ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart40b01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC006061.1| Homo sapiens X BAC GSHB-19O24 (Genome Systems Hum... 38 2.5
2emb|CT573090.2| RP43-052E01, complete sequence 38 2.5
3gb|AY392533.1| Porcine teschovirus isolate DS 183/93 polyprotein... 36 9.7
4gb|AC119876.9| Mus musculus chromosome 3, clone RP24-309A12, com... 36 9.7
5gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-... 36 9.7
6gb|AC092198.5| Homo sapiens chromosome X clone XXbac-10326 map p... 36 9.7
7gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 36 9.7
8gb|BC012404.1| Mus musculus peroxisomal membrane protein 3, mRNA... 36 9.7
9gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 36 9.7
10ref|NM_008994.2| Mus musculus peroxisomal membrane protein 3 (Px... 36 9.7
11emb|CR382377.10| Zebrafish DNA sequence from clone DKEY-238I13 i... 36 9.7
12gb|CP000001.1| Bacillus cereus E33L, complete genome 36 9.7
13emb|AL592308.3| Human DNA sequence from clone RP13-610P22 on chr... 36 9.7
14emb|AL356108.12| Human DNA sequence from clone RP11-149J18 on ch... 36 9.7
15gb|AC114806.5| Homo sapiens BAC clone RP11-1251F13 from 4, compl... 36 9.7
16dbj|AK146530.1| Mus musculus 17 days pregnant adult female amnio... 36 9.7
17dbj|AK152331.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 36 9.7
18dbj|AK151121.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 36 9.7
19gb|AC154538.2| Mus musculus BAC clone RP23-451M23 from chromosom... 36 9.7
20gb|AF031128.1|AF031128 Mus musculus peroxisome membrane protein ... 36 9.7
21gb|AY232669.1| Dunaliella salina carbonic anhydrase gene, comple... 36 9.7
22gb|AC140998.5| Homo sapiens X BAC RP11-428I5 (Roswell Park Cance... 36 9.7
23gb|AF181866.1|AF181866 Synthetic construct for Penicillium janth... 36 9.7
24emb|Z17220.1|CGPERAF1 C.griseus mRNA for peroxisome assembly fac... 36 9.7
25emb|AL929040.12| Zebrafish DNA sequence from clone CH211-284M7 i... 36 9.7
26dbj|D30618.1|HAMPAF1C Cricetulus griseus PAF-1 mRNA for peroxiso... 36 9.7
27gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 36 9.7
28gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome 36 9.7
29gb|AC004063.1|AC004063 Homo sapiens chromosome 4 clone B32I8, co... 36 9.7
30emb|AL929112.6| Mouse DNA sequence from clone RP23-397G5 on chro... 36 9.7

>gb|AC006061.1| Homo sapiens X BAC GSHB-19O24 (Genome Systems Human BAC Library)
             complete sequence
          Length = 98056

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 34    atgggaccacacaagctgc 52
             |||||||||||||||||||
Sbjct: 56454 atgggaccacacaagctgc 56436



to top

>emb|CT573090.2| RP43-052E01, complete sequence
          Length = 161118

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 34     atgggaccacacaagctgc 52
              |||||||||||||||||||
Sbjct: 124216 atgggaccacacaagctgc 124234



to top

>gb|AY392533.1| Porcine teschovirus isolate DS 183/93 polyprotein gene, partial cds
          Length = 3684

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 42  acacaagctgcccaaaat 59
           ||||||||||||||||||
Sbjct: 924 acacaagctgcccaaaat 941



to top

>gb|AC119876.9| Mus musculus chromosome 3, clone RP24-309A12, complete sequence
          Length = 165926

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 35    tgggaccacacaagctgc 52
             ||||||||||||||||||
Sbjct: 54408 tgggaccacacaagctgc 54391



to top

>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome
          Length = 5237682

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 45      caagctgcccaaaatttt 62
               ||||||||||||||||||
Sbjct: 2769101 caagctgcccaaaatttt 2769118



to top

>gb|AC092198.5| Homo sapiens chromosome X clone XXbac-10326 map p11.4, complete sequence
          Length = 158456

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 41     cacacaagctgcccaaaa 58
              ||||||||||||||||||
Sbjct: 138434 cacacaagctgcccaaaa 138451



to top

>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 45      caagctgcccaaaatttt 62
               ||||||||||||||||||
Sbjct: 2729728 caagctgcccaaaatttt 2729745



to top

>gb|BC012404.1| Mus musculus peroxisomal membrane protein 3, mRNA (cDNA clone
           MGC:11449 IMAGE:3964491), complete cds
          Length = 1838

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 35  tgggaccacacaagctgc 52
           ||||||||||||||||||
Sbjct: 640 tgggaccacacaagctgc 623



to top

>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 45      caagctgcccaaaatttt 62
               ||||||||||||||||||
Sbjct: 2730063 caagctgcccaaaatttt 2730080



to top

>ref|NM_008994.2| Mus musculus peroxisomal membrane protein 3 (Pxmp3), mRNA
          Length = 1838

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 35  tgggaccacacaagctgc 52
           ||||||||||||||||||
Sbjct: 640 tgggaccacacaagctgc 623



to top

>emb|CR382377.10| Zebrafish DNA sequence from clone DKEY-238I13 in linkage group 17,
            complete sequence
          Length = 105441

