ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart40f02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_472726.1| Oryza sativa (japonica cultivar-group), predic... 216 4e-53
2emb|AL606636.4|OSJN00075 Oryza sativa genomic DNA, chromosome 4,... 216 4e-53
3dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 216 4e-53
4dbj|AK108672.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 4e-53
5dbj|AK104811.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 4e-53
6dbj|AK066070.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 4e-53
7gb|AY103838.1| Zea mays PCO113775 mRNA sequence 192 6e-46
8gb|U23190.1|ZMU23190 Zea mays chlorophyll a/b-binding apoprotein... 163 6e-37
9gb|DQ427744.1| Sorghum propinquum locus HHU11 genomic sequence 113 5e-22
10gb|DQ427743.1| Sorghum bicolor voucher PI585454 locus HHU11 geno... 113 5e-22
11gb|DQ427742.1| Sorghum bicolor voucher PI267539 locus HHU11 geno... 113 5e-22
12gb|DQ427741.1| Sorghum bicolor voucher PI267408 locus HHU11 geno... 113 5e-22
13gb|DQ427740.1| Sorghum bicolor voucher PI221607 locus HHU11 geno... 113 5e-22
14gb|DQ427739.1| Sorghum bicolor voucher PI152702 locus HHU11 geno... 113 5e-22
15gb|DQ427738.1| Sorghum bicolor voucher NSL92371 locus HHU11 geno... 113 5e-22
16gb|DQ427737.1| Sorghum bicolor voucher NSL87902b locus HHU11 gen... 113 5e-22
17gb|DQ427736.1| Sorghum bicolor voucher NSL87902a locus HHU11 gen... 113 5e-22
18gb|DQ427735.1| Sorghum bicolor voucher NSL87666 locus HHU11 geno... 113 5e-22
19gb|DQ427734.1| Sorghum bicolor voucher NSL77217 locus HHU11 geno... 113 5e-22
20gb|DQ427733.1| Sorghum bicolor voucher NSL77034 locus HHU11 geno... 113 5e-22
21gb|DQ427732.1| Sorghum bicolor voucher NSL56174 locus HHU11 geno... 113 5e-22
22gb|DQ427731.1| Sorghum bicolor voucher NSL55243 locus HHU11 geno... 113 5e-22
23gb|DQ427730.1| Sorghum bicolor voucher NSL51365 locus HHU11 geno... 113 5e-22
24gb|DQ427729.1| Sorghum bicolor voucher NSL51030 locus HHU11 geno... 113 5e-22
25gb|DQ427728.1| Sorghum bicolor voucher NSL50875 locus HHU11 geno... 113 5e-22
26emb|Z50801.1|ZMCABCP29 Z.mays mRNA for chlorophyll a/b-binding p... 50 0.006
27gb|AY103995.1| Zea mays PCO102677 mRNA sequence 50 0.006
28gb|AE005909.1| Caulobacter crescentus CB15 section 235 of 359 of... 46 0.092
29emb|BX323545.11| Mouse DNA sequence from clone RP23-358N13 on ch... 46 0.092
30ref|NM_139299.1| Mus musculus interleukin 31 receptor A (Il31ra)... 44 0.36
31gb|AY509151.1| Mus musculus muzcytor17x2 interleukin 31RA (Il31r... 44 0.36
32gb|AY509150.1| Mus musculus muzcytor17x1 interleukin 31RA (Il31r... 44 0.36
33gb|BC066164.1| Mus musculus interleukin 31 receptor A, mRNA (cDN... 44 0.36
34gb|AC159196.2| Mus musculus BAC clone RP23-430O17 from chromosom... 44 0.36
35gb|AF486621.1| Mus musculus gp130-like monocyte receptor mRNA, c... 44 0.36
36gb|AC154767.2| Mus musculus BAC clone RP23-105P19 from chromosom... 44 0.36
37dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 44 0.36
38dbj|AB083111.1| Mus musculus mRNA for cytokine receptor NR10, co... 44 0.36
39ref|XM_507368.1| PREDICTED Oryza sativa (japonica cultivar-group... 42 1.4
40ref|XM_478692.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.4
41ref|XM_507367.1| PREDICTED Oryza sativa (japonica cultivar-group... 42 1.4
42ref|XM_507366.1| PREDICTED Oryza sativa (japonica cultivar-group... 42 1.4
43ref|XM_506405.2| PREDICTED Oryza sativa (japonica cultivar-group... 42 1.4
44gb|AC149483.1| Populus trichocarpa clone Pop1-69I13, complete se... 42 1.4
45dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
46dbj|AP005195.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
47dbj|AK119534.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
48dbj|AK104619.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
49dbj|AK104309.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
50dbj|AK103924.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
51dbj|AK098992.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
52dbj|AK058293.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
53gb|AF058796.1|AF058796 Oryza sativa chlorophyll a/b-binding prot... 42 1.4
54gb|AC146609.3| Mus musculus BAC clone RP23-162K11 from chromosom... 40 5.7
55gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 40 5.7
56gb|L16687.2| Caenorhabditis elegans cosmid C04D8, complete sequence 40 5.7
57emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 40 5.7
58emb|AL161555.2|ATCHRIV55 Arabidopsis thaliana DNA chromosome 4, ... 40 5.7
59emb|AL022603.1|ATF18E5 Arabidopsis thaliana DNA chromosome 4, BA... 40 5.7
60gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 5.7
61gb|AC073576.23| Homo sapiens 12 BAC RP11-363M20 (Roswell Park Ca... 40 5.7
62gb|AC113380.2| Homo sapiens chromosome 5 clone RP11-304B20, comp... 40 5.7
63gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hilde... 40 5.7
64gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 40 5.7
65dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 5.7
66gb|AF440828.1| Streptomyces avermitilis Imp1 (imp1) gene, partia... 40 5.7
67dbj|BS000046.1| Pan troglodytes chromosome 22 clone:PTB-042H12, ... 40 5.7
68emb|AJ006296.1|HVU6296 Hordeum vulgare partial mRNA for chloroph... 40 5.7
69emb|AL355916.2|CNS05TD1 Human chromosome 14 DNA sequence BAC R-4... 40 5.7
70gb|AE000782.1| Archaeoglobus fulgidus DSM 4304, complete genome 40 5.7
71dbj|AK114004.1| Ciona intestinalis cDNA, clone:cicl021d09, full ... 40 5.7
72gb|AC121960.3| Mus musculus BAC clone RP24-248C17 from 14, compl... 40 5.7 
>ref|XM_472726.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 759

