ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbart39g01 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X84056.1|HVPAF93 H.vulgare paf93 gene Length = 1154 Score = 1007 bits (508), Expect = 0.0 Identities = 517/520 (99%) Strand = Plus / Minus Query: 1 acacaaagtgcccgtaataataagcaaataaacttaaacaacatccaggacctgactctg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1107 acacaaagtgcccgtaataataagcaaataaacttaaacaacatccaggacctgactctg 1048 Query: 61 gaccaaactgaagcccgtatacccaaactgaacacaagcatccgtcacctaacgggcttc 120 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 1047 gaccaaactgaagcccgtatacccaaactgaacacaagcatccgtcacctaacggacttc 988 Query: 121 acagaccggaccttcaaagacgatcaatccctccatcttgacacggacttaaacttaaag 180 ||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| Sbjct: 987 acagaccggaccttcaaagacgatcaatccctccatcttgacacggacttagacgtaaag 928 Query: 181 caaacacgacacacgccaacaatttaatggaggtccggtgatgagtctcggggcacggcg 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 927 caaacacgacacacgccaacaatttaatggaggtccggtgatgagtctcggggcacggcg 868 Query: 241 gcgatcaagctctgggcttgtgctcgcctgaaggggcggcggccttgtcctcctcccctg 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 867 gcgatcaagctctgggcttgtgctcgcctgaaggggcggcggccttgtcctcctcccctg 808 Query: 301 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcg 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 807 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcg 748 Query: 361 cgtccgggctgctcacctcctcggcggccggcgcaggcgcgtgcactggcgctggagcag 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 747 cgtccgggctgctcacctcctcggcggccggcgcaggcgcgtgcactggcgctggagcag 688 Query: 421 cgtgcgtgacgggcaccgcggcagcgtcctccggcttcttgtggccgccgggcagcttct 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 687 cgtgcgtgacgggcaccgcggcagcgtcctccggcttcttgtggccgccgggcagcttct 628 Query: 481 ccttgatcttttccaagaagcctttcttctcctcctcggg 520 |||||||||||||||||||||||||||||||||||||||| Sbjct: 627 ccttgatcttttccaagaagcctttcttctcctcctcggg 588 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttga 486 |||||||||||||||||||| Sbjct: 449 gccgggcagcttctccttga 430
>gb|AF043093.1|AF043093 Hordeum vulgare dehydrin 8 (dhn8) gene, complete cds Length = 2254 Score = 751 bits (379), Expect = 0.0 Identities = 379/379 (100%) Strand = Plus / Minus Query: 142 gatcaatccctccatcttgacacggacttaaacttaaagcaaacacgacacacgccaaca 201 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2246 gatcaatccctccatcttgacacggacttaaacttaaagcaaacacgacacacgccaaca 2187 Query: 202 atttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgt 261 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2186 atttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgt 2127 Query: 262 gctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagct 321 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2126 gctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagct 2067 Query: 322 tgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcct 381 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2066 tgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcct 2007 Query: 382 cggcggccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgcgg 441 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2006 cggcggccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgcgg 1947 Query: 442 cagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaagc 501 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1946 cagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaagc 1887 Query: 502 ctttcttctcctcctcggg 520 ||||||||||||||||||| Sbjct: 1886 ctttcttctcctcctcggg 1868 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttga 486 |||||||||||||||||||| Sbjct: 1729 gccgggcagcttctccttga 1710
>gb|U73211.1|TAU73211 Triticum aestivum cold acclimation protein WCOR410c (Wcor410c) mRNA, complete cds Length = 1242 Score = 611 bits (308), Expect = e-171 Identities = 411/440 (93%), Gaps = 4/440 (0%) Strand = Plus / Minus Query: 83 ccaaactgaa-cacaagcatccgtcacctaacgggcttcacagaccggaccttcaaagac 141 |||||||||| |||||||||||||||| |||||||||||| ||||| |||||||||||| Sbjct: 1037 ccaaactgaaacacaagcatccgtcactgaacgggcttcacggaccgaaccttcaaagac 978 Query: 142 gatcaatccctcc-atcttgacacggacttaaacttaaagcaaacacgacacacgccaac 200 |||||| |||||| | |||||||| |||||| | |||||||||||| |||||||||||| Sbjct: 977 gatcaacccctcccaccttgacaccaacttaa-cgtaaagcaaacacaacacacgccaac 919 Query: 201 aatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttg 260 |||| ||| |||||||||| | |||||||||| ||||||||||||||||| ||||||||| Sbjct: 918 aattcaatcgaggtccggtcacgagtctcggg-cacggcggcgatcaagcgctgggcttg 860 Query: 261 tgctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagc 320 |||||||||| || ||||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 859 tgctcgcctgcagcggcggcggccttgtcctcctcccctgtcttgtggtaaccaggcagc 800 Query: 321 ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcc 380 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 799 ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtcagggctgctcacctcc 740 Query: 381 tcggcggccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgcg 440 |||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||| Sbjct: 739 tcggcggctggcgccggcgcgtgcactggtgctggagcagcgtgcgtgacgggcaccgga 680 Query: 441 gcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaag 500 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 679 gcagcgtcctccggtttcttgtggccgccgggcagcttctccttgatcttttccaagaag 620 Query: 501 cctttcttctcctcctcggg 520 |||||||||||||||||||| Sbjct: 619 cctttcttctcctcctcggg 600 Score = 71.9 bits (36), Expect = 2e-09 Identities = 52/56 (92%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 17 ataataagcaaataaacttaaacaacatccaggacctgactctggaccaaactgaa 72 |||||||| ||| |||||||| |||||||||||||||||||||| ||||||||||| Sbjct: 1082 ataataagtaaacaaacttaa-caacatccaggacctgactctgaaccaaactgaa 1028 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttga 486 |||||||||||||||||||| Sbjct: 461 gccgggcagcttctccttga 442
>gb|L29152.1|WHTWCOR Triticum aestivum cold acclimation protein (WCOR410) mRNA, complete cds Length = 1136 Score = 603 bits (304), Expect = e-169 Identities = 409/440 (92%), Gaps = 3/440 (0%) Strand = Plus / Minus Query: 83 ccaaactgaa-cacaagcatccgtcacctaacgggcttcacagaccggaccttcaaagac 141 |||||||||| || ||||| ||||||| |||||||||||| |||||||||||||||||| Sbjct: 1038 ccaaactgaaacagaagcacccgtcactgaacgggcttcacggaccggaccttcaaagac 979 Query: 142 gatcaatccctcc-atcttgacacggacttaaacttaaagcaaacacgacacacgccaac 200 |||||| |||||| | |||||||| ||||| || |||||||||||| |||||||||||| Sbjct: 978 gatcaacccctcccaccttgacaccaacttagacgtaaagcaaacacaacacacgccaac 919 Query: 201 aatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttg 260 |||| ||| |||||||||| | | |||||||| ||||||||||||||||| ||||||||| Sbjct: 918 aattcaatcgaggtccggtcacgggtctcggg-cacggcggcgatcaagcgctgggcttg 860 Query: 261 tgctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagc 320 |||||||||| || ||||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 859 tgctcgcctgtagcggcggcggccttgtcctcctcccctgtcttgtggtaaccaggcagc 800 Query: 321 ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcc 380 |||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 799 ttgtccatgatcttgcccagcaggcccttcttctccttcgcgtcagggctgctcacctcc 740 Query: 381 tcggcggccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgcg 440 |||| ||||||| | |||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 739 tcgggggccggcaccggcgcgtgcactggtgctggagcagcgtgcgtgacgggcaccgca 680 Query: 441 gcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaag 500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 679 gcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaag 620 Query: 501 cctttcttctcctcctcggg 520 |||||||||||||||||||| Sbjct: 619 cctttcttctcctcctcggg 600 Score = 61.9 bits (31), Expect = 2e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 38 acaacatccaggacctgactctggaccaaactgaa 72 ||||||||||||||||||||||| ||||||||||| Sbjct: 1063 acaacatccaggacctgactctgaaccaaactgaa 1029
>gb|AF181458.1|AF181458 Hordeum vulgare dehydrin (Dhn8) mRNA, complete cds Length = 808 Score = 599 bits (302), Expect = e-168 Identities = 311/314 (99%) Strand = Plus / Minus Query: 207 atggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgtgctcg 266 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 808 atggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgtgctcg 749 Query: 267 cctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagcttgtcc 326 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 748 cctgaaggggcggcggccttgtcctcctcctctgtcttgtggtaaccgggcagcttgtcc 689 Query: 327 atgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcctcggcg 386 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 688 atgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcctcggcg 629 Query: 387 gccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgcggcagcg 446 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 628 gccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtggcgggcaccgcggcagcg 569 Query: 447 tcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaagcctttc 506 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 568 tcctccggcttcttgtggccgccgggcagcttctccttgattttttccaagaagcctttc 509 Query: 507 ttctcctcctcggg 520 |||||||||||||| Sbjct: 508 ttctcctcctcggg 495 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttga 486 |||||||||||||||||||| Sbjct: 356 gccgggcagcttctccttga 337
>gb|L19419.1|LHPESI Lophopyrum elongatum ES135 mRNA sequence Length = 1130 Score = 533 bits (269), Expect = e-148 Identities = 401/440 (91%), Gaps = 10/440 (2%) Strand = Plus / Minus Query: 83 ccaaactgaa-cacaagcatccgtcacctaacgggcttcacagaccggaccttcaaagac 141 |||||||||| ||||| |||||||||| ||||||||||||||||||||||||||| ||| Sbjct: 1009 ccaaactgaaacacaaacatccgtcactgaacgggcttcacagaccggaccttcaa-gac 951 Query: 142 gatcaatccctcc-atcttgacacggacttaaacttaaagcaaacacgacacacgccaac 200 |||||| |||||| | |||||||| ||||| || |||||||||||| |||||||||||| Sbjct: 950 gatcaacccctcccaccttgacaccaacttagacgtaaagcaaacacaacacacgccaac 891 Query: 201 aatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttg 260 |||| ||| ||| |||||| | |||||||||| |||||||||||| |||| ||||||||| Sbjct: 890 aattcaatcgagctccggtcacgagtctcggg-cacggcggcgattaagcgctgggcttg 832 Query: 261 tgctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagc 320 |||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 831 tgctcgcctgcaggggcggcggccttgtcctcctcccctgtcttgtggtaaccaggcagc 772 Query: 321 ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcc 380 |||||||||||||||||||| | ||||||||||||||||||||| ||||||||||| ||| Sbjct: 771 ttgtccatgatcttgcccagcaagcccttcttctccttcgcgtcagggctgctcacttcc 712 Query: 381 tcggcggccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgcg 440 ||||||||| ||||||||||| || ||||| ||||||||||||||||||||||| Sbjct: 711 tcggcggcc------ggcgcgtgcaccggtgctggggcagcgtgcgtgacgggcaccgca 658 Query: 441 gcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaag 500 ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 657 gcaacgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccatgaag 598 Query: 501 cctttcttctcctcctcggg 520 |||||||||||||||||||| Sbjct: 597 cctttcttctcctcctcggg 578 Score = 65.9 bits (33), Expect = 1e-07 Identities = 49/53 (92%), Gaps = 1/53 (1%) Strand = Plus / Minus Query: 20 ataagcaaataaacttaaacaacatccaggacctgactctggaccaaactgaa 72 ||||| ||| |||||||| |||||||||||||||||||||| ||||||||||| Sbjct: 1051 ataagtaaacaaacttaa-caacatccaggacctgactctgaaccaaactgaa 1000 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttga 486 |||||||||||||||||||| Sbjct: 439 gccgggcagcttctccttga 420
