ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart39e10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1tpe|BN000093.1|HVA000093 TPA: TPA_exp: Hordeum vulgare mRNA for ... 898 0.0
2emb|AJ496571.2|HVU496571 Hordeum vulgare partial mRNA for putati... 759 0.0
3gb|AY841792.1| Triticum aestivum cysteine protease (CP) mRNA, co... 565 e-158
4gb|BT008950.1| Triticum aestivum clone wdk1c.pk009.j19:fis, full... 531 e-148
5gb|DQ344624.1| Triticum aestivum vacuolar ATP synthase subunit E... 345 8e-92
6gb|BT017759.1| Zea mays clone EL01N0501D06.c mRNA sequence 178 1e-41
7emb|X82185.1|ZMCYSPRO Z.mays mRNA for cysteine proteinase 178 1e-41
8gb|AY104312.1| Zea mays PCO074362 mRNA sequence 178 1e-41
9dbj|D45402.1|MZECP Corn mRNA for cysteine proteinase, clone CCP,... 178 1e-41
10ref|XM_471773.1| Oryza sativa (japonica cultivar-group), predic... 157 4e-35
11emb|AL663007.2|OSJN00206 Oryza sativa genomic DNA, chromosome 4,... 157 4e-35
12dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 157 4e-35
13dbj|AK121305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 157 4e-35
14dbj|AK071948.1| Oryza sativa (japonica cultivar-group) cDNA clon... 149 1e-32
15ref|XM_507484.1| PREDICTED Oryza sativa (japonica cultivar-group... 145 1e-31
16ref|XM_507483.1| PREDICTED Oryza sativa (japonica cultivar-group... 145 1e-31
17ref|XM_465566.1| Oryza sativa (japonica cultivar-group), mRNA 145 1e-31
18ref|XM_507482.1| PREDICTED Oryza sativa (japonica cultivar-group... 145 1e-31
19ref|XM_506801.2| PREDICTED Oryza sativa (japonica cultivar-group... 145 1e-31
20dbj|AK061947.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 1e-31
21dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 145 1e-31
22dbj|AP004852.3| Oryza sativa (japonica cultivar-group) genomic D... 145 1e-31
23dbj|AK099269.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 1e-31
24dbj|AK098908.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 1e-31
25dbj|AK071907.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 1e-31
26dbj|AK119670.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 9e-27
27gb|AF462226.1| Narcissus pseudonarcissus putative cysteine prote... 117 3e-23
28gb|AY504968.1| Iris hollandica putative cysteine protease 3 (CYS... 105 1e-19
29gb|AF242373.1|AF242373 Ipomoea batatas cysteine protease (SPCP2)... 105 1e-19
30gb|AF411121.1| Sandersonia aurantiaca cysteine proteinase precur... 103 5e-19
31gb|AF138266.1|AF138266 Ipomoea batatas papain-like cysteine prot... 101 2e-18
32gb|AF138265.1|AF138265 Ipomoea batatas papain-like cysteine prot... 101 2e-18
33gb|AF138264.1|AF138264 Ipomoea batatas papain-like cysteine prot... 101 2e-18
34gb|AF216785.1|AF216785 Ipomoea batatas papain-like cysteine prot... 101 2e-18
35gb|AF216784.1|AF216784 Ipomoea batatas papain-like cysteine prot... 101 2e-18
36gb|AF216783.1|AF216783 Ipomoea batatas papain-like cysteine prot... 101 2e-18
37emb|Z99953.1|PVZ99953 Phaseolus vulgaris Moldavian encoding cyst... 90 8e-15
38dbj|AB161375.1| Aster tripolium CysP mRNA for cysteine protease,... 82 2e-12
39gb|AY373974.1| Ipomoea batatas cysteine proteinase precursor, mR... 80 7e-12
40ref|NM_120069.3| Arabidopsis thaliana RD19 (RESPONSIVE TO DEHYDR... 78 3e-11
41ref|NM_120068.3| Arabidopsis thaliana ATPase AT4G39080 mRNA, com... 78 3e-11
42gb|AY133844.1| Arabidopsis thaliana clone U11713 putative cystei... 78 3e-11
43gb|AY080598.1| Arabidopsis thaliana putative cysteine proteinase... 78 3e-11
44emb|AL161594.2|ATCHRIV90 Arabidopsis thaliana DNA chromosome 4, ... 78 3e-11
45emb|AL035679.1|ATF19H22 Arabidopsis thaliana DNA chromosome 4, B... 78 3e-11
46dbj|AK220782.1| Arabidopsis thaliana mRNA for drought-inducible ... 78 3e-11
47emb|BX828077.1|CNS0A48A Arabidopsis thaliana Full-length cDNA Co... 78 3e-11
48emb|BX826350.1|CNS0A43C Arabidopsis thaliana Full-length cDNA Co... 78 3e-11
49gb|AY087621.1| Arabidopsis thaliana clone 37132 mRNA, complete s... 78 3e-11
50dbj|D13042.1|ATHRD19A Arabidopsis thaliana rd19A gene for thiol ... 78 3e-11
51gb|AF082181.1|AF082181 Solanum melongena cysteine proteinase pre... 76 1e-10
52dbj|AB038598.1| Vigna mungo mRNA for cysteine protease, complete... 74 5e-10
53gb|AY800120.1| Populus tomentosa cysteine proteinase (CP) mRNA, ... 72 2e-09
54emb|X03971.1|CPCPROR Carica papaya mRNA 3'region for cysteine pr... 72 2e-09
55gb|AY662989.1| Petunia x hybrida cysteine proteinase (CP3) mRNA,... 68 3e-08
56emb|AJ844006.1| Plantago major partial mRNA for cysteine proteas... 68 3e-08
57gb|AY110841.1| Zea mays CL908_1 mRNA sequence 66 1e-07
58gb|M95060.1|MZEORFA Zea mays putative thiol protease homolog mRN... 66 1e-07
59gb|AY662991.1| Petunia x hybrida cysteine proteinase (CP5) mRNA,... 62 2e-06
60gb|DQ084023.1| Nicotiana benthamiana cysteine proteinase glycina... 62 2e-06
61dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
62dbj|AP005396.3| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
63dbj|AK108733.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
64gb|BT014429.1| Lycopersicon esculentum clone 133747F, mRNA sequence 60 7e-06
65emb|Z13964.1|NTCYP8 N.tabacum mRNA for pre-pro-cysteine proteinase 60 7e-06
66emb|Z13959.1|NTCYP7 N.tabacum mRNA for pre-pro-cysteine proteinase 60 7e-06
67gb|AF454959.1| Brassica oleracea senescence-associated cysteine ... 60 7e-06
68gb|U68221.1|BNU68221 Brassica napus cysteine protease (LSC790) m... 60 7e-06
69gb|AC172870.1| Brassica rapa subsp. pekinensis clone KBrH004A06,... 60 7e-06
70gb|L38514.1|TRBRANGB Trypanosoma rangeli (clone 3) rangelipain g... 60 7e-06
71gb|L38513.1|TRBRANGA Trypanosoma rangeli (clone 2) rangelipain g... 60 7e-06
72gb|L38512.1|TRBRANG Trypanosoma rangeli (clone 1) rangelipain ge... 60 7e-06
73emb|Z30338.1|VSCYSPROT V.sativa mRNA for cysteine proteinase 58 3e-05
74emb|Z32795.1|GMCYSEND G.max (Fiskeby V) mRNA for cysteine endope... 58 3e-05
75emb|X54358.1|PSCC15A P.sativum mRNA of cDNA clone 15a 58 3e-05
76gb|AC148242.14| Medicago truncatula clone mth2-18f6, complete se... 58 3e-05
77gb|AY161277.1| Vicia faba pre-pro cysteine proteinase gene, comp... 58 3e-05
78gb|AF167986.1|AF167986 Glycine max putative cysteine proteinase ... 58 3e-05
79gb|U59465.1|VFU59465 Vicia faba pre-pro-cysteine proteinase (VFC... 58 3e-05
80dbj|AP006110.1| Lotus japonicus genomic DNA, chromosome 1, clone... 58 3e-05
81gb|AY850168.1| Cloning vector pQ-CPB recombinant cysteine protea... 54 4e-04
82gb|AY919606.1| Theileria orientalis cysteine protease 3 gene, co... 54 4e-04
83gb|AY919605.1| Theileria orientalis cysteine protease 1 gene, co... 54 4e-04
84gb|AY912450.1| Theileria orientalis tocp1 variant tocp5 gene, pa... 54 4e-04
85gb|AY912448.1| Theileria orientalis tocp1 variant tocp3 mRNA, co... 54 4e-04
86dbj|AB159780.1| Theileria orientalis ToCP 1 mRNA for cysteine pr... 54 4e-04
87ref|XM_312033.2| Anopheles gambiae str. PEST ENSANGP00000022503 ... 54 4e-04
88ref|XM_312034.2| Anopheles gambiae str. PEST ENSANGP00000018713 ... 54 4e-04
89ref|NM_117715.2| Arabidopsis thaliana cysteine-type endopeptidas... 52 0.002
90ref|NM_187324.2| Oryza sativa (japonica cultivar-group), mRNA 52 0.002
91ref|XM_476390.1| Oryza sativa (japonica cultivar-group), mRNA 52 0.002
92gb|BT018299.1| Zea mays clone EL01T0206B09.c mRNA sequence 52 0.002
93gb|AC145324.3| Oryza sativa (japonica cultivar-group) chromosome... 52 0.002
94gb|BT000733.1| Arabidopsis thaliana clone RAFL08-11-G18 (R11350)... 52 0.002
95emb|Z97340.2|ATFCA5 Arabidopsis thaliana DNA chromosome 4, ESSA ... 52 0.002
96emb|X80876.1|OSCYSPRO O.sativa mRNA for cysteine protease 52 0.002
97emb|AL161543.2|ATCHRIV43 Arabidopsis thaliana DNA chromosome 4, ... 52 0.002
98emb|AJ512653.1|LGU512653 Leishmania guyanensis partial cpb gene ... 52 0.002
99emb|AJ242994.1|NTA242994 Nicotiana tabacum mRNA for putative pre... 52 0.002
100gb|AY136316.1| Arabidopsis thaliana cysteine proteinase (At4g161... 52 0.002
101gb|AY129473.1| Arabidopsis thaliana AT4g16190/dl4135w mRNA, comp... 52 0.002
102gb|AY039556.1| Arabidopsis thaliana AT4g16190/dl4135w mRNA, comp... 52 0.002
103dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
104dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
105emb|BX828277.1|CNS0A2YD Arabidopsis thaliana Full-length cDNA Co... 52 0.002
106emb|BX827724.1|CNS0A2XO Arabidopsis thaliana Full-length cDNA Co... 52 0.002
107gb|AY017414.1| Nicotiana tabacum CPR2-like cysteine proteinase g... 52 0.002
108dbj|AP004299.2| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
109dbj|AP004342.5| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
110dbj|AK071495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
111dbj|AK063422.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
112dbj|AP003759.2| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
113dbj|AB090880.1| Aster tripolium mRNA for thiol protease, complet... 52 0.002
114dbj|AB004648.1| Oryza sativa (japonica cultivar-group) RepA gene... 52 0.002
115gb|U32430.1|TAU32430 Triticum aestivum thiol protease mRNA, comp... 52 0.002
116gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 52 0.002
117emb|Z99955.1|PVZ99955 Phaseolus vulgaris Moldavian encoding cyst... 50 0.007
118emb|AJ580823.1|LCO580823 Lotus corniculatus var. japonicus ORF1,... 50 0.007
119dbj|AP005666.1| Lotus japonicus genomic DNA, chromosome 3, clone... 50 0.007
120dbj|AB092808.1| Lotus japonicus gene for hypothetical proteins, ... 50 0.007
121ref|XM_467463.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.026
122gb|DQ079995.1| Drosophila simulans male accessory gland protein ... 48 0.026
123ref|XM_813485.1| Trypanosoma cruzi strain CL Brener cysteine pep... 48 0.026
124ref|XM_813486.1| Trypanosoma cruzi strain CL Brener cruzipain pr... 48 0.026
125ref|XM_800858.1| Trypanosoma cruzi strain CL Brener cysteine pep... 48 0.026
126ref|XM_815081.1| Trypanosoma cruzi strain CL Brener cysteine pep... 48 0.026
127ref|XM_799143.1| Trypanosoma cruzi strain CL Brener cruzipain pr... 48 0.026
128emb|Z97023.1|HVZ97023 Hordeum vulgare mRNA encoding cysteine end... 48 0.026
129emb|Z97022.1|HVZ97022 Hordeum vulgare gene encoding cysteine pro... 48 0.026
130emb|Z97021.1|HVZ97021 Hordeum vulgare gene encoding cysteine end... 48 0.026
131emb|X05167.1|HVLEU Barley gene for thiol protease aleurain 48 0.026
132gb|AF314929.1|AF314929 Trypanosoma cruzi strain Y cruzipain gene... 48 0.026
133gb|AY112673.1| Trypanosoma cruzi repeated HaeIII genomic fragmen... 48 0.026
134gb|AF265226.1|AF265226 Trypanosoma cruzi strain TUL cruzipain ge... 48 0.026
135dbj|AP004047.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.026
136dbj|AK104296.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.026
137dbj|AK060534.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.026
138gb|U94591.1|HVU94591 Hordeum vulgare cysteine proteinase precurs... 48 0.026
139gb|M90067.1|TRBCYSPRNS Trypanosoma cruzi cysteine proteinase gen... 48 0.026
140gb|AF004594.1|AF004594 Trypanosoma cruzi cysteine protease (cp) ... 48 0.026
141emb|X54414.1|TCCRUZIP T. cruzi mRNA for cysteine proteinase (cru... 48 0.026
142gb|M69121.1|TRBTUL2TAN Trypanosoma cruzi tandem cysteine protein... 48 0.026
143gb|M84342.1|TRBCYSPROA Trypanosoma cruzi cruzain protein gene, c... 48 0.026
144gb|M27305.1|TRBCYPAA Trypanosoma cruzi cysteine protease gene, p... 48 0.026
145ref|NM_127715.2| Arabidopsis thaliana cysteine-type endopeptidas... 46 0.10
146ref|XM_463580.1| Oryza sativa (japonica cultivar-group), predic... 46 0.10
147gb|BT014316.1| Lycopersicon esculentum clone 133569F, mRNA sequence 46 0.10
148ref|XM_797951.1| Trypanosoma cruzi strain CL Brener cysteine pep... 46 0.10
149ref|XM_800491.1| Trypanosoma cruzi strain CL Brener cysteine pep... 46 0.10
150emb|AJ879460.1| Leishmania donovani infantum partial cpbE gene f... 46 0.10
151emb|AJ879459.1| Leishmania donovani donovani partial cpbF gene f... 46 0.10
152emb|AJ879458.1| Leishmania donovani infantum partial cpbE gene f... 46 0.10
153emb|AJ879457.1| Leishmania donovani archibaldi partial cpbA gene... 46 0.10
154emb|AJ879456.1| Leishmania donovani infantum partial cpbA gene f... 46 0.10
155emb|AJ879455.1| Leishmania donovani infantum partial cpbA gene f... 46 0.10
156emb|X74359.1|ATTHIPRO A.thaliana mRNA for putative thiol protease 46 0.10
157emb|AJ628943.1| Leishmania infantum cpb gene for cathepsin L-lik... 46 0.10
158emb|AJ628942.1| Leishmania infantum hd gene for histone deacetyl... 46 0.10
159emb|AJ420286.1|LIN420286 Leishmania infantum cpb gene for cystei... 46 0.10
160dbj|AP003380.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.10
161gb|AC006841.7| Arabidopsis thaliana chromosome 2 clone F3K23 map... 46 0.10
162gb|AF309626.1|AF309626 Leishmania donovani clone Ld-A cysteine p... 46 0.10
163gb|AF004592.2|AF004592 Leishmania donovani chagasi amastigote-sp... 46 0.10
164dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.10
165gb|AF217087.1|AF217087 Leishmania chagasi cathepsin L-like cyste... 46 0.10
166gb|AY089044.1| Arabidopsis thaliana clone 21453 mRNA, complete s... 46 0.10
167dbj|AP006531.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.10
168dbj|AP006170.2| Oryza sativa (japonica cultivar-group) genomic D... 46 0.10
169dbj|AK175856.1| Arabidopsis thaliana mRNA for putative cysteine ... 46 0.10
170gb|AF099203.1|AF099203 Oryza sativa cysteine endopeptidase precu... 46 0.10
171gb|AY109437.1| Zea mays CL903_-1 mRNA sequence 46 0.10
172gb|AY896791.1| Leishmania infantum strain MHOM/PA/78/WR285 cathe... 46 0.10
173gb|AY896788.1| Leishmania donovani strain IMAR/KE/62/LRC-L57 cat... 46 0.10
174gb|AY896787.1| Leishmania donovani strain MHOM/CN/00/WangJie1 ca... 46 0.10
175gb|AY896786.1| Leishmania donovani strain MHOM/KE/67/MRC(L)3 cat... 46 0.10
176gb|AY896785.1| Leishmania donovani strain MHOM/ET/00/HUSSEN cath... 46 0.10
177gb|AY896784.1| Leishmania donovani strain MHOM/SD/82/GILANI cath... 46 0.10
178gb|AY896783.1| Leishmania donovani strain MHOM/ET/67/HU3 catheps... 46 0.10
179gb|AY896782.1| Leishmania infantum strain MHOM/MA/67/ITMAP263 ca... 46 0.10
180gb|AY896781.1| Leishmania infantum strain MHOM/FR/78/LEM75 cathe... 46 0.10
181gb|AY896780.1| Leishmania infantum strain MHOM/FR/85/LEM663 cath... 46 0.10
182gb|AY896779.1| Leishmania infantum strain MHOM/FR/82/LEM356 cath... 46 0.10
183gb|AY896778.1| Leishmania infantum strain MHOM/ES/81/BCN1 cathep... 46 0.10
184gb|AY896777.1| Leishmania infantum strain MHOM/FR/85/LEM716 cath... 46 0.10
185gb|AY896776.1| Leishmania infantum strain MHOM/FR/87/LEM1098 cat... 46 0.10
186gb|AF006198.1|AF006198 Giardia muris cysteine protease (GMCP1) m... 46 0.10
187gb|U43706.1|LMU43706 Leishmania major cathepsin L-like protease ... 46 0.10
188dbj|D76415.1| Rice seedling mRNA for cysteine proteinase, comple... 46 0.10
189dbj|AB004819.1| Oryza sativa Rep1 gene for cysteine endopeptidas... 46 0.10
190gb|AY728269.1| Paragonimus westermani westerpain-1 gene, complet... 44 0.41
191gb|AC106834.9| Mus musculus chromosome 19, clone RP24-132H7, com... 44 0.41
192gb|AY253445.1| Triticum aestivum P9346A1-2-5-1 putative thiol pr... 44 0.41
193gb|AC103947.20| Mus musculus chromosome 19, clone RP23-261A21, c... 44 0.41
194emb|Z14028.1|LECYSPRO L.esculentum mRNA encoding pre-pro-cystein... 44 0.41
195emb|AJ512654.1|LMA512654 Leishmania major partial cpb gene for c... 44 0.41
196emb|AJ245868.1|MSA245868 Medicago sativa mRNA for cysteine prote... 44 0.41
197ref|NM_137062.2| Drosophila melanogaster CG6347-RA (CG6347), mRNA 44 0.41
198gb|AC099008.1| Drosophila melanogaster, chromosome 2R, region 50... 44 0.41
199gb|AY069609.1| Drosophila melanogaster LD36817 full insert cDNA 44 0.41
200gb|AY144442.1| Sorghum bicolor BAC 95A23/98N8.1 Rph region, part... 44 0.41
201dbj|AB091669.1| Pandalus borealis PbCys mRNA for crustapain, com... 44 0.41
202gb|AF217446.1|AF217446 Babesia equi cysteine protease Cys2 mRNA,... 44 0.41
203gb|AF139913.1|AF139913 Trypanosoma congolense cysteine protease ... 44 0.41
204gb|AC005977.3|AC005977 Drosophila melanogaster, chromosome 2R, r... 44 0.41
205gb|AE003817.3| Drosophila melanogaster chromosome 2R, section 33... 44 0.41
206gb|U93166.1|PAU93166 Prunus armeniaca cysteine protease mRNA, co... 44 0.41
207gb|U71380.1|GMU71380 Glycine max thiol protease isoform A mRNA, ... 44 0.41
208gb|U71379.1|GMU71379 Glycine max thiol protease isoform B mRNA, ... 44 0.41
209gb|AY728270.1| Paragonimus westermani westerpain-10 gene, comple... 42 1.6
210gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 42 1.6
211gb|AY974330.1| Saprolegnia parasitica SPM9F1 cysteine protease m... 42 1.6
212emb|AL157413.18| Human DNA sequence from clone RP11-526K17 on ch... 42 1.6
213emb|AJ009878.1|CAR9878 Cicer arietinum mRNA for cysteine proteinase 42 1.6
214gb|AC099770.11| Mus musculus Strain C57BL6/J chromosome 5 BAC, R... 42 1.6
215gb|AC107315.1| Genomic sequence for Oryza sativa, Nipponbare str... 42 1.6
216dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
217gb|AF314930.1|AF314930 Trypanosoma cruzi strain Ynull cruzipain ... 42 1.6
218gb|AC137698.1| Genomic sequence for Oryza sativa, Nipponbare str... 42 1.6
219gb|AY099317.1| Trypanosoma cruzi clone CL Brener cysteine protei... 42 1.6
220dbj|D21124.1|PWSNTP Paragonimus westermani mRNA for neutral thio... 42 1.6
221gb|AY700585.1| Zingiber officinale cysteine protease gp2a mRNA, ... 40 6.3
222ref|XM_507329.1| PREDICTED Oryza sativa (japonica cultivar-group... 40 6.3
223ref|XM_483741.1| Oryza sativa (japonica cultivar-group), mRNA 40 6.3
224gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence 40 6.3
225gb|AC073906.6| Trypanosoma brucei chromosome 6 clone RPCI93-3A7,... 40 6.3
226gb|AF527926.1| Candida glabrata strain NRRL Y-65 actin (act1) ge... 40 6.3
227ref|XM_540519.2| PREDICTED: Canis familiaris similar to tumor pr... 40 6.3
228ref|XM_821191.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.3
229ref|XM_821190.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.3
230ref|XM_821189.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.3
231ref|XM_821188.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.3
232ref|XM_821187.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.3
233ref|XM_821186.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.3
234ref|XM_821185.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.3
235ref|XM_821184.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.3
236ref|XM_821183.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.3
237ref|XM_821182.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.3
238ref|XM_821181.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.3
239ref|XM_448768.1| Candida glabrata CBS138, CAGL0K12694g partial mRNA 40 6.3
240gb|AC149637.11| Medicago truncatula clone mth2-181h2, complete s... 40 6.3
241emb|AL023805.2|HS811H13 Human DNA sequence from clone RP4-811H13... 40 6.3
242emb|X99936.1|ZMSEE1 Z.mays mRNA for cysteine proteinase, See1 40 6.3
243emb|X16465.1|TBCYSPRO Trypanosoma brucei mRNA for cysteine prote... 40 6.3
244emb|X54353.1|TBCSTPRO Trypanosome mRNA for a cysteine protease 40 6.3
245emb|CR380957.1| Candida glabrata strain CBS138 chromosome K comp... 40 6.3
246emb|AJ389073.1|CGL389073 Candida glabrata partial act1 gene, str... 40 6.3
247emb|AJ389072.1|CGL389072 Candida glabrata partial act1 gene, str... 40 6.3
248emb|AJ297265.1|TBR297265 Trypanosoma brucei rhodesiense partial ... 40 6.3
249emb|CR860490.1| Pongo pygmaeus mRNA; cDNA DKFZp469F0716 (from cl... 40 6.3
250gb|AC087182.12| Oryza sativa chromosome 10 BAC OSJNBa0029C15 gen... 40 6.3
251gb|AC155939.6| Mus musculus 10 BAC RP24-418P10 (Roswell Park Can... 40 6.3
252dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
253dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
254ref|XM_574585.1| PREDICTED: Rattus norvegicus similar to transme... 40 6.3
255dbj|AP006171.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
256gb|AF265227.1|AF265227 Trypanosoma cruzi strain TCC cruzipain ge... 40 6.3
257dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 6.3
258dbj|AP003928.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
259dbj|AK105612.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
260dbj|AK099308.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
261dbj|AK072235.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
262gb|AY111351.1| Zea mays CL1876_2 mRNA sequence 40 6.3
263gb|AY106223.1| Zea mays PCO114759 mRNA sequence 40 6.3
264gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 6.3
265gb|AF069746.1|AF069746 Candida glabrata actin gene, complete cds 40 6.3
266gb|U95090.1|HSU95090 Homo sapiens chromosome 19 cosmid F19541, c... 40 6.3
267gb|AF007215.1|AF007215 Lavatera thuringiaca stress-induced cyste... 40 6.3
268gb|U41454.1|TCU41454 Trypanosoma cruzi cysteine protease cruzipa... 40 6.3
269gb|U41444.1|TCU41444 Trypanosoma cruzi cysteine protease cruzipa... 40 6.3
270dbj|D45403.1|MZECYPA Corn mRNA for cysteine proteinase, clone CC... 40 6.3

