ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart40b02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC112979.9| Mus musculus chromosome 3, clone RP24-530C22, com... 40 1.6
2gb|AC102590.9| Mus musculus chromosome 12, clone RP23-335D14, co... 40 1.6
3gb|AC159975.4| Mus musculus chromosome 3, clone RP24-204F16, com... 40 1.6
4gb|AC068286.5| Homo sapiens BAC clone RP11-526G2 from 2, complet... 40 1.6
5gb|AC119171.10| Mus musculus chromosome 8, clone RP23-201B1, com... 40 1.6
6gb|AC165410.4| Mus musculus chromosome 8, clone RP23-267F17, com... 40 1.6
7dbj|AP004481.1| Lotus japonicus genomic DNA, chromosome 6, clone... 40 1.6
8gb|AC109268.10| Mus musculus chromosome 1, clone RP23-305F24, co... 38 6.2
9gb|AE013158.1| Thermoanaerobacter tengcongensis MB4, section 185... 38 6.2
10gb|AC125048.2| Mus musculus BAC clone RP23-364E18 from 5, comple... 38 6.2
11emb|AL772148.6| Zebrafish DNA sequence from clone CH211-153C20 i... 38 6.2
12emb|AL669853.5| Mouse DNA sequence from clone RP23-204F22 on chr... 38 6.2
13gb|AC010739.3| Homo sapiens BAC clone RP11-478M12 from 2, comple... 38 6.2
14gb|AE005672.2| Streptococcus pneumoniae TIGR4, complete genome 38 6.2
15dbj|AB114606.1| Streptococcus bovis manL, manM, manN, manO, serS... 38 6.2

>gb|AC112979.9| Mus musculus chromosome 3, clone RP24-530C22, complete sequence
          Length = 148599

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     aagaatcacatatgatggca 22
             ||||||||||||||||||||
Sbjct: 30209 aagaatcacatatgatggca 30190



to top

>gb|AC102590.9| Mus musculus chromosome 12, clone RP23-335D14, complete sequence
          Length = 202328

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 102   ttgaaaactaataatggaca 121
             ||||||||||||||||||||
Sbjct: 44794 ttgaaaactaataatggaca 44813



to top

>gb|AC159975.4| Mus musculus chromosome 3, clone RP24-204F16, complete sequence
          Length = 181930

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     aagaatcacatatgatggca 22
             ||||||||||||||||||||
Sbjct: 70238 aagaatcacatatgatggca 70219



to top

>gb|AC068286.5| Homo sapiens BAC clone RP11-526G2 from 2, complete sequence
          Length = 137631

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 98    acatttgaaaactaataatggaca 121
             |||||||||| |||||||||||||
Sbjct: 36504 acatttgaaagctaataatggaca 36527



to top

>gb|AC119171.10| Mus musculus chromosome 8, clone RP23-201B1, complete sequence
          Length = 192853

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 92    gttgctacatttgaaaacta 111
             ||||||||||||||||||||
Sbjct: 30221 gttgctacatttgaaaacta 30202



to top

>gb|AC165410.4| Mus musculus chromosome 8, clone RP23-267F17, complete sequence
          Length = 163899

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 92     gttgctacatttgaaaacta 111
              ||||||||||||||||||||
Sbjct: 110532 gttgctacatttgaaaacta 110551



to top

>dbj|AP004481.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT14O07, TM0013,
            complete sequence
          Length = 74668

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 106  aaactaataatggacatagg 125
            ||||||||||||||||||||
Sbjct: 9570 aaactaataatggacatagg 9551



to top

>gb|AC109268.10| Mus musculus chromosome 1, clone RP23-305F24, complete sequence
          Length = 160975

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 12    atatgatggcattatatgc 30
             |||||||||||||||||||
Sbjct: 85818 atatgatggcattatatgc 85800



to top

>gb|AE013158.1| Thermoanaerobacter tengcongensis MB4, section 185 of 244 of the
            complete genome
          Length = 11438

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 3    aagaatcacatatgatggcatta 25
            |||||||||||||||||| ||||
Sbjct: 8912 aagaatcacatatgatggaatta 8890



to top

>gb|AC125048.2| Mus musculus BAC clone RP23-364E18 from 5, complete sequence
          Length = 190505

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 105   aaaactaataatggacata 123
             |||||||||||||||||||
Sbjct: 44638 aaaactaataatggacata 44620



to top

>emb|AL772148.6| Zebrafish DNA sequence from clone CH211-153C20 in linkage group 24
             Contains part of a novel gene similar to human DECR2
             (peroxisomal 2,4-dienoyl CoA reductase 2),  a novel gene
             similar to human KIAA0665, a novel gene similar to human
             KIAA0683, a novel gene similar to human KIAA0590, part of
             a novel gene and three CpG islands, complete sequence
          Length = 161218

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 89    aacgttgctacatttgaaa 107
             |||||||||||||||||||
Sbjct: 82357 aacgttgctacatttgaaa 82339



to top

>emb|AL669853.5| Mouse DNA sequence from clone RP23-204F22 on chromosome 11 Contains part
              of the Abca13 gene for ATP-binding cassette sub-family A
              (ABC1) member 13, complete sequence
          Length = 205759

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 10     acatatgatggcattatat 28
              |||||||||||||||||||
Sbjct: 134147 acatatgatggcattatat 134165



to top

>gb|AC010739.3| Homo sapiens BAC clone RP11-478M12 from 2, complete sequence
          Length = 180226

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 100   atttgaaaactaataatgg 118
             |||||||||||||||||||
Sbjct: 57657 atttgaaaactaataatgg 57675



to top

>gb|AE005672.2| Streptococcus pneumoniae TIGR4, complete genome
          Length = 2160842

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 90     acgttgctacatttgaaaa 108
              |||||||||||||||||||
Sbjct: 261800 acgttgctacatttgaaaa 261782



to top

>dbj|AB114606.1| Streptococcus bovis manL, manM, manN, manO, serS genes for
            mannose-specific phosphotransferase syste component IIAB,
            mannose-specific phosphotransferase system component IIC,
            mannose-specific phosphotransferase system component IID,
            hypothetical protein, seryl-tRNA synthetase, partial and
            complete sequence
          Length = 5428

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 90   acgttgctacatttgaaaa 108
            |||||||||||||||||||
Sbjct: 2001 acgttgctacatttgaaaa 2019


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 869,892
Number of Sequences: 3902068
Number of extensions: 869892
Number of successful extensions: 56747
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56712
Number of HSP's gapped (non-prelim): 35
length of query: 132
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 111
effective length of database: 17,151,101,840
effective search space: 1903772304240
effective search space used: 1903772304240
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top