>emb|AJ890140.1| Triticum turgidum subsp. durum mRNA for dehydrin (dhn11 gene) Length = 1127 Score = 525 bits (265), Expect = e-146 Identities = 402/441 (91%), Gaps = 5/441 (1%) Strand = Plus / Minus Query: 83 ccaaactgaa-cacaagcatccgtcacctaacgggcttcacagaccggaccttcaaagac 141 |||||||||| |||||||||||||||| |||||||||||| ||||| |||||||||||| Sbjct: 1035 ccaaactgaaacacaagcatccgtcactgaacgggcttcacggaccgaaccttcaaagac 976 Query: 142 gatcaatccctcc-atcttgacacggacttaaacttaaagcaaacacgacacacgccaac 200 |||||| |||||| | |||||||| |||||| | |||||||||||| |||||||||||| Sbjct: 975 gatcaacccctcccaccttgacaccaacttaa-cgtaaagcaaacacaacacacgccaac 917 Query: 201 aatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttg 260 |||| ||| | |||||||| | |||||||||| |||||||||| |||||| |||| ||| Sbjct: 916 aattcaatcggggtccggtcacgagtctcggg-cacggcggcgttcaagcgttgggattg 858 Query: 261 tgctcgcc-tgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcag 319 |||||||| || || |||||||| |||||||||||||||||||||||||||||| ||||| Sbjct: 857 tgctcgccctgcagcggcggcggacttgtcctcctcccctgtcttgtggtaaccaggcag 798 Query: 320 cttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctc 379 ||||||||||||||||||||||||||||||||||||||||| ||| ||| || ||||||| Sbjct: 797 cttgtccatgatcttgcccagtaggcccttcttctccttcgggtcagggatggtcacctc 738 Query: 380 ctcggcggccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgc 439 |||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||| Sbjct: 737 ctcggcggatggcgccggcgcgtgcactggtgctggagcagcgtgcgtgacgggcaccgg 678 Query: 440 ggcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaa 499 |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 677 agcagcgtcctccggtttcttgtggccgccgggcagcttctccttgatcttttccaagaa 618 Query: 500 gcctttcttctcctcctcggg 520 ||||||||||||||||||||| Sbjct: 617 gcctttcttctcctcctcggg 597 Score = 71.9 bits (36), Expect = 2e-09 Identities = 52/56 (92%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 17 ataataagcaaataaacttaaacaacatccaggacctgactctggaccaaactgaa 72 |||||||| ||| |||||||| |||||||||||||||||||||| ||||||||||| Sbjct: 1080 ataataagtaaacaaacttaa-caacatccaggacctgactctgaaccaaactgaa 1026
>gb|U73210.1|TAU73210 Triticum aestivum cold acclimation protein WCOR410b (Wcor410b) mRNA, complete cds Length = 1181 Score = 448 bits (226), Expect = e-123 Identities = 327/358 (91%), Gaps = 2/358 (0%) Strand = Plus / Minus Query: 91 aacacaagcatccgtcacctaacgggcttcacagaccggaccttcaaagacgatcaatcc 150 |||| ||||| ||||||| |||||||||||| |||||||||||||||||||||||| || Sbjct: 1038 aacagaagcacccgtcactcaacgggcttcacggaccggaccttcaaagacgatcaaccc 979 Query: 151 ctcc-atcttgacacggacttaaacttaaagcaaacacgacacacgccaacaatttaatg 209 |||| | |||||||| ||||| || |||||||||||| |||||||||||||||| ||| Sbjct: 978 ctcccaccttgacaccaacttagacgtaaagcaaacacaacacacgccaacaattcaatc 919 Query: 210 gaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgtgctcgcct 269 |||||||||| | | |||||||| ||||||||||||||||| |||||||||||||||||| Sbjct: 918 gaggtccggtcacgggtctcggg-cacggcggcgatcaagcgctgggcttgtgctcgcct 860 Query: 270 gaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagcttgtccatg 329 | || ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 859 gtagcggcggcggccttgtcctcctcccctgtcttgtggtaaccaggcagcttgtccatg 800 Query: 330 atcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcctcggcggcc 389 ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 799 atcttgcccagcaggcccttcttctccttcgcgtcagggctgctcacctcctcggcggcc 740 Query: 390 ggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgcggcagcgt 447 ||||| ||||||||||| || |||||||||||||||||||||||| ||| ||||||| Sbjct: 739 ggcgccggcgcgtgcaccggtgctggagcagcgtgcgtgacgggcgccggagcagcgt 682 Score = 208 bits (105), Expect = 1e-50 Identities = 111/113 (98%) Strand = Plus / Minus Query: 408 ggcgctggagcagcgtgcgtgacgggcaccgcggcagcgtcctccggcttcttgtggccg 467 ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 697 ggcgccggagcagcgtgcgtgacgggcaccgcagcagcgtcctccggcttcttgtggccg 638 Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctcctcctcggg 520 ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 637 ccgggcagcttctccttgatcttttccaagaagcctttcttctcctcctcggg 585
>gb|AY574032.1| Triticum aestivum dehydrin-like gene, partial sequence Length = 391 Score = 319 bits (161), Expect = 5e-84 Identities = 192/201 (95%), Gaps = 1/201 (0%) Strand = Plus / Minus Query: 321 ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcc 380 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 390 ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtcagggctgctcacctcc 331 Query: 381 tcggcggccggcgcaggcgcgtgc-actggcgctggagcagcgtgcgtgacgggcaccgc 439 |||||||| ||||| ||||||||| ||||| |||||||||||||||||||||||| ||| Sbjct: 330 tcggcggctggcgccggcgcgtgctactggtgctggagcagcgtgcgtgacgggcgccgg 271 Query: 440 ggcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaa 499 |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 270 agcagcgtcctccggtttcttgtggccgccgggcagcttctccttgatcttttccaagaa 211 Query: 500 gcctttcttctcctcctcggg 520 ||||||||||||||||||||| Sbjct: 210 gcctttcttctcctcctcggg 190
>gb|AY587109.1| Oryza sativa (japonica cultivar-group) dehydration-stress inducible protein 1 mRNA, complete cds Length = 1315 Score = 113 bits (57), Expect = 6e-22 Identities = 72/77 (93%) Strand = Plus / Minus Query: 444 gcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaagcct 503 ||||| ||||||||||||||||||||||||||||||||||||||||| || | |||||| Sbjct: 758 gcgtcttccggcttcttgtggccgccgggcagcttctccttgatcttgtcgaggaagccc 699 Query: 504 ttcttctcctcctcggg 520 ||||||||||||||||| Sbjct: 698 ttcttctcctcctcggg 682 Score = 105 bits (53), Expect = 1e-19 Identities = 74/81 (91%) Strand = Plus / Minus Query: 302 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 361 |||||||||||||||||| || ||||||||||||||||||| ||||||||||||||| | Sbjct: 918 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 859 Query: 362 gtccgggctgctcacctcctc 382 |||||||||||||| ||||| Sbjct: 858 atccgggctgctcacttcctc 838 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatctt 490 |||||||||||||||||||||||| Sbjct: 474 gccgggcagcttctccttgatctt 451 Score = 44.1 bits (22), Expect = 0.45 Identities = 40/46 (86%) Strand = Plus / Minus Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 357 ||||||||||| ||| |||||||| | || | |||||||||||||| Sbjct: 734 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 689
>gb|AY786415.1| Oryza sativa (japonica cultivar-group) SK3-type dehydrin 1 (Dhn1) mRNA, complete cds Length = 1117 Score = 113 bits (57), Expect = 6e-22 Identities = 72/77 (93%) Strand = Plus / Minus Query: 444 gcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaagcct 503 ||||| ||||||||||||||||||||||||||||||||||||||||| || | |||||| Sbjct: 748 gcgtcttccggcttcttgtggccgccgggcagcttctccttgatcttgtcgaggaagccc 689 Query: 504 ttcttctcctcctcggg 520 ||||||||||||||||| Sbjct: 688 ttcttctcctcctcggg 672 Score = 105 bits (53), Expect = 1e-19 Identities = 74/81 (91%) Strand = Plus / Minus Query: 302 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 361 |||||||||||||||||| || ||||||||||||||||||| ||||||||||||||| | Sbjct: 908 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 849 Query: 362 gtccgggctgctcacctcctc 382 |||||||||||||| ||||| Sbjct: 848 atccgggctgctcacttcctc 828 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatctt 490 |||||||||||||||||||||||| Sbjct: 464 gccgggcagcttctccttgatctt 441 Score = 44.1 bits (22), Expect = 0.45 Identities = 40/46 (86%) Strand = Plus / Minus Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 357 ||||||||||| ||| |||||||| | || | |||||||||||||| Sbjct: 724 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 679
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 113 bits (57), Expect = 6e-22 Identities = 72/77 (93%) Strand = Plus / Plus Query: 444 gcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaagcct 503 ||||| ||||||||||||||||||||||||||||||||||||||||| || | |||||| Sbjct: 27184529 gcgtcttccggcttcttgtggccgccgggcagcttctccttgatcttgtcgaggaagccc 27184588 Query: 504 ttcttctcctcctcggg 520 ||||||||||||||||| Sbjct: 27184589 ttcttctcctcctcggg 27184605 Score = 105 bits (53), Expect = 1e-19 Identities = 74/81 (91%) Strand = Plus / Plus Query: 302 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 361 |||||||||||||||||| || ||||||||||||||||||| ||||||||||||||| | Sbjct: 27184369 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 27184428 Query: 362 gtccgggctgctcacctcctc 382 |||||||||||||| ||||| Sbjct: 27184429 atccgggctgctcacttcctc 27184449 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 467 gccgggcagcttctccttgatctt 490 |||||||||||||||||||||||| Sbjct: 27184813 gccgggcagcttctccttgatctt 27184836 Score = 44.1 bits (22), Expect = 0.45 Identities = 40/46 (86%) Strand = Plus / Plus Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 357 ||||||||||| ||| |||||||| | || | |||||||||||||| Sbjct: 27184553 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 27184598
>dbj|AP004858.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1725_H08 Length = 155431 Score = 113 bits (57), Expect = 6e-22 Identities = 72/77 (93%) Strand = Plus / Plus Query: 444 gcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaagcct 503 ||||| ||||||||||||||||||||||||||||||||||||||||| || | |||||| Sbjct: 80978 gcgtcttccggcttcttgtggccgccgggcagcttctccttgatcttgtcgaggaagccc 81037 Query: 504 ttcttctcctcctcggg 520 ||||||||||||||||| Sbjct: 81038 ttcttctcctcctcggg 81054 Score = 105 bits (53), Expect = 1e-19 Identities = 74/81 (91%) Strand = Plus / Plus Query: 302 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 361 |||||||||||||||||| || ||||||||||||||||||| ||||||||||||||| | Sbjct: 80818 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 80877 Query: 362 gtccgggctgctcacctcctc 382 |||||||||||||| ||||| Sbjct: 80878 atccgggctgctcacttcctc 80898 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 467 gccgggcagcttctccttgatctt 490 |||||||||||||||||||||||| Sbjct: 81262 gccgggcagcttctccttgatctt 81285 Score = 44.1 bits (22), Expect = 0.45 Identities = 40/46 (86%) Strand = Plus / Plus Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 357 ||||||||||| ||| |||||||| | || | |||||||||||||| Sbjct: 81002 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 81047
>dbj|AP005055.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0684A08 Length = 137841 Score = 113 bits (57), Expect = 6e-22 Identities = 72/77 (93%) Strand = Plus / Plus Query: 444 gcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaagcct 503 ||||| ||||||||||||||||||||||||||||||||||||||||| || | |||||| Sbjct: 35200 gcgtcttccggcttcttgtggccgccgggcagcttctccttgatcttgtcgaggaagccc 35259 Query: 504 ttcttctcctcctcggg 520 ||||||||||||||||| Sbjct: 35260 ttcttctcctcctcggg 35276 Score = 105 bits (53), Expect = 1e-19 Identities = 74/81 (91%) Strand = Plus / Plus Query: 302 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 361 |||||||||||||||||| || ||||||||||||||||||| ||||||||||||||| | Sbjct: 35040 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 35099 Query: 362 gtccgggctgctcacctcctc 382 |||||||||||||| ||||| Sbjct: 35100 atccgggctgctcacttcctc 35120 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 467 gccgggcagcttctccttgatctt 490 |||||||||||||||||||||||| Sbjct: 35484 gccgggcagcttctccttgatctt 35507 Score = 44.1 bits (22), Expect = 0.45 Identities = 40/46 (86%) Strand = Plus / Plus Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 357 ||||||||||| ||| |||||||| | || | |||||||||||||| Sbjct: 35224 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 35269