>tpe|BN000093.1|HVA000093 TPA: TPA_exp: Hordeum vulgare mRNA for putative cysteine proteinase
            precursor (sf42 gene)
          Length = 1438

 Score =  898 bits (453), Expect = 0.0
 Identities = 462/465 (99%)
 Strand = Plus / Minus

                                                                        
Query: 6    aagcaatacatattatggacagaattattcagaagttctttagccacatcaaaatagcgt 65
            ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1432 aagcaatacatattatgtacagaattattcagaagttctttagccacatcaaaatagcgt 1373

                                                                        
Query: 66   gtggcaaacatcacatgcatgggcgtagcaaatggagcagatgcataagttatacagcaa 125
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1372 gtggcaaacatcacatgcatgggcgtagcaaatggagcagatgcataagttatacagcaa 1313

                                                                        
Query: 126  gcatactgttgcggcttcgcatctccgctgctgataagcgacgatggagcctagcgacta 185
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1312 gcatactgttgcggcttcgcatctccgctgctgataagcgacgatggagcctagcgacta 1253

                                                                        
Query: 186  ctaggtattaaagtttcattctagcgatacatagaaaccaagatcgactccaggagggcc 245
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1252 ctaggtattaaagtttcattctagcgatacatagaaaccaagatcgactccaggagggcc 1193

                                                                        
Query: 246  gccgatcagatcagaacagatcagacaagagcctactcctccttcgaggagtgtgtggcg 305
            |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1192 gccgatcagatcagaacagatcagaccagagcctactcctccttcgaggagtgtgtggcg 1133

                                                                        
Query: 306  gacaccgtggagaccatggagtcgacgccgcacttgttgcgcacgttggagcccctgcag 365
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1132 gacaccgtggagaccatggagtcgacgccgcacttgttgcgcacgttggagcccctgcag 1073

                                                                        
Query: 366  atcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatccagtat 425
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1072 atcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatccagtat 1013

                                                         
Query: 426  ggcttctccttgaagcgggaaggcgcaaagccggacgccccgtaa 470
            |||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 1012 ggcttctccttgaagcgggaaggcgcgaagccggacgccccgtaa 968



to top

>emb|AJ496571.2|HVU496571 Hordeum vulgare partial mRNA for putative cysteine proteinase (sf42
           gene)
          Length = 397

 Score =  759 bits (383), Expect = 0.0
 Identities = 389/391 (99%)
 Strand = Plus / Minus

                                                                       
Query: 6   aagcaatacatattatggacagaattattcagaagttctttagccacatcaaaatagcgt 65
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 391 aagcaatacatattatgtacagaattattcagaagttctttagccacatcaaaatagcgt 332

                                                                       
Query: 66  gtggcaaacatcacatgcatgggcgtagcaaatggagcagatgcataagttatacagcaa 125
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 331 gtggcaaacatcacatgcatgggcgtagcaaatggagcagatgcataagttatacagcaa 272

                                                                       
Query: 126 gcatactgttgcggcttcgcatctccgctgctgataagcgacgatggagcctagcgacta 185
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 271 gcatactgttgcggcttcgcatctccgctgctgataagcgacgatggagcctagcgacta 212

                                                                       
Query: 186 ctaggtattaaagtttcattctagcgatacatagaaaccaagatcgactccaggagggcc 245
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 211 ctaggtattaaagtttcattctagcgatacatagaaaccaagatcgactccaggagggcc 152

                                                                       
Query: 246 gccgatcagatcagaacagatcagacaagagcctactcctccttcgaggagtgtgtggcg 305
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 151 gccgatcagatcagaacagatcagaccagagcctactcctccttcgaggagtgtgtggcg 92

                                                                       
Query: 306 gacaccgtggagaccatggagtcgacgccgcacttgttgcgcacgttggagcccctgcag 365
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 91  gacaccgtggagaccatggagtcgacgccgcacttgttgcgcacgttggagcccctgcag 32

                                          
Query: 366 atcttgtagtaccccttgtccccccagttct 396
           |||||||||||||||||||||||||||||||
Sbjct: 31  atcttgtagtaccccttgtccccccagttct 1



to top

>gb|AY841792.1| Triticum aestivum cysteine protease (CP) mRNA, complete cds
          Length = 1525

 Score =  565 bits (285), Expect = e-158
 Identities = 424/469 (90%), Gaps = 21/469 (4%)
 Strand = Plus / Minus

                                                                        
Query: 6    aagcaatacatattatggacagaattattcagaagttctttagccacatcaaaatagcgt 65
            ||||||||||||||||| |||||||||||||| |||| |||||||||||| |||||||||
Sbjct: 1488 aagcaatacatattatgtacagaattattcaggagttttttagccacatccaaatagcgt 1429

                                                                        
Query: 66   gtggcaaacatcacatgcatgggcgtagcaaatggagcagatgcataagttatacagcaa 125
            |||||| ||||     |||||| ||||||||||  |||| ||||| ||||||||||||||
Sbjct: 1428 gtggcagacat-----gcatgg-cgtagcaaatttagcaaatgcacaagttatacagcaa 1375

                                                                        
Query: 126  gcatactgttgcggcttcgcatctccgctgctgata----agcgacgatggagcctagc- 180
            |||| ||||||||||||||||||| |||||||||||    | ||||||||||||||||| 
Sbjct: 1374 gcattctgttgcggcttcgcatcttcgctgctgataccacaacgacgatggagcctagcc 1315

                                                                        
Query: 181  gactactaggtattaaagtttcattctagcgatacatagaaaccaagatcgactccagga 240
            |||||||||||||||||||||| |||||||||||||  ||||||||||||||||||||||
Sbjct: 1314 gactactaggtattaaagtttctttctagcgatacaccgaaaccaagatcgactccagga 1255

                                                                        
Query: 241  gggccgccgatcagatcagaacagatcagacaagagcctactcctccttcgaggagtgtg 300
            |||| |||||||| ||||||||          |||||||||||||||||||||| ||| |
Sbjct: 1254 gggctgccgatcacatcagaac----------agagcctactcctccttcgaggcgtgcg 1205