 Score =  216 bits (109), Expect = 4e-53
 Identities = 154/169 (91%)
 Strand = Plus / Minus

                                                                       
Query: 255 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 314
           |||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 757 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 698

                                                                       
Query: 315 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 374
           |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| |
Sbjct: 697 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 638

                                                            
Query: 375 cggtgtcggggatgtagatgccgtccttggtctcgccaccgaggccgag 423
           ||||||| |||||||||| ||||||| |||||||||| |||||||||||
Sbjct: 637 cggtgtccgggatgtagacgccgtccctggtctcgccgccgaggccgag 589
to top
>emb|AL606636.4|OSJN00075 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0036B21,
             complete sequence
          Length = 138969

 Score =  216 bits (109), Expect = 4e-53
 Identities = 154/169 (91%)
 Strand = Plus / Plus

                                                                         
Query: 255   atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 314
             |||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 19661 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 19720

                                                                         
Query: 315   tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 374
             |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| |
Sbjct: 19721 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 19780

                                                              
Query: 375   cggtgtcggggatgtagatgccgtccttggtctcgccaccgaggccgag 423
             ||||||| |||||||||| ||||||| |||||||||| |||||||||||
Sbjct: 19781 cggtgtccgggatgtagacgccgtccctggtctcgccgccgaggccgag 19829
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  216 bits (109), Expect = 4e-53
 Identities = 154/169 (91%)
 Strand = Plus / Plus