>dbj|AK070197.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023042N13, full insert sequence Length = 1292 Score = 113 bits (57), Expect = 6e-22 Identities = 72/77 (93%) Strand = Plus / Minus Query: 444 gcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaagcct 503 ||||| ||||||||||||||||||||||||||||||||||||||||| || | |||||| Sbjct: 770 gcgtcttccggcttcttgtggccgccgggcagcttctccttgatcttgtcgaggaagccc 711 Query: 504 ttcttctcctcctcggg 520 ||||||||||||||||| Sbjct: 710 ttcttctcctcctcggg 694 Score = 105 bits (53), Expect = 1e-19 Identities = 74/81 (91%) Strand = Plus / Minus Query: 302 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 361 |||||||||||||||||| || ||||||||||||||||||| ||||||||||||||| | Sbjct: 930 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 871 Query: 362 gtccgggctgctcacctcctc 382 |||||||||||||| ||||| Sbjct: 870 atccgggctgctcacttcctc 850 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatctt 490 |||||||||||||||||||||||| Sbjct: 486 gccgggcagcttctccttgatctt 463 Score = 44.1 bits (22), Expect = 0.45 Identities = 40/46 (86%) Strand = Plus / Minus Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 357 ||||||||||| ||| |||||||| | || | |||||||||||||| Sbjct: 746 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 701
>dbj|AB011367.1| Oryza sativa mRNA for LIP9, partial cds Length = 680 Score = 113 bits (57), Expect = 6e-22 Identities = 72/77 (93%) Strand = Plus / Minus Query: 444 gcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaagcct 503 ||||| ||||||||||||||||||||||||||||||||||||||||| || | |||||| Sbjct: 191 gcgtcttccggcttcttgtggccgccgggcagcttctccttgatcttgtcgaggaagccc 132 Query: 504 ttcttctcctcctcggg 520 ||||||||||||||||| Sbjct: 131 ttcttctcctcctcggg 115 Score = 105 bits (53), Expect = 1e-19 Identities = 74/81 (91%) Strand = Plus / Minus Query: 302 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 361 |||||||||||||||||| || ||||||||||||||||||| ||||||||||||||| | Sbjct: 351 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 292 Query: 362 gtccgggctgctcacctcctc 382 |||||||||||||| ||||| Sbjct: 291 atccgggctgctcacttcctc 271 Score = 44.1 bits (22), Expect = 0.45 Identities = 40/46 (86%) Strand = Plus / Minus Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 357 ||||||||||| ||| |||||||| | || | |||||||||||||| Sbjct: 167 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 122
>gb|BT019045.1| Zea mays clone Contig566.F mRNA sequence Length = 722 Score = 97.6 bits (49), Expect = 3e-17 Identities = 70/77 (90%) Strand = Plus / Minus Query: 441 gcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaag 500 |||||||| ||||||||||||||||| ||||| ||||||||||||||||| |||| | | Sbjct: 219 gcagcgtcttccggcttcttgtggccaccgggtagcttctccttgatcttgtccagcagg 160 Query: 501 cctttcttctcctcctc 517 ||||||||||||||||| Sbjct: 159 cctttcttctcctcctc 143 Score = 63.9 bits (32), Expect = 5e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 301 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttctt 352 |||||||||| ||||| | ||||||||||||||||||||| | ||||||||| Sbjct: 353 tcttgtggtagccgggtatcttgtccatgatcttgcccagcaagcccttctt 302
>gb|L35913.1|MZELIPASE Zea mays dehydrin (dhn-2) mRNA, complete cds Length = 1277 Score = 97.6 bits (49), Expect = 3e-17 Identities = 70/77 (90%) Strand = Plus / Minus Query: 441 gcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaag 500 |||||||| ||||||||||||||||| ||||| ||||||||||||||||| |||| | | Sbjct: 730 gcagcgtcttccggcttcttgtggccaccgggtagcttctccttgatcttgtccagcagg 671 Query: 501 cctttcttctcctcctc 517 ||||||||||||||||| Sbjct: 670 cctttcttctcctcctc 654 Score = 63.9 bits (32), Expect = 5e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 301 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttctt 352 |||||||||| ||||| | ||||||||||||||||||||| | ||||||||| Sbjct: 864 tcttgtggtagccgggtatcttgtccatgatcttgcccagcaagcccttctt 813
>gb|AY105067.1| Zea mays PCO081051 mRNA sequence Length = 1398 Score = 87.7 bits (44), Expect = 3e-14 Identities = 68/76 (89%) Strand = Plus / Minus Query: 301 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcg 360 |||||||||| ||||| | ||||||||||||||||||||| | ||||||||||||||| Sbjct: 928 tcttgtggtagccgggtatcttgtccatgatcttgcccagcaagcccttcttctccttgc 869 Query: 361 cgtccgggctgctcac 376 | |||||||||||||| Sbjct: 868 catccgggctgctcac 853 Score = 69.9 bits (35), Expect = 8e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 459 ttgtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctcctcctc 517 |||||||| ||||| ||||||||||||||||| |||| | |||||||||||||||||| Sbjct: 773 ttgtggccaccggggagcttctccttgatcttgtccagcaggcctttcttctcctcctc 715
>gb|AY111114.1| Zea mays CL2452_1 mRNA sequence Length = 1256 Score = 81.8 bits (41), Expect = 2e-12 Identities = 63/69 (91%), Gaps = 1/69 (1%) Strand = Plus / Minus Query: 450 tccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaa-gcctttctt 508 ||||||||||||||||| ||||| ||||||||||||||||| |||| || ||||||||| Sbjct: 700 tccggcttcttgtggccaccgggtagcttctccttgatcttgtccagcaaggcctttctt 641 Query: 509 ctcctcctc 517 ||||||||| Sbjct: 640 ctcctcctc 632 Score = 63.9 bits (32), Expect = 5e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 301 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttctt 352 |||||||||| ||||| | ||||||||||||||||||||| | ||||||||| Sbjct: 843 tcttgtggtagccgggtatcttgtccatgatcttgcccagcaagcccttctt 792
>gb|AF190474.2|AF190474 Boea crassifolia bdn1 (bdn1) mRNA, partial cds Length = 756 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 464 gccgccgggcagcttctccttgatcttttccaagaagcctttcttctcctcc 515 ||||||||| ||||||||||||||||| || ||||| ||||||||||||||| Sbjct: 570 gccgccgggtagcttctccttgatcttatctaagaaccctttcttctcctcc 519 Score = 48.1 bits (24), Expect = 0.029 Identities = 36/40 (90%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctcct 513 ||||||||||| ||||| |||||||| |||||||| |||| Sbjct: 692 agcttctcctttatcttatccaagaaacctttcttttcct 653
>gb|AY177889.1| Sorghum bicolor clone BAC IS_21O3 ABA-induced RAB17-like gene, partial sequence Length = 4636 Score = 63.9 bits (32), Expect = 5e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||||||||| |||| || |||||||||||| Sbjct: 1501 ccgggcagcttctccttgatcttgtccatgatgcctttcttctc 1458 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||| ||||||||||||||||||||||| Sbjct: 1361 cttgtggcctccgggcagcttctccttgatctt 1329
>gb|U63831.1|SBU63831 Sorghum bicolor dehydrin (DHN2) mRNA, partial cds Length = 549 Score = 63.9 bits (32), Expect = 5e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||||||||| |||| || |||||||||||| Sbjct: 312 ccgggcagcttctccttgatcttgtccatgatgcctttcttctc 269 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||| ||||||||||||||||||||||| Sbjct: 175 cttgtggcctccgggcagcttctccttgatctt 143
>gb|U11696.1|SBU11696 Sorghum bicolor dehydrin (DHN1) mRNA, complete cds Length = 748 Score = 63.9 bits (32), Expect = 5e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||||||||| |||| || |||||||||||| Sbjct: 490 ccgggcagcttctccttgatcttgtccatgatgcctttcttctc 447 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatcttttc 493 ||||||| | |||||||||||||||||||||||||| Sbjct: 353 cttgtgggctccgggcagcttctccttgatcttttc 318
>gb|M93342.2|WHTCOAC Triticum aestivum cold acclimation protein WCS120 (WCS120) mRNA, complete cds Length = 1504 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 100 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttctc 50
>gb|AF031247.1|AF031247 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-2) mRNA, complete cds Length = 1518 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 131 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttctc 81 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 ||||||| ||||| |||||||||||||| ||||||| || ||| |||||||| Sbjct: 1083 tgtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 1032 Score = 46.1 bits (23), Expect = 0.11 Identities = 44/51 (86%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| ||||| |||||||| || |||| || |||||||||||| Sbjct: 890 gtggccaccggggagcttgtccttgatgttctccatgacgcctttcttctc 840 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 1282 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 1242
>gb|AF181455.1|AF181455 Hordeum vulgare dehydrin (Dhn5) gene, complete cds Length = 3447 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 676 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttctc 626 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| |||||||||||||| ||||||| || ||| |||||||| Sbjct: 1921 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 1871 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 2313 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 2273 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 2114 tgtggccaccggggagcttctccttgat 2087
>gb|AF058794.1|AF058794 Triticum aestivum COR39 (cor39) mRNA, complete cds Length = 1243 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 128 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttctc 78 Score = 46.1 bits (23), Expect = 0.11 Identities = 44/51 (86%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| |||||||||||||| || |||| || ||| |||||||| Sbjct: 953 gtggccaccggggagcttctccttgatgttctccatgacgcccttcttctc 903 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 1213 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 1173
>gb|M95810.1|BLYDHN5 Hordeum vulgare dehydrin DHN5 (Dhn5) gene, complete cds Length = 2432 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 669 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttctc 619 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| |||||||||||||| ||||||| || ||| |||||||| Sbjct: 1914 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 1864 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 2306 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 2266 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 2107 tgtggccaccggggagcttctccttgat 2080
>gb|L27516.1|WHTWCS66X Triticum aestivum (Wcs66) gene, complete cds Length = 1629 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 154 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttctc 104
>gb|DQ160121.1| Taraxacum officinale TO101-3 (To101-3) mRNA, partial cds Length = 322 Score = 60.0 bits (30), Expect = 8e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatcttttcca 495 ||||||||||||||| ||||||||||||||||| |||| Sbjct: 222 cttgtggccgccgggaagcttctccttgatcttctcca 185
>emb|AJ439990.1|OSA439990 Oryza sativa partial mRNA for putative cold acclimation protein (cap-L gene) Length = 504 Score = 60.0 bits (30), Expect = 8e-06 Identities = 38/41 (92%) Strand = Plus / Minus Query: 302 cttgtggtaaccgggcagcttgtccatgatcttgcccagta 342 |||||||||||||||||| || | ||||||||||||||||| Sbjct: 123 cttgtggtaaccgggcagtttctncatgatcttgcccagta 83
>emb|AJ844000.1| Plantago major mRNA for dehydrin 1 (dhn1 gene) Length = 1034 Score = 60.0 bits (30), Expect = 8e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 476 cttctccttgatcttttccaagaagcctttcttctcct 513 ||||||||||||||| |||||||| ||||||||||||| Sbjct: 737 cttctccttgatcttctccaagaatcctttcttctcct 700
>gb|AC145325.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0034E03 map near 50283S, complete sequence Length = 134074 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||||||||||||||||||| |||| ||| || |||||||| Sbjct: 67046 gccgggcagcttctccttgatcttgtccatgaatcccttcttctc 67002 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||||||||||||||||||||| Sbjct: 66878 cttgttgccgccgggcagcttctccttgatctt 66846 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||||||||||||||||||| |||| || ||| |||||||| Sbjct: 60505 gccgggcagcttctccttgatcttgtccatgatgcccttcttctc 60461 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 82901 gccggggagcttctccttgatcttgtccacgatgcccttcttctc 82857 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||| ||||||||||||||||| Sbjct: 82721 cttgttgccgccggggagcttctccttgatctt 82689 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| ||||||||||| |||| |||||| |||||||| Sbjct: 75489 gccgggaagcttttccttgatcttgtccatgaagcccttcttctc 75445 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||| ||||||||||||||||| Sbjct: 75315 cttgttgccgccggggagcttctccttgatctt 75283 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||| ||||||||||||||||| Sbjct: 60343 cttgttgccgccggggagcttctccttgatctt 60311 Score = 40.1 bits (20), Expect = 7.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 60504 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 60461