                                                                        
Query: 301  tggcggacaccgtggagaccatggagtcgacgccgcacttgttgcgcacgttggagcccc 360
            ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 1204 tggcggacaccgtggagaccatggagtcgacgccgcacttgtttcgcacgttggagcccc 1145

                                                                        
Query: 361  tgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatcc 420
            |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 1144 tgcagatcttgtagtaacccttgtccccccagttctcgccccatgagttcttgatgatcc 1085

                                                             
Query: 421  agtatggcttctccttgaagcgggaaggcgcaaagccggacgccccgta 469
            |||| |||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 1084 agtagggcttctccttgaagcgggaaggcgcgaagccggacgccccgta 1036



to top

>gb|BT008950.1| Triticum aestivum clone wdk1c.pk009.j19:fis, full insert mRNA
           sequence
          Length = 935

 Score =  531 bits (268), Expect = e-148
 Identities = 428/478 (89%), Gaps = 20/478 (4%)
 Strand = Plus / Minus

                                                                       
Query: 1   gatgaaagcaatacatattatggacagaattattcagaagttctttagccacatcaaaat 60
           |||| |||||||||| |||||| |||||||||||||| ||||||||||||||||| ||||
Sbjct: 916 gatggaagcaatacaaattatgtacagaattattcaggagttctttagccacatccaaat 857

                                                                       
Query: 61  agcgtgtggcaaacatcacatgcatgggcgtagcaaatggagcagatgcataagttatac 120
           ||||||||||| ||||     |||||| ||||||||||  |||| |||||||||||||||
Sbjct: 856 agcgtgtggcagacat-----gcatgg-cgtagcaaatttagcaaatgcataagttatac 803

                                                                       
Query: 121 agcaagcatactgttgcggcttcgcatctccgctgctgata----agcgacgatggagcc 176
           ||||||||| || ||||| |||||||||| |||||||||||    | |||||||||||||
Sbjct: 802 agcaagcattctattgcgacttcgcatcttcgctgctgataccacaacgacgatggagcc 743

                                                                       
Query: 177 tagc-gactactaggtattaaagtttcattctagcgatacata----gaaaccaagatcg 231
           |||| |||||||| ||||||||||||| ||||||||||||| |    |||||||||||||
Sbjct: 742 tagccgactactacgtattaaagtttctttctagcgatacacacaccgaaaccaagatcg 683

                                                                       
Query: 232 actccaggagggccgccgatcagatcagaacagatcagacaagagcctactcctccttcg 291
           || ||||||||||||||||||||||||||     |||||| ||||||||||| ||||| |
Sbjct: 682 acaccaggagggccgccgatcagatcaga-----tcagaccagagcctactcgtccttgg 628

                                                                       
Query: 292 aggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgttgcgcacgt 351
           ||| ||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 627 aggcgtgagtggcggacaccgtggagaccatggagtcgacgccacacttgttgcgcacgt 568

                                                                       
Query: 352 tggagcccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttct 411
           | ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 567 tcgagcccctgcagatcttgtagtaacccttgtccccccagttctcgccccatgagttct 508

                                                                     
Query: 412 tgatgatccagtatggcttctccttgaagcgggaaggcgcaaagccggacgccccgta 469
           ||||||||||||| |||||||||||||||||||||||||| ||||| |||||||||||
Sbjct: 507 tgatgatccagtagggcttctccttgaagcgggaaggcgcgaagccagacgccccgta 450



to top

>gb|DQ344624.1| Triticum aestivum vacuolar ATP synthase subunit E (VATE) mRNA,
            complete cds
          Length = 1970

 Score =  345 bits (174), Expect = 8e-92
 Identities = 319/364 (87%), Gaps = 20/364 (5%)
 Strand = Plus / Plus

                                                                        
Query: 6    aagcaatacatattatggacagaattattcagaagttctttagccacatcaaaatagcgt 65
            |||||||||| |||||| |||||||||||||| |||||||| |||||||| |||||||||
Sbjct: 1617 aagcaatacaaattatgtacagaattattcaggagttctttggccacatccaaatagcgt 1676

                                                                        
Query: 66   gtggcaaacatcacatgcatgggcgtagcaaatggagcagatgcataagttatacagcaa 125
            |||||| ||||     |||||| ||||||||||  |||| ||||||||||||||||||||
Sbjct: 1677 gtggcagacat-----gcatgg-cgtagcaaatttagcaaatgcataagttatacagcaa 1730

                                                                        
Query: 126  gcatactgttgcggcttcgcatctccgctgctgata----agcgacgatggagcctagc- 180
            |||| || ||||| |||||||||| |||||||||||    | ||||||||||||||||| 
Sbjct: 1731 gcattctattgcgacttcgcatcttcgctgctgataccacaacgacgatggagcctagcc 1790

                                                                        
Query: 181  gactactaggtattaaagtttcattctagcgatacata----gaaaccaagatcgactcc 236
            |||||||| ||||||||||||| ||||||||||||| |    ||||||||||||||| ||
Sbjct: 1791 gactactacgtattaaagtttctttctagcgatacacacaccgaaaccaagatcgacacc 1850

                                                                        
Query: 237  aggagggccgccgatcagatcagaacagatcagacaagagcctactcctccttcgaggag 296
            ||||||||||||||||||||||||     |||||| ||||||||||| ||||| |||| |
Sbjct: 1851 aggagggccgccgatcagatcaga-----tcagaccagagcctactcgtccttggaggcg 1905

                                                                        
Query: 297  tgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgttgcgcacgttggag 356
            || ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||
Sbjct: 1906 tgagtggcggacaccgtggagaccatggagtcgacgccacacttgttgcgcacgttcgag 1965

                
Query: 357  cccc 360
            ||||
Sbjct: 1966 cccc 1969



to top

>gb|BT017759.1| Zea mays clone EL01N0501D06.c mRNA sequence
          Length = 1131

 Score =  178 bits (90), Expect = 1e-41
 Identities = 123/134 (91%)
 Strand = Plus / Minus

                                                                       
Query: 303 gcggacaccgtggagaccatggagtcgacgccgcacttgttgcgcacgttggagcccctg 362
           |||||||| || ||||||||||| |||||||||||||||||||| |||||||| ||||||
Sbjct: 808 gcggacacggtagagaccatggaatcgacgccgcacttgttgcgaacgttggaacccctg 749

                                                                       
Query: 363 cagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatccag 422
           || ||||||||||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 748 catatcttgtagtatccgttctccccccagttctcgccccacgagttcttgatgatccag 689

                         
Query: 423 tatggcttctcctt 436
           || ||||| |||||
Sbjct: 688 taaggcttgtcctt 675



to top

>emb|X82185.1|ZMCYSPRO Z.mays mRNA for cysteine proteinase
          Length = 693

 Score =  178 bits (90), Expect = 1e-41
 Identities = 123/134 (91%)
 Strand = Plus / Minus

                                                                       
Query: 303 gcggacaccgtggagaccatggagtcgacgccgcacttgttgcgcacgttggagcccctg 362
           |||||||| || ||||||||||| |||||||||||||||||||| |||||||| ||||||
Sbjct: 416 gcggacacggtagagaccatggaatcgacgccgcacttgttgcgaacgttggaacccctg 357

                                                                       
Query: 363 cagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatccag 422
           || ||||||||||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 356 catatcttgtagtatccgttctccccccagttctcgccccacgagttcttgatgatccag 297

                         
Query: 423 tatggcttctcctt 436
           || ||||| |||||
Sbjct: 296 taaggcttgtcctt 283



to top

>gb|AY104312.1| Zea mays PCO074362 mRNA sequence
          Length = 2610

 Score =  178 bits (90), Expect = 1e-41
 Identities = 123/134 (91%)
 Strand = Plus / Minus

                                                                        
Query: 303  gcggacaccgtggagaccatggagtcgacgccgcacttgttgcgcacgttggagcccctg 362
            |||||||| || ||||||||||| |||||||||||||||||||| |||||||| ||||||
Sbjct: 1178 gcggacacggtagagaccatggaatcgacgccgcacttgttgcgaacgttggaacccctg 1119

                                                                        
Query: 363  cagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatccag 422
            || ||||||||||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 1118 catatcttgtagtatccgttctccccccagttctcgccccacgagttcttgatgatccag 1059

                          
Query: 423  tatggcttctcctt 436
            || ||||| |||||
Sbjct: 1058 taaggcttgtcctt 1045



to top

>dbj|D45402.1|MZECP Corn mRNA for cysteine proteinase, clone CCP, complete cds
          Length = 1311

 Score =  178 bits (90), Expect = 1e-41
 Identities = 123/134 (91%)
 Strand = Plus / Minus

                                                                        
Query: 303  gcggacaccgtggagaccatggagtcgacgccgcacttgttgcgcacgttggagcccctg 362
            |||||||| || ||||||||||| |||||||||||||||||||| |||||||| ||||||
Sbjct: 1117 gcggacacggtagagaccatggaatcgacgccgcacttgttgcgaacgttggaacccctg 1058

                                                                        
Query: 363  cagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatccag 422
            || ||||||||||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 1057 catatcttgtagtatccgttctccccccagttctcgccccacgagttcttgatgatccag 998

                          
Query: 423  tatggcttctcctt 436
            || ||||| |||||
Sbjct: 997  taaggcttgtcctt 984



to top

>ref|XM_471773.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1146

 Score =  157 bits (79), Expect = 4e-35
 Identities = 85/87 (97%)
 Strand = Plus / Minus

                                                                        
Query: 357  cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
            |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1064 cccctgcagatcttgtagtaccccttctccccccagttctcgccccacgagttcttgatg 1005

                                       
Query: 417  atccagtatggcttctccttgaagcgg 443
            |||||||| ||||||||||||||||||
Sbjct: 1004 atccagtacggcttctccttgaagcgg 978



to top

>emb|AL663007.2|OSJN00206 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0054B09,
             complete sequence
          Length = 146506

 Score =  157 bits (79), Expect = 4e-35
 Identities = 85/87 (97%)
 Strand = Plus / Minus

                                                                         
Query: 357   cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
             |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 21996 cccctgcagatcttgtagtaccccttctccccccagttctcgccccacgagttcttgatg 21937

                                        
Query: 417   atccagtatggcttctccttgaagcgg 443
             |||||||| ||||||||||||||||||
Sbjct: 21936 atccagtacggcttctccttgaagcgg 21910



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  157 bits (79), Expect = 4e-35
 Identities = 85/87 (97%)
 Strand = Plus / Minus

                                                                            
Query: 357      cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
                |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 14184230 cccctgcagatcttgtagtaccccttctccccccagttctcgccccacgagttcttgatg 14184171

                                           
Query: 417      atccagtatggcttctccttgaagcgg 443
                |||||||| ||||||||||||||||||
Sbjct: 14184170 atccagtacggcttctccttgaagcgg 14184144



to top

>dbj|AK121305.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023111H18, full
            insert sequence
          Length = 1981

 Score =  157 bits (79), Expect = 4e-35
 Identities = 85/87 (97%)
 Strand = Plus / Minus

                                                                        
Query: 357  cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
            |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1632 cccctgcagatcttgtagtaccccttctccccccagttctcgccccacgagttcttgatg 1573

                                       
Query: 417  atccagtatggcttctccttgaagcgg 443
            |||||||| ||||||||||||||||||
Sbjct: 1572 atccagtacggcttctccttgaagcgg 1546



to top

>dbj|AK071948.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013078J21, full
            insert sequence
          Length = 1334

 Score =  149 bits (75), Expect = 1e-32
 Identities = 84/87 (96%)
 Strand = Plus / Minus

                                                                        
Query: 357  cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
            |||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||
Sbjct: 1075 cccctgcagatcttgtagtaccccttctccccccagttctcgccccgcgagttcttgatg 1016

                                       
Query: 417  atccagtatggcttctccttgaagcgg 443
            |||||||| ||||||||||||||||||
Sbjct: 1015 atccagtacggcttctccttgaagcgg 989



to top

>ref|XM_507484.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1371_D04.6 mRNA
          Length = 1523

 Score =  145 bits (73), Expect = 1e-31
 Identities = 124/141 (87%)
 Strand = Plus / Minus

                                                                        
Query: 284  ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 343
            |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 1163 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 1104

                                                                        
Query: 344  gcgcacgttggagcccctgcagatcttgtagtaccccttgtccccccagttctcgcccca 403
            ||| |||||||||||||||||||||||||||||||| |  || |||||||||||||||||
Sbjct: 1103 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 1044

                                 
Query: 404  cgagttcttgatgatccagta 424
             ||||||||||||||||||||
Sbjct: 1043 ggagttcttgatgatccagta 1023



to top

>ref|XM_507483.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1371_D04.6 mRNA
          Length = 1480

 Score =  145 bits (73), Expect = 1e-31
 Identities = 124/141 (87%)
 Strand = Plus / Minus

                                                                        
Query: 284  ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 343
            |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 1165 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 1106

                                                                        
Query: 344  gcgcacgttggagcccctgcagatcttgtagtaccccttgtccccccagttctcgcccca 403
            ||| |||||||||||||||||||||||||||||||| |  || |||||||||||||||||
Sbjct: 1105 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 1046

                                 
Query: 404  cgagttcttgatgatccagta 424
             ||||||||||||||||||||
Sbjct: 1045 ggagttcttgatgatccagta 1025



to top

>ref|XM_465566.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1386

 Score =  145 bits (73), Expect = 1e-31
 Identities = 124/141 (87%)
 Strand = Plus / Minus

                                                                        
Query: 284  ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 343
            |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 1166 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 1107

                                                                        
Query: 344  gcgcacgttggagcccctgcagatcttgtagtaccccttgtccccccagttctcgcccca 403
            ||| |||||||||||||||||||||||||||||||| |  || |||||||||||||||||
Sbjct: 1106 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 1047

                                 
Query: 404  cgagttcttgatgatccagta 424
             ||||||||||||||||||||
Sbjct: 1046 ggagttcttgatgatccagta 1026



to top

>ref|XM_507482.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1371_D04.6 mRNA
          Length = 1504

 Score =  145 bits (73), Expect = 1e-31
 Identities = 124/141 (87%)
 Strand = Plus / Minus

                                                                        
Query: 284  ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 343
            |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 1167 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 1108

                                                                        
Query: 344  gcgcacgttggagcccctgcagatcttgtagtaccccttgtccccccagttctcgcccca 403
            ||| |||||||||||||||||||||||||||||||| |  || |||||||||||||||||
Sbjct: 1107 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 1048

                                 
Query: 404  cgagttcttgatgatccagta 424
             ||||||||||||||||||||
Sbjct: 1047 ggagttcttgatgatccagta 1027



to top

>ref|XM_506801.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1371_D04.6 mRNA
          Length = 1486

 Score =  145 bits (73), Expect = 1e-31
 Identities = 124/141 (87%)
 Strand = Plus / Minus

                                                                        
Query: 284  ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 343
            |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 1171 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 1112

                                                                        
Query: 344  gcgcacgttggagcccctgcagatcttgtagtaccccttgtccccccagttctcgcccca 403
            ||| |||||||||||||||||||||||||||||||| |  || |||||||||||||||||
Sbjct: 1111 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 1052

                                 
Query: 404  cgagttcttgatgatccagta 424
             ||||||||||||||||||||
Sbjct: 1051 ggagttcttgatgatccagta 1031



to top

>dbj|AK061947.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-E05, full
            insert sequence
          Length = 1504

 Score =  145 bits (73), Expect = 1e-31
 Identities = 124/141 (87%)
 Strand = Plus / Minus

                                                                        
Query: 284  ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 343
            |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 1167 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 1108

                                                                        
Query: 344  gcgcacgttggagcccctgcagatcttgtagtaccccttgtccccccagttctcgcccca 403
            ||| |||||||||||||||||||||||||||||||| |  || |||||||||||||||||
Sbjct: 1107 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 1048

