arabidopsis thaliana ATP binding / ATP-dependent helicase/
           helicase/ nucleic acid binding AT2G45810 mRNA, complete
           cds
          Length = 2329

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 36  tcaatcaatcaatcatctctt 56
           |||||||||||||||||||||
Sbjct: 96  tcaatcaatcaatcatctctt 116
to top
>gb|AC153973.33| Mus musculus 10 BAC RP24-158P6 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 164139

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 36     tcaatcaatcaatcatctctt 56
              |||||||||||||||||||||
Sbjct: 120375 tcaatcaatcaatcatctctt 120395
to top
>gb|BC072999.1| Xenopus laevis MGC82580 protein, mRNA (cDNA clone MGC:82580
           IMAGE:4970299), complete cds
          Length = 3252

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 7   attctaccatgtcttgaattt 27
           |||||||||||||||||||||
Sbjct: 727 attctaccatgtcttgaattt 707
to top
>ref|XM_722374.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY00873)
            partial mRNA
          Length = 1767

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 16   tgtcttgaattttcaaggatt 36
            |||||||||||||||||||||
Sbjct: 1232 tgtcttgaattttcaaggatt 1212
to top
>ref|XM_670717.1| Plasmodium berghei strain ANKA ribosomal large subunit
            pseudouridylate synthase (PB000570.00.0) partial mRNA
          Length = 1572

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 16   tgtcttgaattttcaaggatt 36
            |||||||||||||||||||||
Sbjct: 1253 tgtcttgaattttcaaggatt 1233
to top
>gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map CIC02E07, complete
             sequence
          Length = 101647

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 36    tcaatcaatcaatcatctctt 56
             |||||||||||||||||||||
Sbjct: 67222 tcaatcaatcaatcatctctt 67202
to top
>gb|AC160147.6| Mus musculus 10 BAC RP24-576A6 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 145198

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 36     tcaatcaatcaatcatctctt 56
              |||||||||||||||||||||
Sbjct: 142032 tcaatcaatcaatcatctctt 142012
to top
>gb|AC113448.14| Mus musculus chromosome 15, clone RP23-1N23, complete sequence
          Length = 216103

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 15    atgtcttgaattttcaaggattca 38
             ||||||||||||||| ||||||||
Sbjct: 51421 atgtcttgaattttctaggattca 51398
to top
>gb|AC099415.4| Mus musculus BAC clone RP23-122D8 from chromosome 8, complete sequence
          Length = 215488

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 62     ccagctccttgaagctgatg 81
              ||||||||||||||||||||
Sbjct: 128815 ccagctccttgaagctgatg 128796
to top
>gb|AY999090.1| Bubalus bubalis acyl-CoA 1,2-diacylglycerol O-transferase (DGAT1)
            gene, complete cds
          Length = 12372

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 219  accctccgcgcccaacctcccgct 242
            ||||||||| ||||||||||||||
Sbjct: 3882 accctccgcccccaacctcccgct 3859
to top
>emb|AJ318490.1|BTA318490 Bos taurus dgat gene for Acyl-CoA:1,2-diacylglycerol O-transferase
            and partial hsf1 gene for Heat Shock Factor Protein 1
          Length = 14117

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 219  accctccgcgcccaacctcccgct 242
            ||||||||| ||||||||||||||
Sbjct: 3982 accctccgcccccaacctcccgct 3959
to top
>gb|AC126672.3| Mus musculus BAC clone RP24-473A18 from chromosome 9, complete sequence
          Length = 191730

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 309   ggcggcaaaggagtcggcga 328
             ||||||||||||||||||||
Sbjct: 11088 ggcggcaaaggagtcggcga 11107
to top
>gb|AC160461.3| Mus musculus chromosome 15, clone RP23-174B9, complete sequence
          Length = 208877

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 15    atgtcttgaattttcaaggattca 38
             ||||||||||||||| ||||||||
Sbjct: 84742 atgtcttgaattttctaggattca 84719
to top
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 60      ggccagctccttgaagctgatggg 83
               |||||| |||||||||||||||||
Sbjct: 4225300 ggccaggtccttgaagctgatggg 4225323
to top
>gb|AE005856.1| Caulobacter crescentus CB15 section 182 of 359 of the complete genome
          Length = 12348

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 220  ccctccgcgcccaacctcccgctc 243
            |||| |||||||||||||||||||
Sbjct: 7731 cccttcgcgcccaacctcccgctc 7754
to top
>dbj|AK137118.1| Mus musculus 12 days embryo embryonic body between diaphragm region
            and neck cDNA, RIKEN full-length enriched library,
            clone:9430087I06 product:unclassifiable, full insert
            sequence
          Length = 3090

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 328  agggagtacatgaggcctgg 347
            ||||||||||||||||||||
Sbjct: 2738 agggagtacatgaggcctgg 2757
to top
>gb|AY065621.1| Bos taurus diacylglycerol acyltransferase 1 (DGAT1) gene, complete
           cds
          Length = 8593