>gb|AY349271.1| Hordeum vulgare subsp. spontaneum NPGS PI 559559 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 821 cttgtggccgccggggagcttctccttgatctt 789 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 976 ggcagcttctccttgatcttgtcca 952
>gb|AY349270.1| Hordeum vulgare subsp. spontaneum NPGS PI 559556 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 823 cttgtggccgccggggagcttctccttgatctt 791 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 978 ggcagcttctccttgatcttgtcca 954
>gb|AY349269.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349268.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 821 cttgtggccgccggggagcttctccttgatctt 789 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 976 ggcagcttctccttgatcttgtcca 952
>gb|AY349267.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 821 cttgtggccgccggggagcttctccttgatctt 789 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 976 ggcagcttctccttgatcttgtcca 952
>gb|AY349266.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 dehydrin 9 (Dhn9) gene, complete cds Length = 992 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 808 cttgtggccgccggggagcttctccttgatctt 776 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 963 ggcagcttctccttgatcttgtcca 939
>gb|AY349265.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 dehydrin 9 (Dhn9) gene, complete cds Length = 994 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 810 cttgtggccgccggggagcttctccttgatctt 778 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 965 ggcagcttctccttgatcttgtcca 941
>gb|AY349264.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349263.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 821 cttgtggccgccggggagcttctccttgatctt 789 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 976 ggcagcttctccttgatcttgtcca 952
>gb|AY349262.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 dehydrin 9 (Dhn9) gene, complete cds Length = 1000 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 816 cttgtggccgccggggagcttctccttgatctt 784 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 971 ggcagcttctccttgatcttgtcca 947
>gb|AY349261.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 821 cttgtggccgccggggagcttctccttgatctt 789 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 976 ggcagcttctccttgatcttgtcca 952
>gb|AY349260.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349259.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 823 cttgtggccgccggggagcttctccttgatctt 791 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 978 ggcagcttctccttgatcttgtcca 954
>gb|AY349258.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349257.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 823 cttgtggccgccggggagcttctccttgatctt 791 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 978 ggcagcttctccttgatcttgtcca 954
>gb|AY349256.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349255.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349254.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349253.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349252.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349251.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 dehydrin 9 (Dhn9) gene, complete cds Length = 1004 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 820 cttgtggccgccggggagcttctccttgatctt 788 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 975 ggcagcttctccttgatcttgtcca 951
>gb|AY349250.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349249.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 823 cttgtggccgccggggagcttctccttgatctt 791 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 978 ggcagcttctccttgatcttgtcca 954
>gb|AY349248.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 972 ggcagcttctccttgatcttgtcca 948
>gb|AY349247.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 823 cttgtggccgccggggagcttctccttgatctt 791 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 978 ggcagcttctccttgatcttgtcca 954
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||||||||||||||||||| |||| || ||| |||||||| Sbjct: 14766555 gccgggcagcttctccttgatcttgtccatgatgcccttcttctc 14766599 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||||||||||||||||||||| Sbjct: 14760182 cttgttgccgccgggcagcttctccttgatctt 14760214 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||||||||||||||||||| |||| ||| || |||||||| Sbjct: 14760014 gccgggcagcttctccttgatcttgtccatgaatcccttcttctc 14760058 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||| ||||||||||||||||| Sbjct: 14766717 cttgttgccgccggggagcttctccttgatctt 14766749 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||| ||||||||||||||||| Sbjct: 14751745 cttgttgccgccggggagcttctccttgatctt 14751777 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Plus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| ||||||||||| |||| |||||| |||||||| Sbjct: 14751571 gccgggaagcttttccttgatcttgtccatgaagcccttcttctc 14751615 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||| ||||||||||||||||| Sbjct: 14744339 cttgttgccgccggggagcttctccttgatctt 14744371 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Plus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 14744159 gccggggagcttctccttgatcttgtccacgatgcccttcttctc 14744203 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||| ||||||||||||||||| Sbjct: 14645822 cttgttgccgccggggagcttctccttgatctt 14645854 Score = 40.1 bits (20), Expect = 7.0 Identities = 38/44 (86%) Strand = Plus / Plus Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 14766556 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 14766599 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 468 ccgggcagcttctccttgatcttttcca 495 ||||| ||||||||||||||||| |||| Sbjct: 14645646 ccggggagcttctccttgatcttctcca 14645673
>emb|Y00842.1|OSRAB21 Rice rab21 gene for water-stress inducible protein RAB21 Length = 2537 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||||||||||||||||||| |||| || ||| |||||||| Sbjct: 2164 gccgggcagcttctccttgatcttgtccatgatgcccttcttctc 2120 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||| ||||||||||||||||| Sbjct: 1972 cttgttgccgccggggagcttctccttgatctt 1940 Score = 40.1 bits (20), Expect = 7.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 2163 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 2120
>emb|X78431.1|TDDEH27 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd27e Length = 751 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 325 cttgtggccgccggggagcttctccttgatctt 293
>emb|X15290.1|HVDHN3 Zea mays mRNA for dehydrin (dhn1 gene) Length = 852 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||| ||||||||||||||||||||||| Sbjct: 422 cttgtggcctccgggcagcttctccttgatctt 390 Score = 48.1 bits (24), Expect = 0.029 Identities = 39/44 (88%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||||||||| |||||||| |||| | |||||||||||| Sbjct: 589 ccgggcagcttctctttgatcttgtccataatgcctttcttctc 546
>emb|X52422.1|OSRAB16B O.sativa DNA for rab 16B gene Length = 2890 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||||||||||||||||||| |||| ||| || |||||||| Sbjct: 1976 gccgggcagcttctccttgatcttgtccatgaatcccttcttctc 1932 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||||||||||||||||||||| Sbjct: 1808 cttgttgccgccgggcagcttctccttgatctt 1776
>gb|U60097.2|OSU60097 Oryza sativa dehydrin mRNA, complete cds Length = 864 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||||||||||||||||||| |||| || ||| |||||||| Sbjct: 573 gccgggcagcttctccttgatcttgtccatgatgcccttcttctc 529 Score = 40.1 bits (20), Expect = 7.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 572 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 529
>gb|AF181459.1|AF181459 Hordeum vulgare dehydrin (Dhn9) gene, complete cds Length = 1791 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 988 cttgtggccgccggggagcttctccttgatctt 956 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 1143 ggcagcttctccttgatcttgtcca 1119
>dbj|AK063517.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-116-H03, full insert sequence Length = 872 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||||||||||||||||||| |||| ||| || |||||||| Sbjct: 621 gccgggcagcttctccttgatcttgtccatgaatcccttcttctc 577 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||||||||||||||||||||| Sbjct: 453 cttgttgccgccgggcagcttctccttgatctt 421
>gb|AF043094.1|AF043094 Hordeum vulgare dehydrin 9 (dhn9) gene, complete cds Length = 1630 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||||||||| ||||||||||||||||| Sbjct: 1048 cttgtggccgccggggagcttctccttgatctt 1016 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 1203 ggcagcttctccttgatcttgtcca 1179
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||||||||||||||||||| |||| || ||| |||||||| Sbjct: 14846992 gccgggcagcttctccttgatcttgtccatgatgcccttcttctc 14847036 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||||||||||||||||||||| Sbjct: 14840619 cttgttgccgccgggcagcttctccttgatctt 14840651 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||||||||||||||||||| |||| ||| || |||||||| Sbjct: 14840451 gccgggcagcttctccttgatcttgtccatgaatcccttcttctc 14840495 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||| ||||||||||||||||| Sbjct: 14847154 cttgttgccgccggggagcttctccttgatctt 14847186 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||| ||||||||||||||||| Sbjct: 14832182 cttgttgccgccggggagcttctccttgatctt 14832214 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Plus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| ||||||||||| |||| |||||| |||||||| Sbjct: 14832008 gccgggaagcttttccttgatcttgtccatgaagcccttcttctc 14832052 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||| ||||||||||||||||| Sbjct: 14824776 cttgttgccgccggggagcttctccttgatctt 14824808 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Plus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 14824596 gccggggagcttctccttgatcttgtccacgatgcccttcttctc 14824640 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||| ||||||||||||||||| Sbjct: 14727823 cttgttgccgccggggagcttctccttgatctt 14727855 Score = 40.1 bits (20), Expect = 7.0 Identities = 38/44 (86%) Strand = Plus / Plus Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 14846993 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 14847036 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 468 ccgggcagcttctccttgatcttttcca 495 ||||| ||||||||||||||||| |||| Sbjct: 14727647 ccggggagcttctccttgatcttctcca 14727674
>gb|AF031248.1|AF031248 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-3) mRNA, complete cds Length = 793 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||||||||| |||| || ||| |||||||| Sbjct: 473 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 430 Score = 40.1 bits (20), Expect = 7.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 473 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 430
>dbj|AK121952.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107K14, full insert sequence Length = 709 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttct 510 |||||||||||||||||||||||| |||| || ||| ||||||| Sbjct: 602 gccgggcagcttctccttgatcttgtccatgatgcccttcttct 559 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||| ||||||||||||||||| Sbjct: 440 cttgttgccgccggggagcttctccttgatctt 408
>emb|X78429.1|TDDEH16 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd16 Length = 814 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||||||||| |||| || ||| |||||||| Sbjct: 505 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 462 Score = 40.1 bits (20), Expect = 7.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 505 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 462