                                                                            
Query: 255      atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 314
                |||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 22810886 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 22810945

                                                                            
Query: 315      tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 374
                |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| |
Sbjct: 22810946 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 22811005

                                                                 
Query: 375      cggtgtcggggatgtagatgccgtccttggtctcgccaccgaggccgag 423
                ||||||| |||||||||| ||||||| |||||||||| |||||||||||
Sbjct: 22811006 cggtgtccgggatgtagacgccgtccctggtctcgccgccgaggccgag 22811054
to top
>dbj|AK108672.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-148-H08, full
           insert sequence
          Length = 1377

 Score =  216 bits (109), Expect = 4e-53
 Identities = 154/169 (91%)
 Strand = Plus / Plus

                                                                       
Query: 255 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 314
           |||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 41  ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 100

                                                                       
Query: 315 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 374
           |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| |
Sbjct: 101 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 160

                                                            
Query: 375 cggtgtcggggatgtagatgccgtccttggtctcgccaccgaggccgag 423
           ||||||| |||||||||| ||||||| |||||||||| |||||||||||
Sbjct: 161 cggtgtccgggatgtagacgccgtccctggtctcgccgccgaggccgag 209
to top
>dbj|AK104811.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-G02, full
           insert sequence
          Length = 1138

 Score =  216 bits (109), Expect = 4e-53
 Identities = 154/169 (91%)
 Strand = Plus / Minus

                                                                       
Query: 255 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 314
           |||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 819 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 760

                                                                       
Query: 315 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 374
           |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| |
Sbjct: 759 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 700

                                                            
Query: 375 cggtgtcggggatgtagatgccgtccttggtctcgccaccgaggccgag 423
           ||||||| |||||||||| ||||||| |||||||||| |||||||||||
Sbjct: 699 cggtgtccgggatgtagacgccgtccctggtctcgccgccgaggccgag 651
to top
>dbj|AK066070.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013055K10, full
           insert sequence
          Length = 1144

 Score =  216 bits (109), Expect = 4e-53
 Identities = 154/169 (91%)
 Strand = Plus / Minus

                                                                       
Query: 255 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 314
           |||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 820 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 761

                                                                       
Query: 315 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 374
           |||| |||||||||||||| | ||||||||||||||| | ||||||||| || ||||| |
Sbjct: 760 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccggtcgagcttgt 701

                                                            
Query: 375 cggtgtcggggatgtagatgccgtccttggtctcgccaccgaggccgag 423
           ||||||| |||||||||| ||||||| |||||||||| |||||||||||
Sbjct: 700 cggtgtccgggatgtagacgccgtccctggtctcgccgccgaggccgag 652
to top
>gb|AY103838.1| Zea mays PCO113775 mRNA sequence
          Length = 958

 Score =  192 bits (97), Expect = 6e-46
 Identities = 136/149 (91%)
 Strand = Plus / Minus

                                                                       
Query: 255 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 314
           |||| ||||||||||||||||||||||||||||| ||||||||||||||||||  |||||
Sbjct: 811 ataggccgagcgcgccgagcggcgtcttgccctgcccggcctcgaagtagaaggcgagca 752

                                                                       
Query: 315 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 374
           ||||||||||||||| ||| | ||||||||||||||||| |||||||||||| ||||| |
Sbjct: 751 tggcaagcatggcgatgcgggcgtgcttgatctcggccagcttgagccgctcgagcttgt 692

                                        
Query: 375 cggtgtcggggatgtagatgccgtccttg 403
           ||  |||||||||||||| ||||||||||
Sbjct: 691 cgacgtcggggatgtagacgccgtccttg 663
to top
>gb|U23190.1|ZMU23190 Zea mays chlorophyll a/b-binding apoprotein CP24 (Lhcb6-1) mRNA,
           complete cds
          Length = 1040

 Score =  163 bits (82), Expect = 6e-37
 Identities = 130/146 (89%)
 Strand = Plus / Minus