                                 
Query: 404  cgagttcttgatgatccagta 424
             ||||||||||||||||||||
Sbjct: 1047 ggagttcttgatgatccagta 1027



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  145 bits (73), Expect = 1e-31
 Identities = 124/141 (87%)
 Strand = Plus / Minus

                                                                            
Query: 284      ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 343
                |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 15994671 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 15994612

                                                                            
Query: 344      gcgcacgttggagcccctgcagatcttgtagtaccccttgtccccccagttctcgcccca 403
                ||| |||||||||||||||||||||||||||||||| |  || |||||||||||||||||
Sbjct: 15994611 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 15994552

                                     
Query: 404      cgagttcttgatgatccagta 424
                 ||||||||||||||||||||
Sbjct: 15994551 ggagttcttgatgatccagta 15994531



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                                
Query: 387      ccccagttctcgccccacgagttcttgatgat 418
                |||||||||| ||||||||||||||| |||||
Sbjct: 29687803 ccccagttcttgccccacgagttcttcatgat 29687772



to top

>dbj|AP004852.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1371_D04
          Length = 105468

 Score =  145 bits (73), Expect = 1e-31
 Identities = 124/141 (87%)
 Strand = Plus / Minus

                                                                         
Query: 284   ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 343
             |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 25606 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 25547

                                                                         
Query: 344   gcgcacgttggagcccctgcagatcttgtagtaccccttgtccccccagttctcgcccca 403
             ||| |||||||||||||||||||||||||||||||| |  || |||||||||||||||||
Sbjct: 25546 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 25487

                                  
Query: 404   cgagttcttgatgatccagta 424
              ||||||||||||||||||||
Sbjct: 25486 ggagttcttgatgatccagta 25466



to top

>dbj|AK099269.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023020I09, full
            insert sequence
          Length = 1385

 Score =  145 bits (73), Expect = 1e-31
 Identities = 124/141 (87%)
 Strand = Plus / Minus

                                                                        
Query: 284  ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 343
            |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 1165 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 1106

                                                                        
Query: 344  gcgcacgttggagcccctgcagatcttgtagtaccccttgtccccccagttctcgcccca 403
            ||| |||||||||||||||||||||||||||||||| |  || |||||||||||||||||
Sbjct: 1105 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 1046

                                 
Query: 404  cgagttcttgatgatccagta 424
             ||||||||||||||||||||
Sbjct: 1045 ggagttcttgatgatccagta 1025



to top

>dbj|AK098908.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002F17, full
            insert sequence
          Length = 1480

 Score =  145 bits (73), Expect = 1e-31
 Identities = 124/141 (87%)
 Strand = Plus / Minus

                                                                        
Query: 284  ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 343
            |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 1165 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 1106

                                                                        
Query: 344  gcgcacgttggagcccctgcagatcttgtagtaccccttgtccccccagttctcgcccca 403
            ||| |||||||||||||||||||||||||||||||| |  || |||||||||||||||||
Sbjct: 1105 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 1046

                                 
Query: 404  cgagttcttgatgatccagta 424
             ||||||||||||||||||||
Sbjct: 1045 ggagttcttgatgatccagta 1025



to top

>dbj|AK071907.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013063O07, full
            insert sequence
          Length = 1486

 Score =  145 bits (73), Expect = 1e-31
 Identities = 124/141 (87%)
 Strand = Plus / Minus

                                                                        
Query: 284  ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 343
            |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 1171 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 1112

                                                                        
Query: 344  gcgcacgttggagcccctgcagatcttgtagtaccccttgtccccccagttctcgcccca 403
            ||| |||||||||||||||||||||||||||||||| |  || |||||||||||||||||
Sbjct: 1111 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 1052

                                 
Query: 404  cgagttcttgatgatccagta 424
             ||||||||||||||||||||
Sbjct: 1051 ggagttcttgatgatccagta 1031



to top

>dbj|AK119670.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-149-H07, full
            insert sequence
          Length = 1523

 Score =  129 bits (65), Expect = 9e-27
 Identities = 122/141 (86%)
 Strand = Plus / Minus

                                                                        
Query: 284  ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 343
            |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 1163 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 1104

                                                                        
Query: 344  gcgcacgttggagcccctgcagatcttgtagtaccccttgtccccccagttctcgcccca 403
             || ||||||||||||||||||| |||||||||||| |  || |||||||||||||||||
Sbjct: 1103 acggacgttggagcccctgcagaccttgtagtacccatgctctccccagttctcgcccca 1044

                                 
Query: 404  cgagttcttgatgatccagta 424
             ||||||||||||||||||||
Sbjct: 1043 ggagttcttgatgatccagta 1023



to top

>gb|AF462226.1| Narcissus pseudonarcissus putative cysteine proteinase mRNA,
           partial cds
          Length = 631

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 361 tgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatcc 420
           |||||||||||||||| ||||| || ||||| ||||||||||||||||||||||||||||
Sbjct: 337 tgcagatcttgtagtaacccttctcaccccaattctcgccccacgagttcttgatgatcc 278

                              
Query: 421 agtatggcttctccttgaa 439
           |||||||||| ||||||||
Sbjct: 277 agtatggcttttccttgaa 259



to top

>gb|AY504968.1| Iris hollandica putative cysteine protease 3 (CYS3) mRNA, complete
            cds
          Length = 1286

 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                        
Query: 356  gcccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgat 415
            ||||||||||||||||||||| || || ||||||||| |||| |||||||||||||| ||
Sbjct: 1008 gcccctgcagatcttgtagtaaccattctccccccaggtctcaccccacgagttctttat 949

                                 
Query: 416  gatccagtatggcttctcctt 436
            ||||||||| |||||||||||
Sbjct: 948  gatccagtacggcttctcctt 928



to top

>gb|AF242373.1|AF242373 Ipomoea batatas cysteine protease (SPCP2) mRNA, complete cds
          Length = 1195

 Score =  105 bits (53), Expect = 1e-19
 Identities = 71/77 (92%)
 Strand = Plus / Minus

                                                                        
Query: 357  cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
            |||| |||||||||||||||||| || || |||||| |||||||||||||||||||||||
Sbjct: 1036 ccccggcagatcttgtagtacccattctctccccagctctcgccccacgagttcttgatg 977

                             
Query: 417  atccagtatggcttctc 433
            ||||||||||| |||||
Sbjct: 976  atccagtatggtttctc 960



to top

>gb|AF411121.1| Sandersonia aurantiaca cysteine proteinase precursor (PRT22) mRNA,
            partial cds
          Length = 1310

 Score =  103 bits (52), Expect = 5e-19
 Identities = 76/84 (90%)
 Strand = Plus / Minus

                                                                        
Query: 360  ctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatc 419
            ||||| ||||||||||| || || || ||||||||||| ||||| |||||||||||||||
Sbjct: 1016 ctgcaaatcttgtagtatccgttctctccccagttctctccccatgagttcttgatgatc 957

                                    
Query: 420  cagtatggcttctccttgaagcgg 443
            ||||||||||| ||||||||||||
Sbjct: 956  cagtatggcttttccttgaagcgg 933



to top

>gb|AF138266.1|AF138266 Ipomoea batatas papain-like cysteine proteinase isoform III
            (IBPCPIII) mRNA, complete cds
          Length = 1144

 Score =  101 bits (51), Expect = 2e-18
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                        
Query: 357  cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
            |||| |||||||||||||||||| || || |||||| |||||||||||||||||||||||
Sbjct: 1046 ccccggcagatcttgtagtacccattctctccccagctctcgccccacgagttcttgatg 987

                       
Query: 417  atccagtatgg 427
            |||||||||||
Sbjct: 986  atccagtatgg 976



to top

>gb|AF138265.1|AF138265 Ipomoea batatas papain-like cysteine proteinase isoform II (IBPCPII)
            mRNA, complete cds
          Length = 1143

 Score =  101 bits (51), Expect = 2e-18
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                        
Query: 357  cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
            |||| |||||||||||||||||| || || |||||| |||||||||||||||||||||||
Sbjct: 1046 ccccggcagatcttgtagtacccattctctccccagctctcgccccacgagttcttgatg 987

                       
Query: 417  atccagtatgg 427
            |||||||||||
Sbjct: 986  atccagtatgg 976



to top

>gb|AF138264.1|AF138264 Ipomoea batatas papain-like cysteine proteinase isoform I (IBPCPI)
            mRNA, complete cds
          Length = 1149

 Score =  101 bits (51), Expect = 2e-18
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                        
Query: 357  cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
            |||| |||||||||||||||||| || || |||||| |||||||||||||||||||||||
Sbjct: 1052 ccccggcagatcttgtagtacccattctctccccagctctcgccccacgagttcttgatg 993

                       
Query: 417  atccagtatgg 427
            |||||||||||
Sbjct: 992  atccagtatgg 982



to top

>gb|AF216785.1|AF216785 Ipomoea batatas papain-like cysteine proteinase isoform III (PCPIII)
            gene, complete cds
          Length = 1473

 Score =  101 bits (51), Expect = 2e-18
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                        
Query: 357  cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
            |||| |||||||||||||||||| || || |||||| |||||||||||||||||||||||
Sbjct: 1375 ccccggcagatcttgtagtacccattctctccccagctctcgccccacgagttcttgatg 1316

                       
Query: 417  atccagtatgg 427
            |||||||||||
Sbjct: 1315 atccagtatgg 1305



to top

>gb|AF216784.1|AF216784 Ipomoea batatas papain-like cysteine proteinase isoform II (PCPII)
            gene, complete cds
          Length = 1483

 Score =  101 bits (51), Expect = 2e-18
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                        
Query: 357  cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
            |||| |||||||||||||||||| || || |||||| |||||||||||||||||||||||
Sbjct: 1386 ccccggcagatcttgtagtacccattctctccccagctctcgccccacgagttcttgatg 1327

                       
Query: 417  atccagtatgg 427
            |||||||||||
Sbjct: 1326 atccagtatgg 1316



to top

>gb|AF216783.1|AF216783 Ipomoea batatas papain-like cysteine proteinase isoform I (PCPI)
            gene, complete cds
          Length = 1474

 Score =  101 bits (51), Expect = 2e-18
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                        
Query: 357  cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
            |||| |||||||||||||||||| || || |||||| |||||||||||||||||||||||
Sbjct: 1377 ccccggcagatcttgtagtacccattctctccccagctctcgccccacgagttcttgatg 1318

                       
Query: 417  atccagtatgg 427
            |||||||||||
Sbjct: 1317 atccagtatgg 1307



to top

>emb|Z99953.1|PVZ99953 Phaseolus vulgaris Moldavian encoding cysteine proteinase precursor
            (clone cp41)
          Length = 1376

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 69/77 (89%)
 Strand = Plus / Minus

                                                                        
Query: 360  ctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatc 419
            ||||||||||||||||| || ||  | ||||||||||| |||||||||||||||||||||
Sbjct: 1031 ctgcagatcttgtagtatccattccctccccagttctccccccacgagttcttgatgatc 972

                             
Query: 420  cagtatggcttctcctt 436
            ||||| ||||| |||||
Sbjct: 971  cagtaaggcttttcctt 955



to top

>dbj|AB161375.1| Aster tripolium CysP mRNA for cysteine protease, complete cds
          Length = 1191

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                 
Query: 387  ccccagttctcgccccacgagttcttgatgatccagtatggcttctccttgaa 439
            ||||||| ||| ||||| |||||||||||||||||||||||||||||||||||
Sbjct: 1005 ccccagtcctctccccatgagttcttgatgatccagtatggcttctccttgaa 953



to top

>gb|AY373974.1| Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds
          Length = 1309

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                        
Query: 356  gcccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgat 415
            |||||||||||||||||| || || |  || |||||||| || ||||| || ||||||||
Sbjct: 1063 gcccctgcagatcttgtaatatccttcctctccccagttttctccccaagaattcttgat 1004

                                    
Query: 416  gatccagtatggcttctccttgaa 439
            ||||||||||||||| ||||||||
Sbjct: 1003 gatccagtatggcttgtccttgaa 980



to top

>ref|NM_120069.3| Arabidopsis thaliana RD19 (RESPONSIVE TO DEHYDRATION 19);
            cysteine-type peptidase AT4G39090 (RD19) mRNA, complete
            cds
          Length = 2514

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 69/79 (87%)
 Strand = Plus / Minus

                                                                        
Query: 361  tgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatcc 420
            ||||||| |||||| | || || || |||||  |||| ||||||||||||||||||||||
Sbjct: 1189 tgcagattttgtagaaaccattttcaccccaagtctctccccacgagttcttgatgatcc 1130

                               
Query: 421  agtatggcttctccttgaa 439
            |||| ||||||||||||||
Sbjct: 1129 agtaaggcttctccttgaa 1111



to top

>ref|NM_120068.3| Arabidopsis thaliana ATPase AT4G39080 mRNA, complete cds
          Length = 4147

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                        
Query: 361  tgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatcc 420
            ||||||| |||||| | || || || |||||  |||| ||||||||||||||||||||||
Sbjct: 3698 tgcagattttgtagaaaccattttcaccccaagtctctccccacgagttcttgatgatcc 3757

                               
Query: 421  agtatggcttctccttgaa 439
            |||| ||||||||||||||
Sbjct: 3758 agtaaggcttctccttgaa 3776



to top

>gb|AY133844.1| Arabidopsis thaliana clone U11713 putative cysteine proteinase RD19A
            (At4g39090) mRNA, complete cds
          Length = 1138

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 69/79 (87%)
 Strand = Plus / Minus

                                                                        
Query: 361  tgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatcc 420
            ||||||| |||||| | || || || |||||  |||| ||||||||||||||||||||||
Sbjct: 1033 tgcagattttgtagaaaccattttcaccccaagtctctccccacgagttcttgatgatcc 974

                               
Query: 421  agtatggcttctccttgaa 439
            |||| ||||||||||||||
Sbjct: 973  agtaaggcttctccttgaa 955



to top

>gb|AY080598.1| Arabidopsis thaliana putative cysteine proteinase RD19A (At4g39090)
            mRNA, complete cds
          Length = 1249

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 69/79 (87%)
 Strand = Plus / Minus

                                                                        
Query: 361  tgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatcc 420
            ||||||| |||||| | || || || |||||  |||| ||||||||||||||||||||||
Sbjct: 1042 tgcagattttgtagaaaccattttcaccccaagtctctccccacgagttcttgatgatcc 983

                               
Query: 421  agtatggcttctccttgaa 439
            |||| ||||||||||||||
Sbjct: 982  agtaaggcttctccttgaa 964



to top

>emb|AL161594.2|ATCHRIV90 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 90
          Length = 198987

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                          
Query: 361    tgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatcc 420
              ||||||| |||||| | || || || |||||  |||| ||||||||||||||||||||||
Sbjct: 130055 tgcagattttgtagaaaccattttcaccccaagtctctccccacgagttcttgatgatcc 130114

                                 
Query: 421    agtatggcttctccttgaa 439
              |||| ||||||||||||||
Sbjct: 130115 agtaaggcttctccttgaa 130133



to top

>emb|AL035679.1|ATF19H22 Arabidopsis thaliana DNA chromosome 4, BAC clone F19H22 (ESSA project)
          Length = 100469

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                         
Query: 361   tgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatcc 420
             ||||||| |||||| | || || || |||||  |||| ||||||||||||||||||||||
Sbjct: 92045 tgcagattttgtagaaaccattttcaccccaagtctctccccacgagttcttgatgatcc 92104

                                
Query: 421   agtatggcttctccttgaa 439
             |||| ||||||||||||||
Sbjct: 92105 agtaaggcttctccttgaa 92123



to top

>dbj|AK220782.1| Arabidopsis thaliana mRNA for drought-inducible cysteine proteinase
           RD19A precursor, complete cds, clone: RAFL22-25-O05
          Length = 399

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 69/79 (87%)
 Strand = Plus / Minus