>emb|X15994.1|ZMRAB17G Maize RAB-17 gene Length = 1986 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||||||||| |||| | |||||||||||| Sbjct: 1287 ccgggcagcttctccttgatcttgtccataatgcctttcttctc 1244 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||| |||||||||||||| |||||||| Sbjct: 1120 cttgtggcctccgggcagcttctctttgatctt 1088
>emb|X15287.1|HVDHN18 Barley mRNA for dehydrin (dhn18) Length = 1049 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||||||||| |||| || ||| |||||||| Sbjct: 742 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 699 Score = 40.1 bits (20), Expect = 7.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 742 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 699
>emb|X15286.1|HVDHN17 Barley mRNA for dehydrin (dhn17) Length = 812 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||||||||| |||| || ||| |||||||| Sbjct: 535 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 492 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatctt 490 |||||| ||||| ||||||||||||||||| Sbjct: 332 gtggccaccggggagcttctccttgatctt 303 Score = 40.1 bits (20), Expect = 7.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 535 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 492
>gb|AF181456.1|AF181456 Hordeum vulgare dehydrin (Dhn6) mRNA, complete cds Length = 1637 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 456 ttcttgtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||| || ||||||||||||||||| |||| || ||| |||||||| Sbjct: 1302 ttcttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttctc 1247 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttcca 495 |||||||||||| ||||||||||||||||| |||| Sbjct: 1474 gtggccgccggggagcttctccttgatcttctcca 1440 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatctt 490 |||||||| ||||||||||||||||| Sbjct: 1149 ccgccggggagcttctccttgatctt 1124
>gb|AF181453.1|AF181453 Hordeum vulgare dehydrin (Dhn3) gene, complete cds Length = 1575 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||||||||| |||| || ||| |||||||| Sbjct: 1350 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 1307 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatctt 490 |||||| ||||| ||||||||||||||||| Sbjct: 1147 gtggccaccggggagcttctccttgatctt 1118 Score = 40.1 bits (20), Expect = 7.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 1350 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 1307
>gb|AF043089.1|AF043089 Hordeum vulgare dehydrin 3 (dhn3) gene, complete cds Length = 1560 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||||||||| |||| || ||| |||||||| Sbjct: 1313 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 1270 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatctt 490 |||||| ||||| ||||||||||||||||| Sbjct: 1110 gtggccaccggggagcttctccttgatctt 1081 Score = 40.1 bits (20), Expect = 7.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 ||||||||||| ||| |||||||| ||| | |||||||||||| Sbjct: 1313 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 1270
>gb|AY737725.1| Salvia miltiorrhiza dehydrin mRNA, partial cds Length = 864 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttccaagaagcctttcttctcct 513 |||||||||||||||||||| |||||||| || ||||| |||| Sbjct: 673 ggcagcttctccttgatcttatccaagaatcccttcttttcct 631 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 464 gccgccgggcagcttctccttgatcttttccaagaagcctttcttctcctc 514 |||||| || ||||| ||||||||||| || | |||||||||||||||||| Sbjct: 545 gccgcctgggagcttgtccttgatcttgtctaggaagcctttcttctcctc 495
>gb|AY695932.1| Salvia miltiorrhiza dehydration protein (bdn1) mRNA, complete cds Length = 969 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttccaagaagcctttcttctcct 513 |||||||||||||||||||| |||||||| || ||||| |||| Sbjct: 660 ggcagcttctccttgatcttatccaagaatcccttcttttcct 618 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 464 gccgccgggcagcttctccttgatcttttccaagaagcctttcttctcctc 514 |||||| || ||||| ||||||||||| || | |||||||||||||||||| Sbjct: 532 gccgcctgggagcttgtccttgatcttgtctaggaagcctttcttctcctc 482
>gb|AY349246.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| |||||||||||||| ||||||| || ||| |||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349244.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| |||||||||||||| ||||||| || ||| |||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349243.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| |||||||||||||| ||||||| || ||| |||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349241.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| |||||||||||||| ||||||| || ||| |||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349239.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| |||||||||||||| ||||||| || ||| |||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349238.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| |||||||||||||| ||||||| || ||| |||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349234.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| |||||||||||||| ||||||| || ||| |||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349233.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| |||||||||||||| ||||||| || ||| |||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349232.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| |||||||||||||| ||||||| || ||| |||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349231.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| |||||||||||||| ||||||| || ||| |||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349229.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| |||||||||||||| ||||||| || ||| |||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349228.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| |||||||||||||| ||||||| || ||| |||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349227.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| |||||||||||||| ||||||| || ||| |||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349224.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| |||||||||||||| ||||||| || ||| |||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349222.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| |||||||||||||| ||||||| || ||| |||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349221.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| |||||||||||||| ||||||| || ||| |||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>emb|X71362.1|HVDHN7 H.vulgare gene for dehydrin 7 Length = 2138 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 1510 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 1464
>emb|X15288.1|HVDHN8 Barley mRNA for dehydrin (dhn8) Length = 683 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 483 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 437
>emb|X98326.1|HVDEHYDRN H.vulgare mRNA for dehydrin Length = 671 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 472 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 426
>gb|AF181451.1|AF181451 Hordeum vulgare dehydrin (Dhn1) mRNA, complete cds Length = 512 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 437 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 391
>gb|AY895879.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 1 (Dhn1) gene, partial cds Length = 1446 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445
>gb|AY895878.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin 1 (Dhn1) gene, partial cds Length = 1268 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445
>gb|AY895877.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 1 (Dhn1) gene, partial cds Length = 1268 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445
>gb|AY895876.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 1 (Dhn1) gene, partial cds Length = 1291 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445
>gb|AY895875.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 1 (Dhn1) gene, partial cds Length = 1268 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445
>gb|AY895874.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 1 (Dhn1) gene, partial cds Length = 1249 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445
>gb|AY895873.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 1 (Dhn1) gene, partial cds Length = 1202 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445
>gb|AY895872.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 1 (Dhn1) gene, partial cds Length = 1268 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445
>gb|AY895871.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 1 (Dhn1) gene, partial cds Length = 1330 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 485 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 439
>gb|AY895870.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 1 (Dhn1) gene, partial cds Length = 1428 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445
>gb|AY895869.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445
>gb|AY895868.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445
>gb|AY895867.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 1 (Dhn1) gene, partial cds Length = 1417 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 485 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 439
>gb|AY895866.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 1 (Dhn1) gene, partial cds Length = 1428 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445
>gb|AY895865.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 485 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 439
>gb|AY895864.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 1 (Dhn1) gene, partial cds Length = 1230 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445
>gb|AY895863.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445
>gb|AY895862.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445
>gb|AY895861.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 1 (Dhn1) gene, partial cds Length = 1243 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 495 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 449
>gb|AY895860.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 1 (Dhn1) gene, partial cds Length = 1249 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445
>gb|AY895859.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 1 (Dhn1) gene, partial cds Length = 1243 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 495 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 449
>gb|AY895858.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445
>gb|AY895857.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 1 (Dhn1) gene, partial cds Length = 1249 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445
>gb|AF043096.1|AF043096 Hordeum vulgare dehydrin 5 (dhn5) gene, complete cds Length = 2814 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| |||||||||||||| ||||||| || ||| |||||||| Sbjct: 1919 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 1869 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||||||| || |||||||||||||| |||| || ||| |||||||| Sbjct: 674 gtggccgccggggagtttctccttgatcttctccatgatgcccttcttctc 624 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 2311 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 2271 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 2112 tgtggccaccggggagcttctccttgat 2085
>gb|AF043091.1|AF043091 Hordeum vulgare dehydrin 6 (dhn6) gene, complete cds Length = 3086 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttcca 495 |||||||||||| ||||||||||||||||| |||| Sbjct: 2389 gtggccgccggggagcttctccttgatcttctcca 2355 Score = 52.0 bits (26), Expect = 0.002 Identities = 47/54 (87%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| || ||||||||||||||||| |||| || ||| |||||||| Sbjct: 2215 cttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttctc 2162 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatctt 490 |||||||| ||||||||||||||||| Sbjct: 2064 ccgccggggagcttctccttgatctt 2039