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 219 accctccgcgcccaacctcccgct 242
           ||||||||| ||||||||||||||
Sbjct: 378 accctccgcccccaacctcccgct 355
to top
>emb|AL935286.14| Zebrafish DNA sequence from clone CH211-198E14 in linkage group 22,
              complete sequence
          Length = 211297

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 36     tcaatcaatcaatcatctct 55
              ||||||||||||||||||||
Sbjct: 129222 tcaatcaatcaatcatctct 129203
to top
>gb|AC105762.4| Homo sapiens BAC clone RP11-689P15 from 2, complete sequence
          Length = 76326

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   attcaatcaatcaatcatct 53
            ||||||||||||||||||||
Sbjct: 2450 attcaatcaatcaatcatct 2431
to top
>gb|AC135112.5| Mus musculus BAC clone RP23-477F17 from chromosome unknown, complete
             sequence
          Length = 178498

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     aaaaaattctaccatgtctt 21
             ||||||||||||||||||||
Sbjct: 19446 aaaaaattctaccatgtctt 19465
to top
>gb|AC009232.3| Homo sapiens BAC clone RP11-352J11 from 2, complete sequence
          Length = 139885

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 331    gagtacatgaggcctgggagcctc 354
              ||||| ||||||||||||||||||
Sbjct: 121916 gagtaaatgaggcctgggagcctc 121893
to top
>gb|AC007685.2|AC007685 Homo sapiens BAC clone RP11-558O12 from Y, complete sequence
          Length = 178377

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    attcaatcaatcaatcatct 53
             ||||||||||||||||||||
Sbjct: 28590 attcaatcaatcaatcatct 28609
to top
>gb|AC131568.5| Homo sapiens chromosome 8, clone RP11-1146N6, complete sequence
          Length = 150697

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 12    accatgtcttgaattttcaa 31
             ||||||||||||||||||||
Sbjct: 64290 accatgtcttgaattttcaa 64271
to top
>emb|BX571734.7| Mouse DNA sequence from clone RP23-334P23 on chromosome X, complete
             sequence
          Length = 107595

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     aaaaaattctaccatgtctt 21
             ||||||||||||||||||||
Sbjct: 79016 aaaaaattctaccatgtctt 78997
to top
>dbj|AK057900.1| Homo sapiens cDNA FLJ25171 fis, clone CBR08758
          Length = 1991

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 62   ccagctccttgaagctgatgggtg 85
            ||||| ||||||||||||||||||
Sbjct: 1170 ccagcaccttgaagctgatgggtg 1193
to top
>emb|BX950190.12| Zebrafish DNA sequence from clone DKEY-190N7 in linkage group 22,
             complete sequence
          Length = 106104

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 36    tcaatcaatcaatcatctct 55
             ||||||||||||||||||||
Sbjct: 24555 tcaatcaatcaatcatctct 24536
to top
>dbj|AP005715.3| Homo sapiens genomic DNA, chromosome 8q24, clone: KB1181D6, complete
              sequence
          Length = 134425

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 12     accatgtcttgaattttcaa 31
              ||||||||||||||||||||
Sbjct: 117112 accatgtcttgaattttcaa 117093
to top
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 53     tcttctcggccagctccttgaagc 76
              |||| |||||||||||||||||||
Sbjct: 633818 tcttgtcggccagctccttgaagc 633795
to top
>gb|AC122220.4| Mus musculus BAC clone RP23-122B15 from 9, complete sequence
          Length = 188580

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 309    ggcggcaaaggagtcggcga 328
              ||||||||||||||||||||
Sbjct: 164629 ggcggcaaaggagtcggcga 164648
to top
>emb|AL627302.20| Mouse DNA sequence from clone RP23-272D10 on chromosome X, complete
             sequence
          Length = 191439

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 328   agggagtacatgaggcctgg 347
             ||||||||||||||||||||
Sbjct: 95554 agggagtacatgaggcctgg 95573
to top
>emb|AL117209.7|CNS01DRH Human chromosome 14 DNA sequence BAC R-365N19 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 159602

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 62     ccagctccttgaagctgatgggtg 85
              ||||| ||||||||||||||||||
Sbjct: 103645 ccagcaccttgaagctgatgggtg 103668
to top
>dbj|AP000886.3| Homo sapiens genomic DNA, chromosome 6q25.2, clone:KB1750A9
          Length = 220495

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 204    gttcctcatgcacttaccct 223
              ||||||||||||||||||||
Sbjct: 118046 gttcctcatgcacttaccct 118065


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,839,452
Number of Sequences: 3902068
Number of extensions: 2839452
Number of successful extensions: 113634
Number of sequences better than 10.0: 58
Number of HSP's better than 10.0 without gapping: 58
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 113435
Number of HSP's gapped (non-prelim): 199
length of query: 404
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 382
effective length of database: 17,147,199,772
effective search space: 6550230312904
effective search space used: 6550230312904
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top