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 16   attttatattaggggtta 33
            ||||||||||||||||||
Sbjct: 7226 attttatattaggggtta 7243



to top

>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 45      caagctgcccaaaatttt 62
               ||||||||||||||||||
Sbjct: 2793649 caagctgcccaaaatttt 2793666



to top

>emb|AL592308.3| Human DNA sequence from clone RP13-610P22 on chromosome 1, complete
              sequence
          Length = 170581

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 11     gaaaaattttatattagg 28
              ||||||||||||||||||
Sbjct: 141950 gaaaaattttatattagg 141933



to top

>emb|AL356108.12| Human DNA sequence from clone RP11-149J18 on chromosome 1 Contains part
             of a novel gene and a glutaminyl-tRNA synthase
             (glutamine-hydrolyzing)-like 1 (QRSL1) pseudogene,
             complete sequence
          Length = 162347

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 21    atattaggggttaatgggacca 42
             ||||||||| ||||||||||||
Sbjct: 42812 atattagggtttaatgggacca 42833



to top

>gb|AC114806.5| Homo sapiens BAC clone RP11-1251F13 from 4, complete sequence
          Length = 138121

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 10     ggaaaaattttatattaggggt 31
              |||||||||||||||| |||||
Sbjct: 133445 ggaaaaattttatatttggggt 133424



to top

>dbj|AK146530.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN
           full-length enriched library, clone:I920021E14
           product:peroxisomal membrane protein 3, full insert
           sequence
          Length = 1666

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 35  tgggaccacacaagctgc 52
           ||||||||||||||||||
Sbjct: 525 tgggaccacacaagctgc 508



to top

>dbj|AK152331.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830062I01 product:peroxisomal
           membrane protein 3, full insert sequence
          Length = 1588

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 35  tgggaccacacaagctgc 52
           ||||||||||||||||||
Sbjct: 447 tgggaccacacaagctgc 430



to top

>dbj|AK151121.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830025I06 product:peroxisomal
           membrane protein 3, full insert sequence
          Length = 1588

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 35  tgggaccacacaagctgc 52
           ||||||||||||||||||
Sbjct: 447 tgggaccacacaagctgc 430



to top

>gb|AC154538.2| Mus musculus BAC clone RP23-451M23 from chromosome 16, complete sequence
          Length = 176390

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 20     tatattaggggttaatgg 37
              ||||||||||||||||||
Sbjct: 118162 tatattaggggttaatgg 118145



to top

>gb|AF031128.1|AF031128 Mus musculus peroxisome membrane protein PEX2 mRNA, complete cds
          Length = 1749

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 35  tgggaccacacaagctgc 52
           ||||||||||||||||||
Sbjct: 608 tgggaccacacaagctgc 591



to top

>gb|AY232669.1| Dunaliella salina carbonic anhydrase gene, complete cds
          Length = 5070

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 42   acacaagctgcccaaaat 59
            ||||||||||||||||||
Sbjct: 2622 acacaagctgcccaaaat 2639



to top

>gb|AC140998.5| Homo sapiens X BAC RP11-428I5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 90420

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 15    aattttatattaggggtt 32
             ||||||||||||||||||
Sbjct: 42486 aattttatattaggggtt 42469



to top

>gb|AF181866.1|AF181866 Synthetic construct for Penicillium janthinellum fructosyl amino
            oxidase mRNA, complete cds
          Length = 1333

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 10   ggaaaaattttatattag 27
            ||||||||||||||||||
Sbjct: 1105 ggaaaaattttatattag 1122



to top

>emb|Z17220.1|CGPERAF1 C.griseus mRNA for peroxisome assembly factor 1
          Length = 1244

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 35  tgggaccacacaagctgc 52
           ||||||||||||||||||
Sbjct: 104 tgggaccacacaagctgc 87



to top

>emb|AL929040.12| Zebrafish DNA sequence from clone CH211-284M7 in linkage group 16,
             complete sequence
          Length = 171330

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 10    ggaaaaattttatattag 27
             ||||||||||||||||||
Sbjct: 17384 ggaaaaattttatattag 17367



to top

>dbj|D30618.1|HAMPAF1C Cricetulus griseus PAF-1 mRNA for peroxisome assembly factor-1,
           complete cds
          Length = 945

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 35  tgggaccacacaagctgc 52
           ||||||||||||||||||
Sbjct: 104 tgggaccacacaagctgc 87



to top

>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 45      caagctgcccaaaatttt 62
               ||||||||||||||||||
Sbjct: 2729600 caagctgcccaaaatttt 2729617



to top

>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome
          Length = 5224283

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 45      caagctgcccaaaatttt 62
               ||||||||||||||||||
Sbjct: 2811362 caagctgcccaaaatttt 2811379



to top

>gb|AC004063.1|AC004063 Homo sapiens chromosome 4 clone B32I8, complete sequence
          Length = 177014

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 17     ttttatattaggggttaa 34
              ||||||||||||||||||
Sbjct: 153421 ttttatattaggggttaa 153404



to top

>emb|AL929112.6| Mouse DNA sequence from clone RP23-397G5 on chromosome 4, complete
             sequence
          Length = 179785

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 16    attttatattaggggtta 33
             ||||||||||||||||||
Sbjct: 86398 attttatattaggggtta 86381


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 798,683
Number of Sequences: 3902068
Number of extensions: 798683
Number of successful extensions: 50895
Number of sequences better than 10.0: 30
Number of HSP's better than 10.0 without gapping: 30
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50712
Number of HSP's gapped (non-prelim): 183
length of query: 65
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 44
effective length of database: 17,151,101,840
effective search space: 754648480960
effective search space used: 754648480960
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top