>gb|AF043087.1|AF043087 Hordeum vulgare dehydrin 1 (dhn1) gene, complete cds Length = 2717 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 1767 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 1721
>gb|U73212.1|TAU73212 Triticum aestivum cold acclimation protein WCOR80 (Wcor80) mRNA, complete cds Length = 465 Score = 54.0 bits (27), Expect = 5e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| |||||||||||||| || |||| || |||||||||||| Sbjct: 125 gtggccaccggggagcttctccttgatgttctccatgatgcctttcttctc 75
>gb|DQ487112.1| Panax ginseng dehydrin 7 (Dhn7) mRNA, complete cds Length = 1057 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctcct 513 ||||||||||||||||| |||||||||| | ||||||||||||| Sbjct: 677 ccgggcagcttctccttaatcttttccatcattcctttcttctcct 632
>gb|DQ487106.1| Panax ginseng dehydrin 1 (Dhn1) mRNA, complete cds Length = 1028 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctcct 513 ||||||||||||||||| |||||||||| | ||||||||||||| Sbjct: 690 ccgggcagcttctccttaatcttttccatcattcctttcttctcct 645
>dbj|AB010898.1| Daucus carota mRNA for ecpp44, complete cds Length = 925 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttct 510 ||||| |||||||||||||||||||| |||| ||||| ||||||| Sbjct: 544 ccgcctggcagcttctccttgatcttctccataaagcccttcttct 499
>ref|NM_192219.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 687 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 672 gccggggagcttctccttgatcttctccacgatgcccttcttctc 628 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 |||||||| |||||| ||||||||||| ||||| Sbjct: 543 cttgtggctgccgggaagcttctcctttatctt 511
>gb|AC146946.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0037B06 map near 50283S, complete sequence Length = 149398 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||| ||||||||||||||||| Sbjct: 88894 cttgttgccgccggggagcttctccttgatctt 88862 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttcca 495 ||||| ||||||||||||||||| |||| Sbjct: 89070 ccggggagcttctccttgatcttctcca 89043
>gb|AY333185.1| Oryza sativa (japonica cultivar-group) drought-resistant protein mRNA, complete cds Length = 1021 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 761 gccggggagcttctccttgatcttctccacgatgcccttcttctc 717 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 |||||||| |||||| ||||||||||| ||||| Sbjct: 632 cttgtggctgccgggaagcttctcctttatctt 600
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 29117639 gccggggagcttctccttgatcttctccacgatgcccttcttctc 29117595 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 |||||||| |||||| ||||||||||| ||||| Sbjct: 29117510 cttgtggctgccgggaagcttctcctttatctt 29117478 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 376 cctcctcggcggccggcgcaggcgc 400 |||||||||||||||||| |||||| Sbjct: 24360655 cctcctcggcggccggcgaaggcgc 24360631 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 325 ccatgatcttgcccagtagg 344 |||||||||||||||||||| Sbjct: 42400771 ccatgatcttgcccagtagg 42400752
>dbj|AP003245.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0421H07 Length = 158126 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 78005 gccggggagcttctccttgatcttctccacgatgcccttcttctc 77961 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 |||||||| |||||| ||||||||||| ||||| Sbjct: 77876 cttgtggctgccgggaagcttctcctttatctt 77844
>emb|X52424.1|OSRAB16D O.sativa DNA for rab 16D gene Length = 2459 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 1518 gccggggagcttctccttgatcttgtccacgatgcccttcttctc 1474 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||| ||||||||||||||||| Sbjct: 1338 cttgttgccgccggggagcttctccttgatctt 1306
>emb|X52423.1|OSRAB16C O.sativa DNA for rab 16C gene Length = 2493 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| ||||||||||| |||| |||||| |||||||| Sbjct: 2047 gccgggaagcttttccttgatcttgtccatgaagcccttcttctc 2003 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||| ||||||||||||||||| Sbjct: 1873 cttgttgccgccggggagcttctccttgatctt 1841
>emb|X59133.1|TARAB T.aestivum L. mRNA for an ABA responsive gene, rab Length = 781 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||| ||||| ||||||||||||||||| Sbjct: 294 cttgtggccaccggggagcttctccttgatctt 262 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 461 ggcagcttctccttgatcttgtcca 437
>emb|X57327.1|OSRAB25 Rice rab25 mRNA Length = 920 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 732 gccggggagcttctccttgatcttctccacgatgcccttcttctc 688 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 |||||||| |||||| ||||||||||| ||||| Sbjct: 603 cttgtggctgccgggaagcttctcctttatctt 571
>dbj|AK109096.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-155-A09, full insert sequence Length = 852 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 552 gccggggagcttctccttgatcttgtccacgatgcccttcttctc 508 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| |||||| || ||||||||||||||||| Sbjct: 372 cttgttgccgcctgggagcttctccttgatctt 340
>dbj|AK071366.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096D05, full insert sequence Length = 795 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||| ||||||||||| |||| |||||| |||||||| Sbjct: 564 gccgggaagcttttccttgatcttgtccatgaagcccttcttctc 520 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||| ||||||||| ||||||||||||||||| Sbjct: 390 cttgttgccgccggggagcttctccttgatctt 358
>dbj|AK063691.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-F09, full insert sequence Length = 761 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 553 gccggggagcttctccttgatcttctccacgatgcccttcttctc 509 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 |||||||| |||||| ||||||||||| ||||| Sbjct: 424 cttgtggctgccgggaagcttctcctttatctt 392
>gb|AY104757.1| Zea mays PCO142314 mRNA sequence Length = 899 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatctt 490 ||||||||| |||||||||||||| |||||||| Sbjct: 419 cttgtggcctccgggcagcttctctttgatctt 387 Score = 48.1 bits (24), Expect = 0.029 Identities = 39/44 (88%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 |||||||||||||| |||||||| |||| | |||||||||||| Sbjct: 586 ccgggcagcttctctttgatcttgtccataatgcctttcttctc 543
>gb|AY823548.1| Pennisetum glaucum putative RAB protein mRNA, complete cds Length = 616 Score = 48.1 bits (24), Expect = 0.029 Identities = 45/52 (86%) Strand = Plus / Minus Query: 458 cttgtggccgccgggcagcttctccttgatcttttccaagaagcctttcttc 509 ||||| ||| ||||| ||||||||||||||||| ||| || |||||||||| Sbjct: 348 cttgttgcctccggggagcttctccttgatcttctccttgatgcctttcttc 297 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttcca 495 ||||| ||||||||||||||||| |||| Sbjct: 491 ccgggaagcttctccttgatcttgtcca 464
>gb|AY389583.1| Hyacinthus orientalis dehydrin mRNA, partial cds Length = 729 Score = 48.1 bits (24), Expect = 0.029 Identities = 30/32 (93%) Strand = Plus / Minus Query: 456 ttcttgtggccgccgggcagcttctccttgat 487 ||||||||||| || ||||||||||||||||| Sbjct: 427 ttcttgtggccacccggcagcttctccttgat 396
>gb|DQ487110.1| Panax ginseng dehydrin 5 (Dhn5) mRNA, complete cds Length = 853 Score = 48.1 bits (24), Expect = 0.029 Identities = 39/44 (88%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||||||||| |||| | ||||||||||| Sbjct: 536 ccgggcagcttctccttgatcttctccatcattcctttcttctc 493
>gb|AY243045.1| Boea crassifolia dehydrin-like protein Dh2 mRNA, complete cds Length = 697 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 459 ttgtggccgccgggcagcttctccttga 486 |||||||||||||| ||||||||||||| Sbjct: 362 ttgtggccgccgggtagcttctccttga 335
>gb|AF345988.1| Cornus sericea 60 kDa dehydrin-like protein (Rod60) mRNA, complete cds Length = 1921 Score = 48.1 bits (24), Expect = 0.029 Identities = 36/40 (90%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctcct 513 ||||||||||||||||| |||| || ||||||||||||| Sbjct: 1739 agcttctccttgatcttctccatgactcctttcttctcct 1700
>gb|M62987.1|CRTDESRSA Craterostigma plantagineum dessication-related protein mRNA, complete cds Length = 634 Score = 48.1 bits (24), Expect = 0.029 Identities = 42/48 (87%) Strand = Plus / Minus Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctcctc 514 |||||| ||||||||||||||||| |||| | |||||||||||||| Sbjct: 406 gccggggagcttctccttgatcttctccatcacccctttcttctcctc 359
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 373 tcacctcctcggcggccggcgcaggcgc 400 |||||||||||||||||||||| ||||| Sbjct: 18517274 tcacctcctcggcggccggcgccggcgc 18517247
>dbj|AK073885.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033073G16, full insert sequence Length = 976 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 373 tcacctcctcggcggccggcgcaggcgc 400 |||||||||||||||||||||| ||||| Sbjct: 526 tcacctcctcggcggccggcgccggcgc 499
>gb|AF155129.1|AF155129 Hordeum vulgare dehydrin 12 (Dhn12) gene, complete cds Length = 2890 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttcca 495 ||||||||||||||||||||||| |||| Sbjct: 1885 ccgggcagcttctccttgatcttgtcca 1858
>emb|AL808127.4| Mouse DNA sequence from clone RP23-263L18 on chromosome 2, complete sequence Length = 205838 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 52 ctgactctggaccaaactgaagcc 75 |||||||||||||||||||||||| Sbjct: 138293 ctgactctggaccaaactgaagcc 138316
>ref|NM_101894.3| Arabidopsis thaliana COR47 AT1G20440 (COR47) mRNA, complete cds Length = 1219 Score = 46.1 bits (23), Expect = 0.11 Identities = 41/47 (87%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcctcggg 520 ||||||||||||||||| || | || ||||||||||| |||||||| Sbjct: 689 agcttctccttgatcttctcaactaatcctttcttctcttcctcggg 643 Score = 44.1 bits (22), Expect = 0.45 Identities = 37/42 (88%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcc 515 |||||||| |||||||||||||| | || |||||||||||| Sbjct: 842 agcttctctttgatcttttccaaaatccccttcttctcctcc 801
>gb|AY706990.1| Vitis vinifera dehydrin 1b (DHN1b) gene, complete cds, alternatively spliced Length = 1296 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttcca 495 |||||| || |||||||||||||||||||| |||| Sbjct: 610 gtggcccccaggcagcttctccttgatcttctcca 576
>gb|AY706989.1| Vitis vinifera dehydrin 1a (DHN1a) gene, complete cds, alternatively spliced Length = 845 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttcca 495 |||||| || |||||||||||||||||||| |||| Sbjct: 624 gtggcccccaggcagcttctccttgatcttctcca 590
>gb|AY706988.1| Vitis riparia dehydrin 1b (DHN1b) gene, partial sequence Length = 1296 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttcca 495 |||||| || |||||||||||||||||||| |||| Sbjct: 610 gtggcccccaggcagcttctccttgatcttctcca 576
>gb|AY114699.1| Arabidopsis thaliana unknown protein (At1g20440) mRNA, complete cds Length = 911 Score = 46.1 bits (23), Expect = 0.11 Identities = 41/47 (87%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcctcggg 520 ||||||||||||||||| || | || ||||||||||| |||||||| Sbjct: 581 agcttctccttgatcttctcaactaatcctttcttctcttcctcggg 535 Score = 44.1 bits (22), Expect = 0.45 Identities = 37/42 (88%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcc 515 |||||||| |||||||||||||| | || |||||||||||| Sbjct: 734 agcttctctttgatcttttccaaaatccccttcttctcctcc 693
>gb|AY072392.1| Arabidopsis thaliana unknown protein (At1g20440) mRNA, complete cds Length = 1040 Score = 46.1 bits (23), Expect = 0.11 Identities = 41/47 (87%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcctcggg 520 ||||||||||||||||| || | || ||||||||||| |||||||| Sbjct: 687 agcttctccttgatcttctcaactaatcctttcttctcttcctcggg 641 Score = 44.1 bits (22), Expect = 0.45 Identities = 37/42 (88%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcc 515 |||||||| |||||||||||||| | || |||||||||||| Sbjct: 840 agcttctctttgatcttttccaaaatccccttcttctcctcc 799