                                                                       
Query: 361 tgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatcc 420
           ||||||| |||||| | || || || |||||  |||| ||||||||||||||||||||||
Sbjct: 198 tgcagattttgtagaaaccattttcaccccaagtctctccccacgagttcttgatgatcc 139

                              
Query: 421 agtatggcttctccttgaa 439
           |||| ||||||||||||||
Sbjct: 138 agtaaggcttctccttgaa 120



to top

>emb|BX828077.1|CNS0A48A Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH50ZA07 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1179

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 69/79 (87%)
 Strand = Plus / Minus

                                                                        
Query: 361  tgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatcc 420
            ||||||| |||||| | || || || |||||  |||| ||||||||||||||||||||||
Sbjct: 1027 tgcagattttgtagaaaccattttcaccccaagtctctccccacgagttcttgatgatcc 968

                               
Query: 421  agtatggcttctccttgaa 439
            |||| ||||||||||||||
Sbjct: 967  agtaaggcttctccttgaa 949



to top

>emb|BX826350.1|CNS0A43C Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB18ZD12 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1186

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 69/79 (87%)
 Strand = Plus / Minus

                                                                        
Query: 361  tgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatcc 420
            ||||||| |||||| | || || || |||||  |||| ||||||||||||||||||||||
Sbjct: 1029 tgcagattttgtagaaaccattttcaccccaagtctctccccacgagttcttgatgatcc 970

                               
Query: 421  agtatggcttctccttgaa 439
            |||| ||||||||||||||
Sbjct: 969  agtaaggcttctccttgaa 951



to top

>gb|AY087621.1| Arabidopsis thaliana clone 37132 mRNA, complete sequence
          Length = 1461

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 69/79 (87%)
 Strand = Plus / Minus

                                                                        
Query: 361  tgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatcc 420
            ||||||| |||||| | || || || |||||  |||| ||||||||||||||||||||||
Sbjct: 1189 tgcagattttgtagaaaccattttcaccccaagtctctccccacgagttcttgatgatcc 1130

                               
Query: 421  agtatggcttctccttgaa 439
            |||| ||||||||||||||
Sbjct: 1129 agtaaggcttctccttgaa 1111



to top

>dbj|D13042.1|ATHRD19A Arabidopsis thaliana rd19A gene for thiol protease, partial cds
          Length = 3255

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 69/79 (87%)
 Strand = Plus / Minus

                                                                        
Query: 361  tgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatcc 420
            ||||||| |||||| | || || || |||||  |||| ||||||||||||||||||||||
Sbjct: 2960 tgcagattttgtagaaaccattttcaccccaagtctctccccacgagttcttgatgatcc 2901

                               
Query: 421  agtatggcttctccttgaa 439
            |||| ||||||||||||||
Sbjct: 2900 agtaaggcttctccttgaa 2882



to top

>gb|AF082181.1|AF082181 Solanum melongena cysteine proteinase precursor, mRNA, complete cds
          Length = 1426

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                        
Query: 357  cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
            ||||||||||||||||| || || |  || ||||||||||| ||||| || |||||||||
Sbjct: 1046 cccctgcagatcttgtaataaccgtgttctccccagttctctccccaagaattcttgatg 987

                                  
Query: 417  atccagtatggcttctccttga 438
            |||||||| ||||| |||||||
Sbjct: 986  atccagtaaggcttttccttga 965



to top

>dbj|AB038598.1| Vigna mungo mRNA for cysteine protease, complete cds
          Length = 1424

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                        
Query: 360  ctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatc 419
            ||||||||||||||||| || || || |||||| |||| |||||||| ||||| ||||||
Sbjct: 1034 ctgcagatcttgtagtatccattctctccccagctctccccccacgaattcttaatgatc 975

                             
Query: 420  cagtatggcttctcctt 436
            ||||| ||||| |||||
Sbjct: 974  cagtaaggcttttcctt 958



to top

>gb|AY800120.1| Populus tomentosa cysteine proteinase (CP) mRNA, complete cds
          Length = 1143

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                        
Query: 357  cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
            ||||||||||| |||||| | || || || |||||| | || ||||| ||||||||||| 
Sbjct: 1058 cccctgcagattttgtagaatccattctctccccagctttctccccatgagttcttgata 999

                                
Query: 417  atccagtatggcttctcctt 436
            ||||||||||||||||||||
Sbjct: 998  atccagtatggcttctcctt 979



to top

>emb|X03971.1|CPCPROR Carica papaya mRNA 3'region for cysteine proteinase (pLBPc13)
          Length = 444

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 357 cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
           ||||||||||||||||| || || || || |||||||| || ||||| || ||||| |||
Sbjct: 224 cccctgcagatcttgtaatatccgttctctccccagttttctccccatgaattctttatg 165

                               
Query: 417 atccagtatggcttctcctt 436
           | ||||||||||||||||||
Sbjct: 164 acccagtatggcttctcctt 145



to top

>gb|AY662989.1| Petunia x hybrida cysteine proteinase (CP3) mRNA, partial cds
          Length = 1041

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 70/82 (85%)
 Strand = Plus / Minus

                                                                       
Query: 357 cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
           ||||||||||||||||| || || |  || |||||| |||| ||||| || |||||||||
Sbjct: 703 cccctgcagatcttgtaatatccttgctctccccagctctctccccaagaattcttgatg 644

                                 
Query: 417 atccagtatggcttctccttga 438
           |||||||| ||||| |||||||
Sbjct: 643 atccagtaaggcttttccttga 622



to top

>emb|AJ844006.1| Plantago major partial mRNA for cysteine protease 2 (cpr2 gene)
          Length = 967

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 357 cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
           |||||||||||||||||||| ||  | || |||||| |||| ||||| || ||||| |||
Sbjct: 673 cccctgcagatcttgtagtagccgctctctccccagctctctccccatgaattctttatg 614

                         
Query: 417 atccagtatggctt 430
           ||||||||||||||
Sbjct: 613 atccagtatggctt 600



to top

>gb|AY110841.1| Zea mays CL908_1 mRNA sequence
          Length = 916

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 373 agtaccccttgtccccccagttctcgccccacgagttcttgatgatccagtat 425
           |||| ||||| || ||||| |||||||||||||||||||||| ||||||||||
Sbjct: 645 agtatcccttctcgccccacttctcgccccacgagttcttgacgatccagtat 593



to top

>gb|M95060.1|MZEORFA Zea mays putative thiol protease homolog mRNA, partial cds
          Length = 171

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 373 agtaccccttgtccccccagttctcgccccacgagttcttgatgatccagtat 425
           |||| ||||| || ||||| |||||||||||||||||||||| ||||||||||
Sbjct: 120 agtatcccttctcgccccacttctcgccccacgagttcttgacgatccagtat 68



to top

>gb|AY662991.1| Petunia x hybrida cysteine proteinase (CP5) mRNA, partial cds
          Length = 643

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 387 ccccagttctcgccccacgagttcttgatgatccagtatggcttctc 433
           ||||| ||||| ||||| ||||||||||||||||||||||| |||||
Sbjct: 479 ccccatttctctccccatgagttcttgatgatccagtatggtttctc 433



to top

>gb|DQ084023.1| Nicotiana benthamiana cysteine proteinase glycinain type mRNA,
            partial cds
          Length = 1086

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Minus

                                                                        
Query: 360  ctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatc 419
            |||||||||||||| || || |  || ||||||||||| ||||| || ||||||||||||
Sbjct: 1042 ctgcagatcttgtaatatccatgctcaccccagttctctccccaagaattcttgatgatc 983

                               
Query: 420  cagtatggcttctccttga 438
            ||||| | ||| |||||||
Sbjct: 982  cagtaagccttttccttga 964



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                               
Query: 378      cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
                |||| ||| ||||||||||  ||||||||||||||||||||||||||
Sbjct: 22050534 ccctggtcgccccagttcttcccccacgagttcttgatgatccagta 22050580



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                           
Query: 399      ccccacgagttcttgatgatccagtat 425
                ||||| |||||||||||||||||||||
Sbjct: 22144425 ccccaagagttcttgatgatccagtat 22144451



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 397      cgccccacgagttcttgatgatccagta 424
                ||||||||||||||||||  ||||||||
Sbjct: 22188632 cgccccacgagttcttgactatccagta 22188605



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 398      gccccacgagttcttgatgatccagtat 425
                ||||||||||||||| | ||||||||||
Sbjct: 22136828 gccccacgagttcttaacgatccagtat 22136855



to top

>dbj|AP005396.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0635G10
          Length = 146728

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                            
Query: 378   cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
             |||| ||| ||||||||||  ||||||||||||||||||||||||||
Sbjct: 92598 ccctggtcgccccagttcttcccccacgagttcttgatgatccagta 92644



to top

>dbj|AK108733.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-150-D05, full
           insert sequence
          Length = 904

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           |||| ||| ||||||||||  ||||||||||||||||||||||||||
Sbjct: 623 ccctggtcgccccagttcttcccccacgagttcttgatgatccagta 577



to top

>gb|BT014429.1| Lycopersicon esculentum clone 133747F, mRNA sequence
          Length = 1246

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                        
Query: 360  ctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatc 419
            |||||||| |||||||| ||  | || ||||| ||||| ||||| |||||||||||||||
Sbjct: 1059 ctgcagattttgtagtatccactttctccccatttctctccccatgagttcttgatgatc 1000

                          
Query: 420  cagtatggcttctc 433
            ||||| || |||||
Sbjct: 999  cagtacggtttctc 986



to top

>emb|Z13964.1|NTCYP8 N.tabacum mRNA for pre-pro-cysteine proteinase
          Length = 1330

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                        
Query: 357  cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
            |||||||| |||||||| || || |  || ||||||||||| ||||| || |||||||||
Sbjct: 1046 cccctgcaaatcttgtaatatccatgctctccccagttctctccccatgaattcttgatg 987

                                  
Query: 417  atccagtatggcttctccttga 438
            |||||||| | ||| |||||||
Sbjct: 986  atccagtaagccttttccttga 965



to top

>emb|Z13959.1|NTCYP7 N.tabacum mRNA for pre-pro-cysteine proteinase
          Length = 1304

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                        
Query: 357  cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
            |||||||| |||||||| || || |  || ||||||||||| ||||| || |||||||||
Sbjct: 1025 cccctgcaaatcttgtaatatccatgctctccccagttctctccccatgaattcttgatg 966

                                  
Query: 417  atccagtatggcttctccttga 438
            |||||||| | ||| |||||||
Sbjct: 965  atccagtaagccttttccttga 944



to top

>gb|AF454959.1| Brassica oleracea senescence-associated cysteine protease (CP4) mRNA,
            complete cds
          Length = 1253

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 394  tctcgccccacgagttcttgatgatccagtatggcttctccttgaa 439
            |||| |||||||||||||| || |||||||| ||||||||||||||
Sbjct: 1019 tctctccccacgagttcttaataatccagtaaggcttctccttgaa 974



to top

>gb|U68221.1|BNU68221 Brassica napus cysteine protease (LSC790) mRNA, partial cds
          Length = 255

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 394 tctcgccccacgagttcttgatgatccagtatggcttctccttgaa 439
           |||| |||||||||||||| || |||||||| ||||||||||||||
Sbjct: 187 tctctccccacgagttcttaataatccagtaaggcttctccttgaa 142



to top

>gb|AC172870.1| Brassica rapa subsp. pekinensis clone KBrH004A06, complete sequence
          Length = 145603

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                   
Query: 368   cttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatcca 421
             ||||||||| || ||||| ||||| ||||  |||||||||||||||||||||||
Sbjct: 79636 cttgtagtatccattgtctccccacttctttccccacgagttcttgatgatcca 79689



to top

>gb|L38514.1|TRBRANGB Trypanosoma rangeli (clone 3) rangelipain gene, 3' end of cds and
           5' end of cds
          Length = 1898

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 387 ccccagttctcgccccacgagttcttgatgatccagta 424
           ||||||| | ||||||||||||||||||||||||||||
Sbjct: 149 ccccagtccgcgccccacgagttcttgatgatccagta 112



to top

>gb|L38513.1|TRBRANGA Trypanosoma rangeli (clone 2) rangelipain gene, 3' end of cds and
           5' end of cds
          Length = 1905

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 387 ccccagttctcgccccacgagttcttgatgatccagta 424
           ||||||| | ||||||||||||||||||||||||||||
Sbjct: 149 ccccagtccgcgccccacgagttcttgatgatccagta 112



to top

>gb|L38512.1|TRBRANG Trypanosoma rangeli (clone 1) rangelipain gene, 3' end of cds and
           5' end of cds
          Length = 1902

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 387 ccccagttctcgccccacgagttcttgatgatccagta 424
           ||||||| | ||||||||||||||||||||||||||||
Sbjct: 149 ccccagtccgcgccccacgagttcttgatgatccagta 112



to top

>emb|Z30338.1|VSCYSPROT V.sativa mRNA for cysteine proteinase
          Length = 1371

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                        
Query: 360  ctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatc 419
            |||||||||||||| || ||||  || ||||| ||||  ||||| |||||||| ||||||
Sbjct: 1064 ctgcagatcttgtaatatccctgctctccccaattctgcccccaagagttcttaatgatc 1005

                             
Query: 420  cagtatggcttctcctt 436
            ||||| ||||| |||||
Sbjct: 1004 cagtaaggcttttcctt 988



to top

>emb|Z32795.1|GMCYSEND G.max (Fiskeby V) mRNA for cysteine endopeptidase
          Length = 1441

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 387  ccccagttctcgccccacgagttcttgatgatccagtatgg 427
            ||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 1070 ccccatttctccccccacgaattcttgatgatccagtatgg 1030



to top

>emb|X54358.1|PSCC15A P.sativum mRNA of cDNA clone 15a
          Length = 1453

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                        
Query: 360  ctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatc 419
            |||||||||||||| || ||||  || ||||| ||||  ||||| |||||||| ||||||
Sbjct: 1066 ctgcagatcttgtaatatccctgctctccccaattctgcccccaggagttcttaatgatc 1007

                             
Query: 420  cagtatggcttctcctt 436
            ||||| ||||| |||||
Sbjct: 1006 cagtaaggcttttcctt 990



to top

>gb|AC148242.14| Medicago truncatula clone mth2-18f6, complete sequence
          Length = 125077

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                         
Query: 360   ctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatc 419
             ||||| ||||||||||| || || || |||||| |||| ||||||||||| || | ||||
Sbjct: 81680 ctgcaaatcttgtagtatccgttctctccccaggtctcaccccacgagtttttaacgatc 81739

                              
Query: 420   cagtatggcttctcctt 436
             || || |||||||||||
Sbjct: 81740 caatacggcttctcctt 81756



to top

>gb|AY161277.1| Vicia faba pre-pro cysteine proteinase gene, complete cds
          Length = 3822

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                        
Query: 360  ctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatc 419
            ||||||||||||||||| ||||  || ||||| ||||  ||||| |||||||| | ||||
Sbjct: 3423 ctgcagatcttgtagtatccctgctctccccaattctgcccccaagagttcttaacgatc 3364

                             
Query: 420  cagtatggcttctcctt 436
            ||||| ||||| |||||
Sbjct: 3363 cagtaaggcttttcctt 3347



to top

>gb|AF167986.1|AF167986 Glycine max putative cysteine proteinase GmPM33 (GmPM33) mRNA,
            complete cds
          Length = 1407

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 387  ccccagttctcgccccacgagttcttgatgatccagtatgg 427
            ||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 1005 ccccatttctccccccacgaattcttgatgatccagtatgg 965



to top

>gb|U59465.1|VFU59465 Vicia faba pre-pro-cysteine proteinase (VFCYSPRO) mRNA, complete cds
          Length = 1439