                                                                       
Query: 255 atagaccgagcgcgccgagcggcgtcttgccctgtccggcctcgaagtagaagatgagca 314
           |||| ||||||||||||||  ||||||||||||| || |||||||||||||||  |||||
Sbjct: 774 ataggccgagcgcgccgaggcgcgtcttgccctgcccagcctcgaagtagaaggcgagca 715

                                                                       
Query: 315 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctcaagcttct 374
           ||||||||||||||| ||| | ||||||||||||||||| |||||||||||| ||||| |
Sbjct: 714 tggcaagcatggcgatgcgggcgtgcttgatctcggccagcttgagccgctcgagcttgt 655

                                     
Query: 375 cggtgtcggggatgtagatgccgtcc 400
           ||  |||||||||||||| |||||||
Sbjct: 654 cgacgtcggggatgtagacgccgtcc 629
to top
>gb|DQ427744.1| Sorghum propinquum locus HHU11 genomic sequence
          Length = 757

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 757 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 698

                                                
Query: 367 aagcttctcggtgtcggggatgtagatgccgtccttg 403
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 697 gagcttgtcgacgtcggggatgtagacgccgtccttg 661
to top
>gb|DQ427743.1| Sorghum bicolor voucher PI585454 locus HHU11 genomic sequence
          Length = 755

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 755 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 696

                                                
Query: 367 aagcttctcggtgtcggggatgtagatgccgtccttg 403
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 695 gagcttgtcgacgtcggggatgtagacgccgtccttg 659
to top
>gb|DQ427742.1| Sorghum bicolor voucher PI267539 locus HHU11 genomic sequence
          Length = 755

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 755 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 696

                                                
Query: 367 aagcttctcggtgtcggggatgtagatgccgtccttg 403
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 695 gagcttgtcgacgtcggggatgtagacgccgtccttg 659
to top
>gb|DQ427741.1| Sorghum bicolor voucher PI267408 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 367 aagcttctcggtgtcggggatgtagatgccgtccttg 403
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
to top
>gb|DQ427740.1| Sorghum bicolor voucher PI221607 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 367 aagcttctcggtgtcggggatgtagatgccgtccttg 403
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
to top
>gb|DQ427739.1| Sorghum bicolor voucher PI152702 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 367 aagcttctcggtgtcggggatgtagatgccgtccttg 403
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
to top
>gb|DQ427738.1| Sorghum bicolor voucher NSL92371 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 367 aagcttctcggtgtcggggatgtagatgccgtccttg 403
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
to top
>gb|DQ427737.1| Sorghum bicolor voucher NSL87902b locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 367 aagcttctcggtgtcggggatgtagatgccgtccttg 403
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
to top
>gb|DQ427736.1| Sorghum bicolor voucher NSL87902a locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 367 aagcttctcggtgtcggggatgtagatgccgtccttg 403
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
to top
>gb|DQ427735.1| Sorghum bicolor voucher NSL87666 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 367 aagcttctcggtgtcggggatgtagatgccgtccttg 403
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
to top
>gb|DQ427734.1| Sorghum bicolor voucher NSL77217 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 367 aagcttctcggtgtcggggatgtagatgccgtccttg 403
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
to top
>gb|DQ427733.1| Sorghum bicolor voucher NSL77034 locus HHU11 genomic sequence
          Length = 755

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 755 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 696

                                                
Query: 367 aagcttctcggtgtcggggatgtagatgccgtccttg 403
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 695 gagcttgtcgacgtcggggatgtagacgccgtccttg 659
to top
>gb|DQ427732.1| Sorghum bicolor voucher NSL56174 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 367 aagcttctcggtgtcggggatgtagatgccgtccttg 403
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
to top
>gb|DQ427731.1| Sorghum bicolor voucher NSL55243 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 367 aagcttctcggtgtcggggatgtagatgccgtccttg 403
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
to top
>gb|DQ427730.1| Sorghum bicolor voucher NSL51365 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 367 aagcttctcggtgtcggggatgtagatgccgtccttg 403
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
to top
>gb|DQ427729.1| Sorghum bicolor voucher NSL51030 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 367 aagcttctcggtgtcggggatgtagatgccgtccttg 403
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
to top
>gb|DQ427728.1| Sorghum bicolor voucher NSL50875 locus HHU11 genomic sequence
          Length = 761

