ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart40f09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC164574.15| Mus musculus 6 BAC RP23-446I7 (Roswell Park Canc... 40 6.9
2gb|AC164628.8| Mus musculus 6 BAC RP23-82H18 (Roswell Park Cance... 40 6.9
3gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-... 40 6.9
4ref|XM_787479.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 6.9
5emb|BX072539.13| Zebrafish DNA sequence from clone CH211-286O24 ... 40 6.9
6gb|AC159338.10| Mus musculus 6 BAC RP24-540A24 (Roswell Park Can... 40 6.9
7gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 40 6.9
8emb|AL115257.1|CNS01C9T Botrytis cinerea strain T4 cDNA library 40 6.9
9ref|NM_211260.1| Eremothecium gossypii AFR358Wp (AFR358W), mRNA 40 6.9
10gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome 40 6.9
11gb|AC160640.2| Gallus gallus BAC clone CH261-166L21 from chromos... 40 6.9

>gb|AC164574.15| Mus musculus 6 BAC RP23-446I7 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 188358

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  aggtgaacaacactttatgt 387
            ||||||||||||||||||||
Sbjct: 9035 aggtgaacaacactttatgt 9016



to top

>gb|AC164628.8| Mus musculus 6 BAC RP23-82H18 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 205032

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 368    aggtgaacaacactttatgt 387
              ||||||||||||||||||||
Sbjct: 118909 aggtgaacaacactttatgt 118928



to top

>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome
          Length = 5237682

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 448     cgttggtgttgtcattgccg 467
               ||||||||||||||||||||
Sbjct: 2708771 cgttggtgttgtcattgccg 2708752



to top

>ref|XM_787479.1| PREDICTED: Strongylocentrotus purpuratus similar to CG3973-PA
           (LOC587769), mRNA
          Length = 2124

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 395 attctgatagtactgcttat 414
           ||||||||||||||||||||
Sbjct: 557 attctgatagtactgcttat 576



to top

>emb|BX072539.13| Zebrafish DNA sequence from clone CH211-286O24 in linkage group 6,
             complete sequence
          Length = 78217

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 391   tcacattctgatagtactgcttat 414
             ||||||||||||||||||| ||||
Sbjct: 57030 tcacattctgatagtactgattat 57007



to top

>gb|AC159338.10| Mus musculus 6 BAC RP24-540A24 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 173081

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   aggtgaacaacactttatgt 387
             ||||||||||||||||||||
Sbjct: 60832 aggtgaacaacactttatgt 60813



to top

>gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VI,
               complete sequence
          Length = 1813164

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 356     gcacggcgtccgaggtgaac 375
               ||||||||||||||||||||
Sbjct: 1088383 gcacggcgtccgaggtgaac 1088402



to top

>emb|AL115257.1|CNS01C9T Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 451 tggtgttgtcattgccgttg 470
           ||||||||||||||||||||
Sbjct: 292 tggtgttgtcattgccgttg 311



to top

>ref|NM_211260.1| Eremothecium gossypii AFR358Wp (AFR358W), mRNA
          Length = 1242

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 356 gcacggcgtccgaggtgaac 375
           ||||||||||||||||||||
Sbjct: 653 gcacggcgtccgaggtgaac 672



to top

>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome
          Length = 5224283

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 448     cgttggtgttgtcattgccg 467
               ||||||||||||||||||||
Sbjct: 2748908 cgttggtgttgtcattgccg 2748889



to top

>gb|AC160640.2| Gallus gallus BAC clone CH261-166L21 from chromosome unknown, complete
             sequence
          Length = 233376

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 65    tacataattttagtataagaaaac 88
             ||||| ||||||||||||||||||
Sbjct: 90407 tacatcattttagtataagaaaac 90430


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,940,518
Number of Sequences: 3902068
Number of extensions: 2940518
Number of successful extensions: 53907
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 53867
Number of HSP's gapped (non-prelim): 40
length of query: 510
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 488
effective length of database: 17,147,199,772
effective search space: 8367833488736
effective search space used: 8367833488736
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top