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                        
Query: 360  ctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatc 419
            ||||||||||||||||| ||||  || ||||| ||||  ||||| |||||||| | ||||
Sbjct: 1040 ctgcagatcttgtagtatccctgctctccccaattctgcccccaagagttcttaacgatc 981

                             
Query: 420  cagtatggcttctcctt 436
            ||||| ||||| |||||
Sbjct: 980  cagtaaggcttttcctt 964



to top

>dbj|AP006110.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT39G11, TM0195b,
             complete sequence
          Length = 52245

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                         
Query: 360   ctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatc 419
             |||||||||||||| || || || || |||||| |||| ||||| || ||||| ||||||
Sbjct: 25944 ctgcagatcttgtaatatccattctctccccaggtctccccccatgaattctttatgatc 26003

                              
Query: 420   cagtatggcttctcctt 436
             ||||| ||||| |||||
Sbjct: 26004 cagtaaggcttttcctt 26020



to top

>gb|AY850168.1| Cloning vector pQ-CPB recombinant cysteine protease mRNA, partial
           cds
          Length = 1005

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||||||| ||||||||||||||||| | ||||||
Sbjct: 929 cccttctcgccccagttctcaccccacgagttcttgatcacccagta 883



to top

>gb|AY919606.1| Theileria orientalis cysteine protease 3 gene, complete cds
          Length = 1431

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 387  ccccagttctcgccccacgagttcttgatgatccagtat 425
            ||||||||||| ||||| ||||||||||||| |||||||
Sbjct: 1253 ccccagttctcaccccaagagttcttgatgacccagtat 1215



to top

>gb|AY919605.1| Theileria orientalis cysteine protease 1 gene, complete cds
          Length = 1431

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 387  ccccagttctcgccccacgagttcttgatgatccagtat 425
            ||||||||||| ||||| ||||||||||||| |||||||
Sbjct: 1253 ccccagttctctccccatgagttcttgatgacccagtat 1215



to top

>gb|AY912450.1| Theileria orientalis tocp1 variant tocp5 gene, partial cds
          Length = 1428

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 387  ccccagttctcgccccacgagttcttgatgatccagtat 425
            ||||||||||| ||||| ||||||||||||| |||||||
Sbjct: 1253 ccccagttctcaccccaagagttcttgatgacccagtat 1215



to top

>gb|AY912448.1| Theileria orientalis tocp1 variant tocp3 mRNA, complete cds
          Length = 1559

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 387  ccccagttctcgccccacgagttcttgatgatccagtat 425
            ||||||||||| ||||| ||||||||||||| |||||||
Sbjct: 1320 ccccagttctcaccccaagagttcttgatgacccagtat 1282



to top

>dbj|AB159780.1| Theileria orientalis ToCP 1 mRNA for cysteine protease 1, complete
            cds
          Length = 1547

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 387  ccccagttctcgccccacgagttcttgatgatccagtat 425
            ||||||||||| ||||| ||||||||||||| |||||||
Sbjct: 1311 ccccagttctctccccatgagttcttgatgacccagtat 1273



to top

>ref|XM_312033.2| Anopheles gambiae str. PEST ENSANGP00000022503
           (ENSANGG00000016224), partial mRNA
          Length = 880

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 398 gccccacgagttcttgatgatccagta 424
           |||||||||||||||||||||||||||
Sbjct: 732 gccccacgagttcttgatgatccagta 706



to top

>ref|XM_312034.2| Anopheles gambiae str. PEST ENSANGP00000018713 (ENSANGG00000016224),
            partial mRNA
          Length = 1636

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                       
Query: 398  gccccacgagttcttgatgatccagta 424
            |||||||||||||||||||||||||||
Sbjct: 1488 gccccacgagttcttgatgatccagta 1462



to top

>ref|NM_117715.2| Arabidopsis thaliana cysteine-type endopeptidase/ cysteine-type
            peptidase AT4G16190 mRNA, complete cds
          Length = 1395

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 399  ccccacgagttcttgatgatccagtatggcttctcctt 436
            ||||||||||||||||| ||||| || |||||||||||
Sbjct: 1055 ccccacgagttcttgataatccaataaggcttctcctt 1018



to top

>ref|NM_187324.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1415

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 399  ccccacgagttcttgatgatccagta 424
            ||||||||||||||||||||||||||
Sbjct: 1044 ccccacgagttcttgatgatccagta 1019



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 314  ggagaccatggagtcgacgccgca 337
            ||||||||||| ||||||||||||
Sbjct: 1120 ggagaccatggtgtcgacgccgca 1097



to top

>ref|XM_476390.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1059

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 399 ccccacgagttcttgatgatccagta 424
           ||||||||||||||||||||||||||
Sbjct: 953 ccccacgagttcttgatgatccagta 928



to top

>gb|BT018299.1| Zea mays clone EL01T0206B09.c mRNA sequence
          Length = 1209

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 399 ccccacgagttcttgatgatccagta 424
           ||||||||||||||||||||||||||
Sbjct: 890 ccccacgagttcttgatgatccagta 865



to top

>gb|AC145324.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0026D03 map near S2137, complete sequence
          Length = 115141

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                           
Query: 395   ctcgccccacgagttcttgatgatccagta 424
             |||||||||||||||||||| |||||||||
Sbjct: 34065 ctcgccccacgagttcttgacgatccagta 34036



to top

>gb|BT000733.1| Arabidopsis thaliana clone RAFL08-11-G18 (R11350) putative cysteine
            proteinase (At4g16190) mRNA, complete cds
          Length = 1398

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 399  ccccacgagttcttgatgatccagtatggcttctcctt 436
            ||||||||||||||||| ||||| || |||||||||||
Sbjct: 1047 ccccacgagttcttgataatccaataaggcttctcctt 1010



to top

>emb|Z97340.2|ATFCA5 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 5
          Length = 209164

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 399    ccccacgagttcttgatgatccagtatggcttctcctt 436
              ||||||||||||||||| ||||| || |||||||||||
Sbjct: 139423 ccccacgagttcttgataatccaataaggcttctcctt 139386



to top

>emb|X80876.1|OSCYSPRO O.sativa mRNA for cysteine protease
          Length = 1440

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                          
Query: 395  ctcgccccacgagttcttgatgatccagta 424
            |||||||||||||||||||| |||||||||
Sbjct: 1077 ctcgccccacgagttcttgacgatccagta 1048



to top

>emb|AL161543.2|ATCHRIV43 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 43
          Length = 198226

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 399    ccccacgagttcttgatgatccagtatggcttctcctt 436
              ||||||||||||||||| ||||| || |||||||||||
Sbjct: 108413 ccccacgagttcttgataatccaataaggcttctcctt 108376



to top

>emb|AJ512653.1|LGU512653 Leishmania guyanensis partial cpb gene for cysteine proteinase b
          Length = 522

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 387 ccccagttctcgccccacgagttcttgatgatccagta 424
           ||||||||||| ||||||||||||||||| | ||||||
Sbjct: 518 ccccagttctcaccccacgagttcttgatcagccagta 481



to top

>emb|AJ242994.1|NTA242994 Nicotiana tabacum mRNA for putative preprocysteine proteinase
          Length = 1431

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                        
Query: 357  cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
            |||||||| |||||||| || || |  || |||||||| || ||||| || |||||||||
Sbjct: 1099 cccctgcaaatcttgtaatatccatgctctccccagttttctccccaagaattcttgatg 1040

                                  
Query: 417  atccagtatggcttctccttga 438
            |||||||| | ||| |||||||
Sbjct: 1039 atccagtaagccttttccttga 1018



to top

>gb|AY136316.1| Arabidopsis thaliana cysteine proteinase (At4g16190) mRNA, complete
            cds
          Length = 1389

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 399  ccccacgagttcttgatgatccagtatggcttctcctt 436
            ||||||||||||||||| ||||| || |||||||||||
Sbjct: 1054 ccccacgagttcttgataatccaataaggcttctcctt 1017



to top

>gb|AY129473.1| Arabidopsis thaliana AT4g16190/dl4135w mRNA, complete cds
          Length = 1122

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 399  ccccacgagttcttgatgatccagtatggcttctcctt 436
            ||||||||||||||||| ||||| || |||||||||||
Sbjct: 1010 ccccacgagttcttgataatccaataaggcttctcctt 973



to top

>gb|AY039556.1| Arabidopsis thaliana AT4g16190/dl4135w mRNA, complete cds
          Length = 1291

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 399  ccccacgagttcttgatgatccagtatggcttctcctt 436
            ||||||||||||||||| ||||| || |||||||||||
Sbjct: 1054 ccccacgagttcttgataatccaataaggcttctcctt 1017



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                             
Query: 395     ctcgccccacgagttcttgatgatccagta 424
               |||||||||||||||||||| |||||||||
Sbjct: 8298335 ctcgccccacgagttcttgacgatccagta 8298364



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                          
Query: 399      ccccacgagttcttgatgatccagta 424
                ||||||||||||||||||||||||||
Sbjct: 17444052 ccccacgagttcttgatgatccagta 17444027



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 399    ccccacgagttcttgatgatccagta 424
              ||||||||||||||||||||||||||
Sbjct: 464235 ccccacgagttcttgatgatccagta 464210



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 314      ggagaccatggagtcgacgccgca 337
                ||||||||||| ||||||||||||
Sbjct: 17444128 ggagaccatggtgtcgacgccgca 17444105



to top

>emb|BX828277.1|CNS0A2YD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH70ZD04 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1323

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 399  ccccacgagttcttgatgatccagtatggcttctcctt 436
            ||||||||||||||||| ||||| || |||||||||||
Sbjct: 1028 ccccacgagttcttgataatccaataaggcttctcctt 991



to top

>emb|BX827724.1|CNS0A2XO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH14ZG05 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1287

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 399  ccccacgagttcttgatgatccagtatggcttctcctt 436
            ||||||||||||||||| ||||| || |||||||||||
Sbjct: 1038 ccccacgagttcttgataatccaataaggcttctcctt 1001



to top

>gb|AY017414.1| Nicotiana tabacum CPR2-like cysteine proteinase gene, complete cds
          Length = 2107

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                        
Query: 357  cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
            |||||||| |||||||| || || |  || |||||||| || ||||| || |||||||||
Sbjct: 2021 cccctgcaaatcttgtaatatccatgctctccccagttttctccccaagaattcttgatg 1962

                                  
Query: 417  atccagtatggcttctccttga 438
            |||||||| | ||| |||||||
Sbjct: 1961 atccagtaagccttttccttga 1940



to top

>dbj|AP004299.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0434A03
          Length = 146505

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 399    ccccacgagttcttgatgatccagta 424
              ||||||||||||||||||||||||||
Sbjct: 112276 ccccacgagttcttgatgatccagta 112251



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 314    ggagaccatggagtcgacgccgca 337
              ||||||||||| ||||||||||||
Sbjct: 112352 ggagaccatggtgtcgacgccgca 112329



to top

>dbj|AP004342.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0585H11
          Length = 149371

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 399   ccccacgagttcttgatgatccagta 424
             ||||||||||||||||||||||||||
Sbjct: 66399 ccccacgagttcttgatgatccagta 66374



to top

>dbj|AK071495.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023099K03, full
            insert sequence
          Length = 1511

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                          
Query: 395  ctcgccccacgagttcttgatgatccagta 424
            |||||||||||||||||||| |||||||||
Sbjct: 1083 ctcgccccacgagttcttgacgatccagta 1054



to top

>dbj|AK063422.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-115-C06, full
            insert sequence
          Length = 1415

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 399  ccccacgagttcttgatgatccagta 424
            ||||||||||||||||||||||||||
Sbjct: 1044 ccccacgagttcttgatgatccagta 1019



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 314  ggagaccatggagtcgacgccgca 337
            ||||||||||| ||||||||||||
Sbjct: 1120 ggagaccatggtgtcgacgccgca 1097



to top

>dbj|AP003759.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1567_G09
          Length = 121388

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 399   ccccacgagttcttgatgatccagta 424
             ||||||||||||||||||||||||||
Sbjct: 18147 ccccacgagttcttgatgatccagta 18122



to top

>dbj|AB090880.1| Aster tripolium mRNA for thiol protease, complete cds
          Length = 910

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 399 ccccacgagttcttgatgatccagtatggcttctcctt 436
           ||||| |||||||| |||||||| ||||||||||||||
Sbjct: 601 ccccatgagttctttatgatccaatatggcttctcctt 564



to top

>dbj|AB004648.1| Oryza sativa (japonica cultivar-group) RepA gene for cysteine
            endopeptidase, complete cds
          Length = 3836

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                          
Query: 395  ctcgccccacgagttcttgatgatccagta 424
            |||||||||||||||||||| |||||||||
Sbjct: 2599 ctcgccccacgagttcttgacgatccagta 2570



to top

>gb|U32430.1|TAU32430 Triticum aestivum thiol protease mRNA, complete cds
          Length = 1353

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 387  ccccagttctcgccccacgagttcttgatgatccagta 424
            ||||| |||||||||||||||||||||  |||||||||
Sbjct: 1052 ccccacttctcgccccacgagttcttggcgatccagta 1015



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                             
Query: 395     ctcgccccacgagttcttgatgatccagta 424
               |||||||||||||||||||| |||||||||
Sbjct: 8369098 ctcgccccacgagttcttgacgatccagta 8369127



to top

>emb|Z99955.1|PVZ99955 Phaseolus vulgaris Moldavian encoding cysteine proteinase precursor
            (clone cp4)
          Length = 1286

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 399  ccccacgagttcttgatgatccagtatgg 427
            |||||||| ||||||||||||||||||||
Sbjct: 1019 ccccacgaattcttgatgatccagtatgg 991



to top

>emb|AJ580823.1|LCO580823 Lotus corniculatus var. japonicus ORF1, ORF2, ORF3 and genes for
             vacuolar proton-ATPase subunit-like protein, papain-like
             cysteine proteinase-like protein 1 and papain-like
             cysteine proteinase-like protein 2
          Length = 46563

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 61/73 (83%)
 Strand = Plus / Plus

                                                                         
Query: 360   ctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatc 419
             ||||| ||||||||||| || || || ||||| ||||| ||||| || || ||||| |||
Sbjct: 22606 ctgcaaatcttgtagtatccattttctccccaattctctccccaggaatttttgattatc 22665

                          
Query: 420   cagtatggcttct 432
             || ||||||||||
Sbjct: 22666 caatatggcttct 22678



to top

>dbj|AP005666.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT09E01, TM0258b,
             complete sequence
          Length = 46491

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 61/73 (83%)
 Strand = Plus / Plus

                                                                         
Query: 360   ctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatc 419
             ||||| ||||||||||| || || || ||||| ||||| ||||| || || ||||| |||
Sbjct: 22683 ctgcaaatcttgtagtatccattttctccccaattctctccccaggaatttttgattatc 22742

                          
Query: 420   cagtatggcttct 432
             || ||||||||||
Sbjct: 22743 caatatggcttct 22755



to top

>dbj|AB092808.1| Lotus japonicus gene for hypothetical proteins, complete and partial
            cds, clone:BAC259.12D-1
          Length = 32644

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 61/73 (83%)
 Strand = Plus / Plus

                                                                        
Query: 360  ctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatc 419
            ||||| ||||||||||| || || || ||||| ||||| ||||| || || ||||| |||
Sbjct: 9781 ctgcaaatcttgtagtatccattttctccccaattctctccccaggaatttttgattatc 9840

                         
Query: 420  cagtatggcttct 432
            || ||||||||||
Sbjct: 9841 caatatggcttct 9853



to top

>ref|XM_467463.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1101

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 387 ccccagttctcgccccacgagttcttgatgat 418
           |||||||||| ||||||||||||||| |||||
Sbjct: 989 ccccagttcttgccccacgagttcttcatgat 958



to top

>gb|DQ079995.1| Drosophila simulans male accessory gland protein (CG4847) mRNA,
            partial cds
          Length = 1086