 Score =  113 bits (57), Expect = 5e-22
 Identities = 87/97 (89%)
 Strand = Plus / Minus

                                                                       
Query: 307 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgctc 702

                                                
Query: 367 aagcttctcggtgtcggggatgtagatgccgtccttg 403
            ||||| |||  |||||||||||||| ||||||||||
Sbjct: 701 gagcttgtcgacgtcggggatgtagacgccgtccttg 665
to top
>emb|Z50801.1|ZMCABCP29 Z.mays mRNA for chlorophyll a/b-binding protein CP29
          Length = 1162

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||||| |||||||||||| |||| ||  ||||||||
Sbjct: 760 catggcgaggcgcgcgtgcttgatctccgccagctgcagccgctc 716
to top
>gb|AY103995.1| Zea mays PCO102677 mRNA sequence
          Length = 1225

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||||| |||||||||||| |||| ||  ||||||||
Sbjct: 805 catggcgaggcgcgcgtgcttgatctccgccagctgcagccgctc 761
to top
>gb|AE005909.1| Caulobacter crescentus CB15 section 235 of 359 of the complete genome
          Length = 10294

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 265  cgcgccgagcggcgtcttgccct 287
            |||||||||||||||||||||||
Sbjct: 9269 cgcgccgagcggcgtcttgccct 9291
to top
>emb|BX323545.11| Mouse DNA sequence from clone RP23-358N13 on chromosome 4, complete
             sequence
          Length = 47574

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 2     aatcaaaagtcttttgcccattc 24
             |||||||||||||||||||||||
Sbjct: 26691 aatcaaaagtcttttgcccattc 26713
to top
>ref|NM_139299.1| Mus musculus interleukin 31 receptor A (Il31ra), mRNA
          Length = 3680

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 121  taaaagaagtcacggacacaga 142
            ||||||||||||||||||||||
Sbjct: 1294 taaaagaagtcacggacacaga 1273
to top
>gb|AY509151.1| Mus musculus muzcytor17x2 interleukin 31RA (Il31ra) mRNA, complete
            cds
          Length = 2728

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 121  taaaagaagtcacggacacaga 142
            ||||||||||||||||||||||
Sbjct: 1191 taaaagaagtcacggacacaga 1170
to top
>gb|AY509150.1| Mus musculus muzcytor17x1 interleukin 31RA (Il31ra) mRNA, complete
            cds
          Length = 2748

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 121  taaaagaagtcacggacacaga 142
            ||||||||||||||||||||||
Sbjct: 1191 taaaagaagtcacggacacaga 1170
to top
>gb|BC066164.1| Mus musculus interleukin 31 receptor A, mRNA (cDNA clone MGC:76531
            IMAGE:30475340), complete cds
          Length = 2020

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 121  taaaagaagtcacggacacaga 142
            ||||||||||||||||||||||
Sbjct: 1016 taaaagaagtcacggacacaga 995
to top
>gb|AC159196.2| Mus musculus BAC clone RP23-430O17 from chromosome 13, complete
             sequence
          Length = 198595

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 121   taaaagaagtcacggacacaga 142
             ||||||||||||||||||||||
Sbjct: 22923 taaaagaagtcacggacacaga 22902
to top
>gb|AF486621.1| Mus musculus gp130-like monocyte receptor mRNA, complete cds
          Length = 2151

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 121 taaaagaagtcacggacacaga 142
           ||||||||||||||||||||||
Sbjct: 874 taaaagaagtcacggacacaga 853
to top
>gb|AC154767.2| Mus musculus BAC clone RP23-105P19 from chromosome 13, complete
             sequence
          Length = 189362