>gb|AY634281.1| Vitis vinifera dehydrin mRNA, complete cds Length = 876 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatcttttcca 495 |||||| || |||||||||||||||||||| |||| Sbjct: 456 gtggcccccaggcagcttctccttgatcttctcca 422
>dbj|AB105039.1| Daucus carota CAISE1 mRNA for dehydrin protein, complete cds Length = 771 Score = 46.1 bits (23), Expect = 0.11 Identities = 41/47 (87%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctcctc 514 ||||||||||| ||||||||||| |||| | |||||||||||||| Sbjct: 505 ccgggcagcttgtccttgatcttatccataattcctttcttctcctc 459 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 311 accgggcagcttgtccatgatctt 334 |||||||||||||||| ||||||| Sbjct: 506 accgggcagcttgtccttgatctt 483
>gb|AC027665.4|AC027665 Genomic sequence for Arabidopsis thaliana BAC F5M15 from chromosome I, complete sequence Length = 99231 Score = 46.1 bits (23), Expect = 0.11 Identities = 41/47 (87%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcctcggg 520 ||||||||||||||||| || | || ||||||||||| |||||||| Sbjct: 79718 agcttctccttgatcttctcaactaatcctttcttctcttcctcggg 79672 Score = 44.1 bits (22), Expect = 0.45 Identities = 37/42 (88%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcc 515 |||||||| |||||||||||||| | || |||||||||||| Sbjct: 79871 agcttctctttgatcttttccaaaatccccttcttctcctcc 79830 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||||||||||| Sbjct: 76232 agcttctccttgatcttatccataaaccctttcttctc 76195
>dbj|AB004872.1| Arabidopsis thaliana DNA for COR47, complete cds Length = 2484 Score = 46.1 bits (23), Expect = 0.11 Identities = 41/47 (87%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcctcggg 520 ||||||||||||||||| || | || ||||||||||| |||||||| Sbjct: 2096 agcttctccttgatcttctcaactaatcctttcttctcttcctcggg 2050 Score = 44.1 bits (22), Expect = 0.45 Identities = 37/42 (88%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcc 515 |||||||| |||||||||||||| | || |||||||||||| Sbjct: 2249 agcttctctttgatcttttccaaaatccccttcttctcctcc 2208
>emb|X90959.1|ATCOR47G A.thaliana cor47 gene Length = 1260 Score = 46.1 bits (23), Expect = 0.11 Identities = 41/47 (87%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcctcggg 520 ||||||||||||||||| || | || ||||||||||| |||||||| Sbjct: 915 agcttctccttgatcttctcaactaatcctttcttctcttcctcggg 869 Score = 44.1 bits (22), Expect = 0.45 Identities = 37/42 (88%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcc 515 |||||||| |||||||||||||| | || |||||||||||| Sbjct: 1068 agcttctctttgatcttttccaaaatccccttcttctcctcc 1027
>emb|X15289.1|HVDHN9 Barley mRNA for dehydrin (dhn9) Length = 683 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttcca 495 |||||||| ||||||||||||||||| |||| Sbjct: 477 ccgccgggaagcttctccttgatcttgtcca 447
>emb|X59814.1|ATCOR47 A.thaliana cor47 mRNA Length = 1073 Score = 46.1 bits (23), Expect = 0.11 Identities = 41/47 (87%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcctcggg 520 ||||||||||||||||| || | || ||||||||||| |||||||| Sbjct: 670 agcttctccttgatcttctcaactaatcctttcttctcttcctcggg 624 Score = 44.1 bits (22), Expect = 0.45 Identities = 37/42 (88%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcc 515 |||||||| |||||||||||||| | || |||||||||||| Sbjct: 823 agcttctctttgatcttttccaaaatccccttcttctcctcc 782
>gb|AF181452.1|AF181452 Hordeum vulgare dehydrin (Dhn2) gene, complete cds Length = 1294 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttcca 495 |||||||| ||||||||||||||||| |||| Sbjct: 1170 ccgccgggaagcttctccttgatcttgtcca 1140
>gb|AF043088.1|AF043088 Hordeum vulgare dehydrin 2 (dhn2) gene, complete cds Length = 1849 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatcttttcca 495 |||||||| ||||||||||||||||| |||| Sbjct: 1178 ccgccgggaagcttctccttgatcttgtcca 1148
>ref|NM_180616.2| Arabidopsis thaliana ERD10 AT1G20450 (ERD10) transcript variant AT1G20450.1 mRNA, complete cds Length = 1514 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||||||||||| Sbjct: 1092 agcttctccttgatcttatccataaaccctttcttctc 1055
>ref|NM_101895.3| Arabidopsis thaliana ERD10 AT1G20450 (ERD10) transcript variant AT1G20450.2 mRNA, complete cds Length = 1511 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||||||||||| Sbjct: 1089 agcttctccttgatcttatccataaaccctttcttctc 1052
>gb|AY619566.1| Triticum turgidum subsp. durum dehydrin mRNA, complete cds Length = 1124 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 764 agcttctccttgatcttgtccatgatgcccttcttctc 727 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatctt 490 |||||| ||||| ||||||||||||||||| Sbjct: 366 gtggccaccggggagcttctccttgatctt 337
>gb|AY142491.1| Arabidopsis thaliana unknown protein (At1g20450) mRNA, complete cds Length = 814 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||||||||||| Sbjct: 593 agcttctccttgatcttatccataaaccctttcttctc 556
>gb|AF360351.1| Arabidopsis thaliana unknown protein (At1g20450) mRNA, complete cds Length = 1080 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||||||||||| Sbjct: 700 agcttctccttgatcttatccataaaccctttcttctc 663
>gb|AY136407.1| Arabidopsis thaliana unknown protein mRNA, complete cds Length = 1056 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||||||||||| Sbjct: 699 agcttctccttgatcttatccataaaccctttcttctc 662
>emb|X74067.1|CPCDET619 Craterostigma plantagineum CDeT6-19 gene for dessication-related protein Length = 1742 Score = 44.1 bits (22), Expect = 0.45 Identities = 31/34 (91%) Strand = Plus / Minus Query: 462 tggccgccgggcagcttctccttgatcttttcca 495 ||||||||||| |||||||| |||||||| |||| Sbjct: 1529 tggccgccgggaagcttctctttgatcttgtcca 1496 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Minus Query: 462 tggccgccgggcagcttctccttgatctt 490 ||||||||||| ||||||||||| ||||| Sbjct: 1415 tggccgccgggaagcttctccttcatctt 1387
>gb|AY065655.1| Pisum sativum ultraviolet-B-repressible dehydrin-related protein mRNA, partial cds Length = 387 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| |||||||||||||| | ||||||||||| Sbjct: 173 agcttctctttgatcttttccaaaatacctttcttctc 136
>gb|AY048208.1| Arabidopsis thaliana At1g20450/F5M15_20 mRNA, complete cds Length = 693 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||||||||||| Sbjct: 375 agcttctccttgatcttatccataaaccctttcttctc 338
>gb|M62988.1|CRTDESRSB Craterostigma plantagineum dessication-related protein mRNA, complete cds Length = 741 Score = 44.1 bits (22), Expect = 0.45 Identities = 31/34 (91%) Strand = Plus / Minus Query: 462 tggccgccgggcagcttctccttgatcttttcca 495 ||||||||||| |||||||| |||||||| |||| Sbjct: 528 tggccgccgggaagcttctctttgatcttgtcca 495 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Minus Query: 462 tggccgccgggcagcttctccttgatctt 490 ||||||||||| ||||||||||| ||||| Sbjct: 414 tggccgccgggaagcttctccttcatctt 386
>emb|BX815233.1|CNS0ACV9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS44ZF01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 321 Score = 44.1 bits (22), Expect = 0.45 Identities = 37/42 (88%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcc 515 |||||||| |||||||||||||| | || |||||||||||| Sbjct: 84 agcttctctttgatcttttccaaaatccccttcttctcctcc 43
>gb|AF236067.1|AF236067 Elaeis guineensis clone pKT5 dehydrin-like protein mRNA, complete cds Length = 775 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttcca 495 |||||||||||||||||||||| Sbjct: 462 agcttctccttgatcttttcca 441
>dbj|D17714.1|ATHERD10 Arabidopsis thaliana mRNA for ERD10 protein, complete cds Length = 1024 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||||||||||| Sbjct: 667 agcttctccttgatcttatccataaaccctttcttctc 630
>emb|X78432.1|TDDEH38 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd38 Length = 555 Score = 44.1 bits (22), Expect = 0.45 Identities = 43/50 (86%) Strand = Plus / Minus Query: 462 tggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 ||||| ||||| |||||||||||||| || |||| || ||| |||||||| Sbjct: 140 tggccaccggggagcttctccttgatgttctccatgatgcccttcttctc 91
>emb|X78430.1|TDDEH25 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd25a Length = 565 Score = 44.1 bits (22), Expect = 0.45 Identities = 43/50 (86%) Strand = Plus / Minus Query: 462 tggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511 ||||| ||||| |||||||||||||| || |||| || ||| |||||||| Sbjct: 146 tggccaccggggagcttctccttgatgttctccatgatgcccttcttctc 97
>emb|X90958.1|ATDLTI29G A.thaliana lti29 gene Length = 1260 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||||||||||| Sbjct: 920 agcttctccttgatcttatccataaaccctttcttctc 883
>emb|X72748.1|HVDEHYD H.vulgare mRNA for dehydrin Length = 1016 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 689 agcttctccttgatcttgtccatgatgcccttcttctc 652
>emb|X62476.1|TARAB15B T.aestivum rab15B mRNA Length = 1068 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 749 agcttctccttgatcttgtccatgatgcccttcttctc 712 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatctt 490 |||||| ||||| ||||||||||||||||| Sbjct: 351 gtggccaccggggagcttctccttgatctt 322
>emb|Z14145.1|DHNCOGG P.sativum dhn-cog gene encoding dehydrin-cognate Length = 1035 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 |||||||| |||||||||||||| | ||||||||||| Sbjct: 736 agcttctctttgatcttttccaaaatacctttcttctc 699
>emb|X77614.1|ATLTI45 A.thaliana (Landsberg Erecta) lti45 mRNA Length = 828 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||||||||||| Sbjct: 429 agcttctccttgatcttatccataaaccctttcttctc 392
>gb|AF181454.1|AF181454 Hordeum vulgare dehydrin (Dhn4) gene, complete cds Length = 2440 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 1539 agcttctccttgatcttgtccatgatgcccttcttctc 1502
>gb|BT002131.1| Arabidopsis thaliana unknown protein mRNA, complete cds Length = 827 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||||||||||| Sbjct: 593 agcttctccttgatcttatccataaaccctttcttctc 556
>gb|AY895927.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 7 (Dhn7) gene, complete cds Length = 1357 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 461 gtggccgccgggcagcttctccttgatctt 490 |||||| ||||| ||||||||||||||||| Sbjct: 583 gtggccaccggggagcttctccttgatctt 554 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttctt 508 |||||||||||||||||||| || |||| || ||| ||||| Sbjct: 828 ccgggcagcttctccttgattttgtccatgatgcccttctt 788
>gb|AY895904.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 560559 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 766 agcttctccttgatcttgtccatgatgcccttcttctc 729
>gb|AY895903.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 766 agcttctccttgatcttgtccatgatgcccttcttctc 729
>gb|AY895902.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin 4-like (Dhn4) gene, partial sequence Length = 422 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 341 agcttctccttgatcttgtccatgatgcccttcttctc 304
>gb|AY895901.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 4 (Dhn4) gene, complete cds Length = 920 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 764 agcttctccttgatcttgtccatgatgcccttcttctc 727
>gb|AY895900.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 4 (Dhn4) gene, complete cds Length = 924 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 766 agcttctccttgatcttgtccatgatgcccttcttctc 729
>gb|AY895899.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 766 agcttctccttgatcttgtccatgatgcccttcttctc 729
>gb|AY895898.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 4 (Dhn4) gene, complete cds Length = 921 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 765 agcttctccttgatcttgtccatgatgcccttcttctc 728
>gb|AY895897.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 4 (Dhn4) gene, complete cds Length = 919 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 763 agcttctccttgatcttgtccatgatgcccttcttctc 726
>gb|AY895896.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 4 (Dhn4) gene, complete cds Length = 910 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 754 agcttctccttgatcttgtccatgatgcccttcttctc 717