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 373  agtaccccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
            |||| ||||| || |||||| | ||| ||||||||||||||| |||||||||
Sbjct: 1024 agtagcccttttcgccccaggtgtcgtcccacgagttcttgacgatccagta 973



to top

>ref|XM_813485.1| Trypanosoma cruzi strain CL Brener cysteine peptidase
           (Tc00.1047053507603.260) partial mRNA
          Length = 1404

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||||||||||||||||||
Sbjct: 918 ccacgagttcttgatgatccagta 895



to top

>ref|XM_813486.1| Trypanosoma cruzi strain CL Brener cruzipain precursor
           (Tc00.1047053507603.270) partial mRNA
          Length = 1404

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||||||||||||||||||
Sbjct: 918 ccacgagttcttgatgatccagta 895



to top

>ref|XM_800858.1| Trypanosoma cruzi strain CL Brener cysteine peptidase
           (Tc00.1047053507537.20) partial mRNA
          Length = 1281

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||||||||||||||||||
Sbjct: 918 ccacgagttcttgatgatccagta 895



to top

>ref|XM_815081.1| Trypanosoma cruzi strain CL Brener cysteine peptidase
           (Tc00.1047053509429.320) partial mRNA
          Length = 1404

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||||||||||||||||||
Sbjct: 918 ccacgagttcttgatgatccagta 895



to top

>ref|XM_799143.1| Trypanosoma cruzi strain CL Brener cruzipain precursor
           (Tc00.1047053507297.10) partial mRNA
          Length = 745

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||||||||||||||||||
Sbjct: 469 ccacgagttcttgatgatccagta 446



to top

>emb|Z97023.1|HVZ97023 Hordeum vulgare mRNA encoding cysteine endopeptidase EP-A
          Length = 1299

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 378  cccttgtccccccagttctcgccccacgagttcttgatgatccagtat 425
            ||||| || ||||||| ||| |||||||||||||| | ||||||||||
Sbjct: 1007 cccttctcaccccagtcctctccccacgagttcttcacgatccagtat 960



to top

>emb|Z97022.1|HVZ97022 Hordeum vulgare gene encoding cysteine proteinase
          Length = 5593

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 397  cgccccacgagttcttgatgatccagta 424
            |||||||||||||||| |||||||||||
Sbjct: 4814 cgccccacgagttcttcatgatccagta 4787



to top

>emb|Z97021.1|HVZ97021 Hordeum vulgare gene encoding cysteine endopeptidase EP-A
          Length = 2752

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 378  cccttgtccccccagttctcgccccacgagttcttgatgatccagtat 425
            ||||| || ||||||| ||| |||||||||||||| | ||||||||||
Sbjct: 2384 cccttctcaccccagtcctctccccacgagttcttcacgatccagtat 2337



to top

>emb|X05167.1|HVLEU Barley gene for thiol protease aleurain
          Length = 5372

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 366  atcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatga 417
            |||||| |||| || ||||| |||||||   |||||||||||||||||||||
Sbjct: 4876 atcttgaagtaaccattgtcaccccagtcggcgccccacgagttcttgatga 4825



to top

>gb|AF314929.1|AF314929 Trypanosoma cruzi strain Y cruzipain gene, complete cds
          Length = 1404

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||||||||||||||||||
Sbjct: 918 ccacgagttcttgatgatccagta 895



to top

>gb|AY112673.1| Trypanosoma cruzi repeated HaeIII genomic fragment IGRE F510
          Length = 600

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||||||||||||||||||
Sbjct: 342 ccacgagttcttgatgatccagta 319



to top

>gb|AF265226.1|AF265226 Trypanosoma cruzi strain TUL cruzipain gene, complete cds
          Length = 1404

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||||||||||||||||||
Sbjct: 918 ccacgagttcttgatgatccagta 895



to top

>dbj|AP004047.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1191_G08
          Length = 172832

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 387   ccccagttctcgccccacgagttcttgatgat 418
             |||||||||| ||||||||||||||| |||||
Sbjct: 56782 ccccagttcttgccccacgagttcttcatgat 56751



to top

>dbj|AK104296.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-H03, full
           insert sequence
          Length = 1251

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 387 ccccagttctcgccccacgagttcttgatgat 418
           |||||||||| ||||||||||||||| |||||
Sbjct: 989 ccccagttcttgccccacgagttcttcatgat 958



to top

>dbj|AK060534.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-021-A12, full
           insert sequence
          Length = 1251

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 387 ccccagttctcgccccacgagttcttgatgat 418
           |||||||||| ||||||||||||||| |||||
Sbjct: 989 ccccagttcttgccccacgagttcttcatgat 958



to top

>gb|U94591.1|HVU94591 Hordeum vulgare cysteine proteinase precursor, mRNA, complete cds
          Length = 1328

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 378  cccttgtccccccagttctcgccccacgagttcttgatgatccagtat 425
            ||||| || ||||||| ||| |||||||||||||| | ||||||||||
Sbjct: 1015 cccttctcaccccagtcctctccccacgagttcttcacgatccagtat 968



to top

>gb|M90067.1|TRBCYSPRNS Trypanosoma cruzi cysteine proteinase gene, partial cds
          Length = 2401

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 401  ccacgagttcttgatgatccagta 424
            ||||||||||||||||||||||||
Sbjct: 1799 ccacgagttcttgatgatccagta 1776



to top

>gb|AF004594.1|AF004594 Trypanosoma cruzi cysteine protease (cp) gene, complete cds
          Length = 1677

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||||||||||||||||||
Sbjct: 969 ccacgagttcttgatgatccagta 946



to top

>emb|X54414.1|TCCRUZIP T. cruzi mRNA for cysteine proteinase (cruzipain)
          Length = 767

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||||||||||||||||||
Sbjct: 36  ccacgagttcttgatgatccagta 13



to top

>gb|M69121.1|TRBTUL2TAN Trypanosoma cruzi tandem cysteine proteinase genes, C-terminal and
           N-terminal cds
          Length = 1845

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||||||||||||||||||
Sbjct: 264 ccacgagttcttgatgatccagta 241



to top

>gb|M84342.1|TRBCYSPROA Trypanosoma cruzi cruzain protein gene, complete cds
          Length = 1845

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||||||||||||||||||
Sbjct: 918 ccacgagttcttgatgatccagta 895



to top

>gb|M27305.1|TRBCYPAA Trypanosoma cruzi cysteine protease gene, partial cds
          Length = 495

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||||||||||||||||||
Sbjct: 495 ccacgagttcttgatgatccagta 472



to top

>ref|NM_127715.2| Arabidopsis thaliana cysteine-type endopeptidase/ cysteine-type
            peptidase AT2G21430 mRNA, complete cds
          Length = 1177

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 399  ccccacgagttcttgatgatcca 421
            |||||||||||||||||||||||
Sbjct: 1004 ccccacgagttcttgatgatcca 982



to top

>ref|XM_463580.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1116

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 398 gccccacgagttcttgatgatccagta 424
           ||||||||||||||||| |||||||||
Sbjct: 960 gccccacgagttcttgacgatccagta 934



to top

>gb|BT014316.1| Lycopersicon esculentum clone 133569F, mRNA sequence
          Length = 1354

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 399  ccccacgagttcttgatgatccagtatggct 429
            |||||||||||||| |||||||| |||||||
Sbjct: 1071 ccccacgagttctttatgatccaatatggct 1041



to top

>ref|XM_797951.1| Trypanosoma cruzi strain CL Brener cysteine peptidase
           (Tc00.1047053509401.30) partial mRNA
          Length = 1404

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 401 ccacgagttcttgatgatccagt 423
           |||||||||||||||||||||||
Sbjct: 918 ccacgagttcttgatgatccagt 896



to top

>ref|XM_800491.1| Trypanosoma cruzi strain CL Brener cysteine peptidase
           (Tc00.1047053508595.50) partial mRNA
          Length = 548

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 401 ccacgagttcttgatgatccagt 423
           |||||||||||||||||||||||
Sbjct: 62  ccacgagttcttgatgatccagt 40



to top

>emb|AJ879460.1| Leishmania donovani infantum partial cpbE gene for Cysteine
           proteinase type B, strain MHOM/FR/1996/LEM3249
          Length = 192

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 57  cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 11



to top

>emb|AJ879459.1| Leishmania donovani donovani partial cpbF gene for Cysteine
           proteinase type B, strain MHOM/IN/1996/THAK35(LEM3178)
          Length = 192

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 57  cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 11



to top

>emb|AJ879458.1| Leishmania donovani infantum partial cpbE gene for cysteine
           proteinase type B, strain MHOM/FR/1978/LEM75
          Length = 192

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 57  cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 11



to top

>emb|AJ879457.1| Leishmania donovani archibaldi partial cpbA gene for cysteine
           proteinase type B, strain MHOM/ET/1972/GEBRE 1
          Length = 354

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 57  cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 11



to top

>emb|AJ879456.1| Leishmania donovani infantum partial cpbA gene for cysteine
           proteinase type B, strain MHOM/IN/1996/THAK35(LEM3178)
          Length = 354

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 57  cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 11



to top

>emb|AJ879455.1| Leishmania donovani infantum partial cpbA gene for cysteine
           proteinase type B, strain MHOM/FR/1978/LEM75
          Length = 354

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 57  cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 11



to top

>emb|X74359.1|ATTHIPRO A.thaliana mRNA for putative thiol protease
          Length = 1060

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 399 ccccacgagttcttgatgatcca 421
           |||||||||||||||||||||||
Sbjct: 842 ccccacgagttcttgatgatcca 820



to top

>emb|AJ628943.1| Leishmania infantum cpb gene for cathepsin L-like cysteine
           proteinase and partial ORF
          Length = 6462

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 914 cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 868



to top

>emb|AJ628942.1| Leishmania infantum hd gene for histone deacetylase and cpb1 gene for
             cysteine proteinase
          Length = 12482

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                            
Query: 378   cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
             ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 12103 cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 12057



to top

>emb|AJ420286.1|LIN420286 Leishmania infantum cpb gene for cysteine proteinase
          Length = 2767

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 378  cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
            ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 1309 cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 1263



to top

>dbj|AP003380.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0497A05
          Length = 130919

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 398   gccccacgagttcttgatgatccagta 424
             ||||||||||||||||| |||||||||
Sbjct: 50139 gccccacgagttcttgacgatccagta 50113



to top

>gb|AC006841.7| Arabidopsis thaliana chromosome 2 clone F3K23 map mi148, complete
             sequence
          Length = 125045

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 399   ccccacgagttcttgatgatcca 421
             |||||||||||||||||||||||
Sbjct: 69103 ccccacgagttcttgatgatcca 69125



to top

>gb|AF309626.1|AF309626 Leishmania donovani clone Ld-A cysteine protease gene, complete cds
          Length = 1332

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 953 cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 907



to top

>gb|AF004592.2|AF004592 Leishmania donovani chagasi amastigote-specific cysteine protease
            (ldccys1) mRNA, complete cds
          Length = 2498

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 378  cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
            ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 1301 cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 1255



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 398      gccccacgagttcttgatgatccagta 424
                ||||||||||||||||| |||||||||
Sbjct: 39495697 gccccacgagttcttgacgatccagta 39495671



to top

>gb|AF217087.1|AF217087 Leishmania chagasi cathepsin L-like cysteine protease gene,
           complete cds
          Length = 1146

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 914 cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 868



to top

>gb|AY089044.1| Arabidopsis thaliana clone 21453 mRNA, complete sequence
          Length = 1159

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 399  ccccacgagttcttgatgatcca 421
            |||||||||||||||||||||||
Sbjct: 1005 ccccacgagttcttgatgatcca 983



to top

>dbj|AP006531.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1417F08
          Length = 155536

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 398   gccccacgagttcttgatgatccagta 424
             ||||||||||||||||| |||||||||
Sbjct: 70711 gccccacgagttcttgacgatccagta 70685



to top

>dbj|AP006170.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OSJNBa0042B15
          Length = 157981

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 399   ccccacgagttcttgatgatccagtat 425
             ||||| |||||||||||||||||||||
Sbjct: 65918 ccccaagagttcttgatgatccagtat 65944



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 397    cgccccacgagttcttgatgatccagta 424
              ||||||||||||||||||  ||||||||
Sbjct: 110125 cgccccacgagttcttgactatccagta 110098



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 398   gccccacgagttcttgatgatccagtat 425
             ||||||||||||||| | ||||||||||
Sbjct: 58321 gccccacgagttcttaacgatccagtat 58348



to top

>dbj|AK175856.1| Arabidopsis thaliana mRNA for putative cysteine proteinase, complete
            cds, clone: RAFL22-47-O11
          Length = 1220

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 399  ccccacgagttcttgatgatcca 421
            |||||||||||||||||||||||
Sbjct: 1024 ccccacgagttcttgatgatcca 1002



to top

>gb|AF099203.1|AF099203 Oryza sativa cysteine endopeptidase precursor (EP3A) gene, complete
            cds
          Length = 2588

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 398  gccccacgagttcttgatgatccagta 424
            ||||||||||||||||| |||||||||
Sbjct: 1924 gccccacgagttcttgacgatccagta 1898



to top

>gb|AY109437.1| Zea mays CL903_-1 mRNA sequence
          Length = 1664

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 398  gccccacgagttcttgatgatccagta 424
            ||||||||||||||||| |||||||||
Sbjct: 1051 gccccacgagttcttgacgatccagta 1025



to top

>gb|AY896791.1| Leishmania infantum strain MHOM/PA/78/WR285 cathepsin L-like
           cysteine protease (cpbE) gene, partial cds
          Length = 607

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 491 cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 445



to top

>gb|AY896788.1| Leishmania donovani strain IMAR/KE/62/LRC-L57 cathepsin L-like
           cysteine protease (cpbF) gene, partial cds
          Length = 639

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 543 cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 497



to top

>gb|AY896787.1| Leishmania donovani strain MHOM/CN/00/WangJie1 cathepsin L-like
           cysteine protease (cpbF) gene, partial cds
          Length = 676

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 478 cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 432



to top

>gb|AY896786.1| Leishmania donovani strain MHOM/KE/67/MRC(L)3 cathepsin L-like
           cysteine protease (cpbF) gene, partial cds
          Length = 741

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 543 cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 497



to top

>gb|AY896785.1| Leishmania donovani strain MHOM/ET/00/HUSSEN cathepsin L-like
           cysteine protease (cpbF) gene, partial cds
          Length = 741

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 543 cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 497



to top

>gb|AY896784.1| Leishmania donovani strain MHOM/SD/82/GILANI cathepsin L-like
           cysteine protease (cpbF) gene, partial cds
          Length = 741

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 543 cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 497



to top

>gb|AY896783.1| Leishmania donovani strain MHOM/ET/67/HU3 cathepsin L-like cysteine
           protease (cpbF) gene, partial cds
          Length = 741

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 543 cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 497



to top

>gb|AY896782.1| Leishmania infantum strain MHOM/MA/67/ITMAP263 cathepsin L-like
           cysteine protease (cpbE) gene, partial cds
          Length = 702

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 504 cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 458



to top

>gb|AY896781.1| Leishmania infantum strain MHOM/FR/78/LEM75 cathepsin L-like
           cysteine protease (cpbE) gene, partial cds
          Length = 702

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 504 cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 458



to top

>gb|AY896780.1| Leishmania infantum strain MHOM/FR/85/LEM663 cathepsin L-like
           cysteine protease (cpbE) gene, partial cds
          Length = 702

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 504 cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 458



to top

>gb|AY896779.1| Leishmania infantum strain MHOM/FR/82/LEM356 cathepsin L-like
           cysteine protease (cpbE) gene, partial cds
          Length = 702