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 121   taaaagaagtcacggacacaga 142
             ||||||||||||||||||||||
Sbjct: 22495 taaaagaagtcacggacacaga 22516
to top
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 345     tctcggccaccttgagccgctc 366
               ||||||||||||||||||||||
Sbjct: 3855385 tctcggccaccttgagccgctc 3855406
to top
>dbj|AB083111.1| Mus musculus mRNA for cytokine receptor NR10, complete cds
          Length = 3680

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 121  taaaagaagtcacggacacaga 142
            ||||||||||||||||||||||
Sbjct: 1294 taaaagaagtcacggacacaga 1273
to top
>ref|XM_507368.1| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA
          Length = 1156

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 791 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 747
to top
>ref|XM_478692.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1152

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 786 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 742
to top
>ref|XM_507367.1| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA
          Length = 1162

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 793 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 749
to top
>ref|XM_507366.1| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA
          Length = 1183

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 793 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 749
to top
>ref|XM_506405.2| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA
          Length = 1221

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 807 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 763
to top
>gb|AC149483.1| Populus trichocarpa clone Pop1-69I13, complete sequence
          Length = 51685

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 175  atcccattcaatccatgcgtc 195
            |||||||||||||||||||||
Sbjct: 5637 atcccattcaatccatgcgtc 5617
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                             
Query: 322      catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
                |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 22263178 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 22263222
to top
>dbj|AP005195.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0567H04
          Length = 181420

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                          
Query: 322   catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
             |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 68424 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 68468
to top
>dbj|AK119534.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-B02, full
           insert sequence
          Length = 1234

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 793 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 749
to top
>dbj|AK104619.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-F11, full
           insert sequence
          Length = 1152

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 786 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 742
to top
>dbj|AK104309.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D03, full
           insert sequence
          Length = 1169

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 800 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 756
to top
>dbj|AK103924.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-C12, full
           insert sequence
          Length = 1183

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 793 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 749
to top
>dbj|AK098992.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098H13, full
           insert sequence
          Length = 1156

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 791 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 747
to top
>dbj|AK058293.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-F01, full
           insert sequence
          Length = 1221

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 807 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 763
to top
>gb|AF058796.1|AF058796 Oryza sativa chlorophyll a/b-binding protein (RCABP69) mRNA,
           complete cds
          Length = 1178

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 322 catggcgaggcgcgagtgcttgatctcggccaccttgagccgctc 366
           |||||||||||| | |||||||||||| |||| ||  ||||||||
Sbjct: 791 catggcgaggcgggcgtgcttgatctccgccagctgcagccgctc 747
to top
>gb|AC146609.3| Mus musculus BAC clone RP23-162K11 from chromosome 14, complete
             sequence
          Length = 199215

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    tatatattacatggtacata 68
             ||||||||||||||||||||
Sbjct: 53057 tatatattacatggtacata 53076
to top
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 260     ccgagcgcgccgagcggcgt 279
               ||||||||||||||||||||
Sbjct: 1691401 ccgagcgcgccgagcggcgt 1691420
to top
>gb|L16687.2| Caenorhabditis elegans cosmid C04D8, complete sequence
          Length = 21034

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 297   cgaagtagaagatgagcatg 316
             ||||||||||||||||||||
Sbjct: 13041 cgaagtagaagatgagcatg 13022
to top
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 260     ccgagcgcgccgagcggcgt 279
               ||||||||||||||||||||
Sbjct: 3026363 ccgagcgcgccgagcggcgt 3026382
to top
>emb|AL161555.2|ATCHRIV55 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 55
          Length = 194916

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 245   aaatcatcttatagaccgag 264
             ||||||||||||||||||||
Sbjct: 55520 aaatcatcttatagaccgag 55539
to top
>emb|AL022603.1|ATF18E5 Arabidopsis thaliana DNA chromosome 4, BAC clone F18E5 (ESSAII project)
          Length = 95266