>gb|AY895895.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 4 (Dhn4) gene, complete cds Length = 921 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 765 agcttctccttgatcttgtccatgatgcccttcttctc 728
>gb|AY895894.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 766 agcttctccttgatcttgtccatgatgcccttcttctc 729
>gb|AY895893.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 766 agcttctccttgatcttgtccatgatgcccttcttctc 729
>gb|AY895892.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 4 (Dhn4) gene, complete cds Length = 907 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 751 agcttctccttgatcttgtccatgatgcccttcttctc 714
>gb|AY895891.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 766 agcttctccttgatcttgtccatgatgcccttcttctc 729
>gb|AY895890.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 4 (Dhn4) gene, complete cds Length = 907 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 751 agcttctccttgatcttgtccatgatgcccttcttctc 714
>gb|AY895889.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 4 (Dhn4) gene, complete cds Length = 921 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 765 agcttctccttgatcttgtccatgatgcccttcttctc 728
>gb|AY895888.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 4 (Dhn4) gene, complete cds Length = 980 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 824 agcttctccttgatcttgtccatgatgcccttcttctc 787
>gb|AY895887.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 4 (Dhn4) gene, complete cds Length = 907 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 751 agcttctccttgatcttgtccatgatgcccttcttctc 714
>gb|AY895886.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 4 (Dhn4) gene, complete cds Length = 904 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 748 agcttctccttgatcttgtccatgatgcccttcttctc 711
>gb|AY895885.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 766 agcttctccttgatcttgtccatgatgcccttcttctc 729
>gb|AY895884.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 236388 dehydrin 4 (Dhn4) gene, complete cds Length = 916 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 760 agcttctccttgatcttgtccatgatgcccttcttctc 723
>gb|AY895883.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 4 (Dhn4) gene, complete cds Length = 906 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 750 agcttctccttgatcttgtccatgatgcccttcttctc 713
>gb|AY895882.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 4 (Dhn4) gene, complete cds Length = 908 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 751 agcttctccttgatcttgtccatgatgcccttcttctc 714
>gb|AY895881.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 4 (Dhn4) gene, complete cds Length = 907 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 751 agcttctccttgatcttgtccatgatgcccttcttctc 714
>gb|AY895880.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 766 agcttctccttgatcttgtccatgatgcccttcttctc 729
>gb|AF043090.1|AF043090 Hordeum vulgare dehydrin 4 (dhn4) gene, complete cds Length = 2790 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511 ||||||||||||||||| |||| || ||| |||||||| Sbjct: 2187 agcttctccttgatcttgtccatgatgcccttcttctc 2150
>dbj|AB090885.1| Aster tripolium mRNA for dehydrin, complete cds Length = 979 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Minus Query: 465 ccgccgggcagcttctccttgatctt 490 |||||||| ||||||||||||||||| Sbjct: 507 ccgccgggtagcttctccttgatctt 482
>emb|AJ001448.1|FVAJ1448 Fragaria vesca partial mRNA for ripening-induced protein, clone 2.5.R1 Length = 815 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 476 cttctccttgatcttttccaagaagcctttcttctcct 513 ||||||||||||||| ||||| || || |||||||||| Sbjct: 642 cttctccttgatcttctccaacaaacccttcttctcct 605
>gb|AY465376.1| Prunus persica dehydrin 2 mRNA, complete cds Length = 829 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 544 ggcagcttctccttgatcttgtcca 520
>ref|NM_192777.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1419 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 376 cctcctcggcggccggcgcaggcgc 400 |||||||||||||||||| |||||| Sbjct: 349 cctcctcggcggccggcgaaggcgc 325
>gb|AC102686.7| Mus musculus chromosome 1, clone RP24-467J24, complete sequence Length = 156547 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 81 acccaaactgaacacaagcat 101 ||||||||||||||||||||| Sbjct: 134241 acccaaactgaacacaagcat 134261
>gb|AY706987.1| Vitis riparia dehydrin 1a (DHN1a) gene, complete cds, alternatively spliced Length = 1324 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 614 ggcagcttctccttgatcttctcca 590
>gb|AF172263.1| Prunus dulcis abscisic acid response protein (rab21) mRNA, complete cds Length = 897 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 538 ggcagcttctccttgatcttgtcca 514
>gb|AY349245.1| Hordeum vulgare subsp. spontaneum NPGS PI 560556 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349242.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccgggaagcttctccttgat 765
>gb|AY349240.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccggggagcttctccttgat 765
>gb|AY349237.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccgggaagcttctccttgat 765
>gb|AY349236.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 5 (Dhn5) gene, partial cds Length = 446 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 388 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 348 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 183 tgtggccaccgggaagcttctccttgat 156
>gb|AY349235.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 5 (Dhn5) gene, partial cds Length = 446 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 388 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 348 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 183 tgtggccaccgggaagcttctccttgat 156
>gb|AY349230.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 dehydrin 5 (Dhn5) gene, partial cds Length = 1061 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 1003 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 963 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccgggaagcttctccttgat 765
>gb|AY349226.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 5 (Dhn5) gene, partial cds Length = 446 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 388 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 348 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 183 tgtggccaccgggaagcttctccttgat 156
>gb|AY349225.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 5 (Dhn5) gene, partial cds Length = 446 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 388 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 348 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 183 tgtggccaccgggaagcttctccttgat 156
>gb|AY349223.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccgggaagcttctccttgat 765
>gb|AY349220.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355 |||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 460 tgtggccgccgggcagcttctccttgat 487 ||||||| ||||| |||||||||||||| Sbjct: 792 tgtggccaccgggaagcttctccttgat 765
>emb|AL138725.19| Human DNA sequence from clone RP11-528A10 on chromosome 6 Contains an IMPDH1 (IMP (inosine monophosphate) dehydrogenase 1) pseudogene, an RNA helicase pseudogene and part of a novel gene similar to KIAA0161, complete sequence Length = 165653 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ttgcccagtaggcccttcttc 353 ||||||||||||||||||||| Sbjct: 48697 ttgcccagtaggcccttcttc 48717
>gb|AC036101.6| Homo sapiens chromosome 10 clone RP11-71J2, complete sequence Length = 175492 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 475 gcttctccttgatcttttcca 495 ||||||||||||||||||||| Sbjct: 115635 gcttctccttgatcttttcca 115615
>gb|AF453444.1|AF453444 Triticum aestivum dehydrin WZY1-1 mRNA, complete cds Length = 483 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttctt 508 ||||||||||| ||||||||||| |||| || ||| ||||| Sbjct: 473 ccgggcagcttttccttgatcttgtccatgatgcccttctt 433
>gb|DQ015701.1| Ovis aries endothelial nitric oxide synthase mRNA, complete cds Length = 4097 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 274 gggcggcggccttgtcctcctcccc 298 |||||||||||||| |||||||||| Sbjct: 2195 gggcggcggccttggcctcctcccc 2171
>dbj|AB058947.1| Streptomyces albulus plasmid pNO33 DNA, complete sequence Length = 36955 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 447 tcctccggcttcttgtggccgccgg 471 |||||||||||||||| |||||||| Sbjct: 11860 tcctccggcttcttgtcgccgccgg 11836
>dbj|AP002866.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0410E01 Length = 166753 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 376 cctcctcggcggccggcgcaggcgc 400 |||||||||||||||||| |||||| Sbjct: 106559 cctcctcggcggccggcgaaggcgc 106535
>gb|AF220407.1|AF220407 Vitis riparia dehydrin-like protein (Dhn) mRNA, complete cds Length = 761 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 471 ggcagcttctccttgatcttttcca 495 |||||||||||||||||||| |||| Sbjct: 468 ggcagcttctccttgatcttctcca 444
>dbj|AK105551.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-128-A11, full insert sequence Length = 1509 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 376 cctcctcggcggccggcgcaggcgc 400 |||||||||||||||||| |||||| Sbjct: 399 cctcctcggcggccggcgaaggcgc 375
>gb|AF181457.1|AF181457 Hordeum vulgare dehydrin (Dhn7) mRNA, complete cds Length = 654 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttctt 508 |||||||||||||||||||| || |||| || ||| ||||| Sbjct: 577 ccgggcagcttctccttgattttgtccatgatgcccttctt 537
>gb|AY895931.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 560559 dehydrin 7 (Dhn7) gene, complete cds Length = 1371 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttctt 508 |||||||||||||||||||| || |||| || ||| ||||| Sbjct: 844 ccgggcagcttctccttgattttgtccatgatgcccttctt 804
>gb|AY895930.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 7 (Dhn7) gene, complete cds Length = 1370 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttctt 508 |||||||||||||||||||| || |||| || ||| ||||| Sbjct: 841 ccgggcagcttctccttgattttgtccatgatgcccttctt 801
>gb|AY895929.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin 7 (Dhn7) gene, complete cds Length = 1370 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttctt 508 |||||||||||||||||||| || |||| || ||| ||||| Sbjct: 841 ccgggcagcttctccttgattttgtccatgatgcccttctt 801
>gb|AY895928.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 7 (Dhn7) gene, complete cds Length = 1332 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttctt 508 |||||||||||||||||||| || |||| || ||| ||||| Sbjct: 803 ccgggcagcttctccttgattttgtccatgatgcccttctt 763
>gb|AY895926.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 7 (Dhn7) gene, complete cds Length = 1370 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttctt 508 |||||||||||||||||||| || |||| || ||| ||||| Sbjct: 841 ccgggcagcttctccttgattttgtccatgatgcccttctt 801
>gb|AY895925.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 7 (Dhn7) gene, complete cds Length = 1373 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttctt 508 |||||||||||||||||||| || |||| || ||| ||||| Sbjct: 844 ccgggcagcttctccttgattttgtccatgatgcccttctt 804 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,693,365 Number of Sequences: 3902068 Number of extensions: 4693365 Number of successful extensions: 119948 Number of sequences better than 10.0: 304 Number of HSP's better than 10.0 without gapping: 306 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 118236 Number of HSP's gapped (non-prelim): 1690 length of query: 520 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 497 effective length of database: 17,143,297,704 effective search space: 8520218958888 effective search space used: 8520218958888 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