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 245   aaatcatcttatagaccgag 264
             ||||||||||||||||||||
Sbjct: 42512 aaatcatcttatagaccgag 42531
to top
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 258    gaccgagcgcgccgagcggc 277
              ||||||||||||||||||||
Sbjct: 404087 gaccgagcgcgccgagcggc 404068
to top
>gb|AC073576.23| Homo sapiens 12 BAC RP11-363M20 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 180309

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 4      tcaaaagtcttttgcccatt 23
              ||||||||||||||||||||
Sbjct: 160272 tcaaaagtcttttgcccatt 160253
to top
>gb|AC113380.2| Homo sapiens chromosome 5 clone RP11-304B20, complete sequence
          Length = 143534

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     actatatattacatggtaca 66
              ||||||||||||||||||||
Sbjct: 110106 actatatattacatggtaca 110125
to top
>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete genome
          Length = 3570858

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 370     cttctcggtgtcggggatgtagatgccg 397
               |||| |||||||||||||||||| ||||
Sbjct: 2052833 cttcgcggtgtcggggatgtagaggccg 2052860
to top
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 260     ccgagcgcgccgagcggcgt 279
               ||||||||||||||||||||
Sbjct: 2175170 ccgagcgcgccgagcggcgt 2175189
to top
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 404     gtctcgccaccgaggccgag 423
               ||||||||||||||||||||
Sbjct: 8759993 gtctcgccaccgaggccgag 8759974
to top
>gb|AF440828.1| Streptomyces avermitilis Imp1 (imp1) gene, partial cds; Imp2 (imp2)
            gene, complete cds; and unknown genes
          Length = 7996

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 404  gtctcgccaccgaggccgag 423
            ||||||||||||||||||||
Sbjct: 7684 gtctcgccaccgaggccgag 7665
to top
>dbj|BS000046.1| Pan troglodytes chromosome 22 clone:PTB-042H12, map 22, complete
             sequences
          Length = 150162

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 4     tcaaaagtcttttgcccatt 23
             ||||||||||||||||||||
Sbjct: 72323 tcaaaagtcttttgcccatt 72342
to top
>emb|AJ006296.1|HVU6296 Hordeum vulgare partial mRNA for chlorophyll a/b-binding protein
          Length = 470

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 322 catggcgaggcgcgagtgcttgatctcggcca 353
           |||||||||||| | |||||||||||| ||||
Sbjct: 107 catggcgaggcgggcgtgcttgatctccgcca 76
to top
>emb|AL355916.2|CNS05TD1 Human chromosome 14 DNA sequence BAC R-47I22 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 178484

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 4      tcaaaagtcttttgcccatt 23
              ||||||||||||||||||||
Sbjct: 148967 tcaaaagtcttttgcccatt 148948
to top
>gb|AE000782.1| Archaeoglobus fulgidus DSM 4304, complete genome
          Length = 2178400

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 358     gagccgctcaagcttctcgg 377
               ||||||||||||||||||||
Sbjct: 1360159 gagccgctcaagcttctcgg 1360140
to top
>dbj|AK114004.1| Ciona intestinalis cDNA, clone:cicl021d09, full insert sequence
          Length = 997

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 3   atcaaaagtcttttgcccat 22
           ||||||||||||||||||||
Sbjct: 285 atcaaaagtcttttgcccat 266
to top
>gb|AC121960.3| Mus musculus BAC clone RP24-248C17 from 14, complete sequence
          Length = 160030

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    tatatattacatggtacata 68
             ||||||||||||||||||||
Sbjct: 14348 tatatattacatggtacata 14329


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,379,950
Number of Sequences: 3902068
Number of extensions: 4379950
Number of successful extensions: 66857
Number of sequences better than 10.0: 72
Number of HSP's better than 10.0 without gapping: 72
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 66093
Number of HSP's gapped (non-prelim): 764
length of query: 423
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 401
effective length of database: 17,147,199,772
effective search space: 6876027108572
effective search space used: 6876027108572
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top