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 504 cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 458



to top

>gb|AY896778.1| Leishmania infantum strain MHOM/ES/81/BCN1 cathepsin L-like
           cysteine protease (cpbE) gene, partial cds
          Length = 702

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 504 cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 458



to top

>gb|AY896777.1| Leishmania infantum strain MHOM/FR/85/LEM716 cathepsin L-like
           cysteine protease (cpbE) gene, partial cds
          Length = 702

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 504 cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 458



to top

>gb|AY896776.1| Leishmania infantum strain MHOM/FR/87/LEM1098 cathepsin L-like
           cysteine protease (cpbE) gene, partial cds
          Length = 702

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 504 cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 458



to top

>gb|AF006198.1|AF006198 Giardia muris cysteine protease (GMCP1) mRNA, complete cds
          Length = 906

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 398 gccccacgagttcttgatgatccagta 424
           ||||||||||||| |||||||||||||
Sbjct: 810 gccccacgagttcctgatgatccagta 784



to top

>gb|U43706.1|LMU43706 Leishmania major cathepsin L-like protease mRNA, complete cds
          Length = 1332

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 378 cccttgtccccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| || ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 953 cccttctcgccccagtcctcaccccacgagttcttgatcacccagta 907



to top

>dbj|D76415.1| Rice seedling mRNA for cysteine proteinase, complete cds
          Length = 1429

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 398 gccccacgagttcttgatgatccagta 424
           ||||||||||||||||| |||||||||
Sbjct: 970 gccccacgagttcttgacgatccagta 944



to top

>dbj|AB004819.1| Oryza sativa Rep1 gene for cysteine endopeptidase, complete cds
          Length = 2544

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 398  gccccacgagttcttgatgatccagta 424
            ||||||||||||||||| |||||||||
Sbjct: 1886 gccccacgagttcttgacgatccagta 1860



to top

>gb|AY728269.1| Paragonimus westermani westerpain-1 gene, complete cds
          Length = 2097

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 407  gttcttgatgatccagtatggc 428
            ||||||||||||||||||||||
Sbjct: 1676 gttcttgatgatccagtatggc 1655



to top

>gb|AC106834.9| Mus musculus chromosome 19, clone RP24-132H7, complete sequence
          Length = 177277

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 249   gatcagatcagaacagatcaga 270
             ||||||||||||||||||||||
Sbjct: 89644 gatcagatcagaacagatcaga 89623



to top

>gb|AY253445.1| Triticum aestivum P9346A1-2-5-1 putative thiol protease mRNA,
           partial cds
          Length = 560

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 387 ccccagttctcgccccacgagttcttgatgatccagta 424
           ||||| |||||||||||||||||| ||  |||||||||
Sbjct: 429 ccccacttctcgccccacgagttcctggcgatccagta 392



to top

>gb|AC103947.20| Mus musculus chromosome 19, clone RP23-261A21, complete sequence
          Length = 245390

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 249  gatcagatcagaacagatcaga 270
            ||||||||||||||||||||||
Sbjct: 2117 gatcagatcagaacagatcaga 2096



to top

>emb|Z14028.1|LECYSPRO L.esculentum mRNA encoding pre-pro-cysteine proteinase
          Length = 1295

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                        
Query: 357  cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
            ||||||||||||||||| || || |  || |||||  |||  ||||| || |||||||||
Sbjct: 1013 cccctgcagatcttgtaatatccgtgttctccccaagtctttccccaagaattcttgatg 954

                          
Query: 417  atccagtatggctt 430
            |||||||| |||||
Sbjct: 953  atccagtaaggctt 940



to top

>emb|AJ512654.1|LMA512654 Leishmania major partial cpb gene for cysteine proteinase b
          Length = 522

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 387 ccccagttctcgccccacgagttcttgatgatccagta 424
           ||||||| ||| ||||||||||||||||| | ||||||
Sbjct: 518 ccccagtcctcaccccacgagttcttgatcacccagta 481



to top

>emb|AJ245868.1|MSA245868 Medicago sativa mRNA for cysteine protease, partial (cyp15a gene)
          Length = 890

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 387 ccccagttctcgccccacgagttcttgatgatccagtatggcttctcctt 436
           ||||| |||| |||||| || ||||| ||||||||||| ||||| |||||
Sbjct: 542 ccccaattctggccccatgaattctttatgatccagtaaggcttttcctt 493



to top

>ref|NM_137062.2| Drosophila melanogaster CG6347-RA (CG6347), mRNA
          Length = 1311

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 403  acgagttcttgatgatccagta 424
            ||||||||||||||||||||||
Sbjct: 1067 acgagttcttgatgatccagta 1046



to top

>gb|AC099008.1| Drosophila melanogaster, chromosome 2R, region 50B-50C, BAC clone
              BACR16G12, complete sequence
          Length = 154681

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 403    acgagttcttgatgatccagta 424
              ||||||||||||||||||||||
Sbjct: 108467 acgagttcttgatgatccagta 108488



to top

>gb|AY069609.1| Drosophila melanogaster LD36817 full insert cDNA
          Length = 1318

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 403  acgagttcttgatgatccagta 424
            ||||||||||||||||||||||
Sbjct: 1056 acgagttcttgatgatccagta 1035



to top

>gb|AY144442.1| Sorghum bicolor BAC 95A23/98N8.1 Rph region, partial sequence
          Length = 268433

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 399    ccccacgagttcttgatgatccagta 424
              |||||||||||||||| |||||||||
Sbjct: 152882 ccccacgagttcttgacgatccagta 152857



to top

>dbj|AB091669.1| Pandalus borealis PbCys mRNA for crustapain, complete cds
          Length = 1242

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 399 ccccacgagttcttgatgatccagta 424
           |||||||||||||||| |||||||||
Sbjct: 890 ccccacgagttcttgacgatccagta 865



to top

>gb|AF217446.1|AF217446 Babesia equi cysteine protease Cys2 mRNA, partial cds
          Length = 657

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 399 ccccacgagttcttgatgatccagta 424
           ||||| ||||||||||||||||||||
Sbjct: 467 ccccaagagttcttgatgatccagta 442



to top

>gb|AF139913.1|AF139913 Trypanosoma congolense cysteine protease gene, partial cds
          Length = 1321

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 398 gccccacgagttcttgatgatccagtatgg 427
           |||||| ||||||||||| |||||||||||
Sbjct: 930 gccccatgagttcttgataatccagtatgg 901



to top

>gb|AC005977.3|AC005977 Drosophila melanogaster, chromosome 2R, region 50C6-50C8, P1 clone
             DS04160, complete sequence
          Length = 69330

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 403   acgagttcttgatgatccagta 424
             ||||||||||||||||||||||
Sbjct: 67688 acgagttcttgatgatccagta 67709



to top

>gb|AE003817.3| Drosophila melanogaster chromosome 2R, section 33 of 73 of the complete
              sequence
          Length = 265472

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 403    acgagttcttgatgatccagta 424
              ||||||||||||||||||||||
Sbjct: 245754 acgagttcttgatgatccagta 245733



to top

>gb|U93166.1|PAU93166 Prunus armeniaca cysteine protease mRNA, complete cds
          Length = 1444

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 381  ttgtccccccagttctcgccccacgagttcttgatgatccag 422
            ||||| |||||| |||| ||||| ||||||||||||| ||||
Sbjct: 1082 ttgtcaccccagctctctccccaagagttcttgatgagccag 1041



to top

>gb|U71380.1|GMU71380 Glycine max thiol protease isoform A mRNA, partial cds
          Length = 1221

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 387 ccccagttctcgccccacgagttcttgatgatccagta 424
           |||||| |||||||||| || ||||| |||||||||||
Sbjct: 857 ccccagctctcgccccatgaattcttaatgatccagta 820



to top

>gb|U71379.1|GMU71379 Glycine max thiol protease isoform B mRNA, partial cds
          Length = 1073

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 387 ccccagttctcgccccacgagttcttgatgatccagta 424
           |||||| |||||||||| || ||||| |||||||||||
Sbjct: 864 ccccagctctcgccccatgaattcttaatgatccagta 827



to top

>gb|AY728270.1| Paragonimus westermani westerpain-10 gene, complete cds
          Length = 2456

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 408  ttcttgatgatccagtatggc 428
            |||||||||||||||||||||
Sbjct: 2031 ttcttgatgatccagtatggc 2011



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 248     cgatcagatcagaacagatcagaca 272
               ||||||||||||| |||||||||||
Sbjct: 9225773 cgatcagatcagaccagatcagaca 9225797



to top

>gb|AY974330.1| Saprolegnia parasitica SPM9F1 cysteine protease mRNA, complete cds
          Length = 1633

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 378 cccttgtccccccagttctcgccccacgagttcttga 414
           |||||||| |||||||   ||||||||||||||||||
Sbjct: 926 cccttgtcgccccagtcggcgccccacgagttcttga 890



to top

>emb|AL157413.18| Human DNA sequence from clone RP11-526K17 on chromosome 20 Contains
           a novel gene and part of the C20orf39 gene for
           chromosome 20 open reading frame 39, complete sequence
          Length = 133207

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 23  gacagaattattcagaagttc 43
           |||||||||||||||||||||
Sbjct: 631 gacagaattattcagaagttc 651



to top

>emb|AJ009878.1|CAR9878 Cicer arietinum mRNA for cysteine proteinase
          Length = 1377

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                        
Query: 360  ctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatc 419
            |||||||||||||| || || |  || ||||| ||||  ||||| || ||||| ||||||
Sbjct: 1022 ctgcagatcttgtaatatccttcctcaccccaattctgtccccatgaattctttatgatc 963

                             
Query: 420  cagtatggcttctcctt 436
            ||||| ||||| |||||
Sbjct: 962  cagtaaggcttttcctt 946



to top

>gb|AC099770.11| Mus musculus Strain C57BL6/J chromosome 5 BAC, RP23-349C19, Complete
             Sequence, complete sequence
          Length = 191223

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 249   gatcagatcagaacagatcag 269
             |||||||||||||||||||||
Sbjct: 46972 gatcagatcagaacagatcag 46992



to top

>gb|AC107315.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0032O19, from chromosome 3, complete sequence
          Length = 142248

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 248   cgatcagatcagaacagatcagaca 272
             ||||||||||||| |||||||||||
Sbjct: 60618 cgatcagatcagaccagatcagaca 60594



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 248     cgatcagatcagaacagatcagaca 272
               ||||||||||||| |||||||||||
Sbjct: 9223606 cgatcagatcagaccagatcagaca 9223630



to top

>gb|AF314930.1|AF314930 Trypanosoma cruzi strain Ynull cruzipain gene, complete cds
          Length = 1404

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 404 cgagttcttgatgatccagta 424
           |||||||||||||||||||||
Sbjct: 915 cgagttcttgatgatccagta 895



to top

>gb|AC137698.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBb0014A21, from chromosome 3, complete sequence
          Length = 134014

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 248    cgatcagatcagaacagatcagaca 272
              ||||||||||||| |||||||||||
Sbjct: 130480 cgatcagatcagaccagatcagaca 130456



to top

>gb|AY099317.1| Trypanosoma cruzi clone CL Brener cysteine proteinase precursor,
           gene, complete cds
          Length = 1404

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 401 ccacgagttcttgatgatcca 421
           |||||||||||||||||||||
Sbjct: 918 ccacgagttcttgatgatcca 898



to top

>dbj|D21124.1|PWSNTP Paragonimus westermani mRNA for neutral thiol protease, complete
           cds
          Length = 803

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 408 ttcttgatgatccagtatggc 428
           |||||||||||||||||||||
Sbjct: 633 ttcttgatgatccagtatggc 613



to top

>gb|AY700585.1| Zingiber officinale cysteine protease gp2a mRNA, complete cds
          Length = 1359

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 387  ccccagttctcgccccacgagttcttgatgatccag 422
            ||||||||||  |||||||||||||| | |||||||
Sbjct: 1013 ccccagttcttaccccacgagttcttcacgatccag 978



to top

>ref|XM_507329.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1150_A11.17 mRNA
          Length = 1437

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 397  cgccccacgagttcttgatgatccagta 424
            |||||||||||||| ||| |||||||||
Sbjct: 1042 cgccccacgagttcctgacgatccagta 1015



to top

>ref|XM_483741.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1437

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 397  cgccccacgagttcttgatgatccagta 424
            |||||||||||||| ||| |||||||||
Sbjct: 1042 cgccccacgagttcctgacgatccagta 1015



to top

>gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence
          Length = 1618915

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 401    ccacgagttcttgatgatccagta 424
              ||||||||| ||||||||||||||
Sbjct: 422852 ccacgagtttttgatgatccagta 422875



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 401    ccacgagttcttgatgatccagta 424
              ||||||||| ||||||||||||||
Sbjct: 421091 ccacgagtttttgatgatccagta 421114



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 401    ccacgagttcttgatgatccagta 424
              ||||||||| ||||||||||||||
Sbjct: 419330 ccacgagtttttgatgatccagta 419353



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 401    ccacgagttcttgatgatccagta 424
              ||||||||| ||||||||||||||
Sbjct: 417569 ccacgagtttttgatgatccagta 417592



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 401    ccacgagttcttgatgatccagta 424
              ||||||||| ||||||||||||||
Sbjct: 415808 ccacgagtttttgatgatccagta 415831



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 401    ccacgagttcttgatgatccagta 424
              ||||||||| ||||||||||||||
Sbjct: 414044 ccacgagtttttgatgatccagta 414067



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 401    ccacgagttcttgatgatccagta 424
              ||||||||| ||||||||||||||
Sbjct: 412280 ccacgagtttttgatgatccagta 412303



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 401    ccacgagttcttgatgatccagta 424
              ||||||||| ||||||||||||||
Sbjct: 410519 ccacgagtttttgatgatccagta 410542



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 401    ccacgagttcttgatgatccagta 424
              ||||||||| ||||||||||||||
Sbjct: 408758 ccacgagtttttgatgatccagta 408781



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 401    ccacgagttcttgatgatccagta 424
              ||||||||| ||||||||||||||
Sbjct: 406994 ccacgagtttttgatgatccagta 407017



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 401    ccacgagttcttgatgatccagta 424
              ||||||||| ||||||||||||||
Sbjct: 405230 ccacgagtttttgatgatccagta 405253



to top

>gb|AC073906.6| Trypanosoma brucei chromosome 6 clone RPCI93-3A7, complete sequence
          Length = 175357

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 401   ccacgagttcttgatgatccagta 424
             ||||||||| ||||||||||||||
Sbjct: 74668 ccacgagtttttgatgatccagta 74691



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 401   ccacgagttcttgatgatccagta 424
             ||||||||| ||||||||||||||
Sbjct: 72907 ccacgagtttttgatgatccagta 72930



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 401   ccacgagttcttgatgatccagta 424
             ||||||||| ||||||||||||||
Sbjct: 71146 ccacgagtttttgatgatccagta 71169



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 401   ccacgagttcttgatgatccagta 424
             ||||||||| ||||||||||||||
Sbjct: 69385 ccacgagtttttgatgatccagta 69408



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 401   ccacgagttcttgatgatccagta 424
             ||||||||| ||||||||||||||
Sbjct: 67624 ccacgagtttttgatgatccagta 67647



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 401   ccacgagttcttgatgatccagta 424
             ||||||||| ||||||||||||||
Sbjct: 65860 ccacgagtttttgatgatccagta 65883



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 401   ccacgagttcttgatgatccagta 424
             ||||||||| ||||||||||||||
Sbjct: 64096 ccacgagtttttgatgatccagta 64119



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 401   ccacgagttcttgatgatccagta 424
             ||||||||| ||||||||||||||
Sbjct: 62335 ccacgagtttttgatgatccagta 62358



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 401   ccacgagttcttgatgatccagta 424
             ||||||||| ||||||||||||||
Sbjct: 60574 ccacgagtttttgatgatccagta 60597



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 401   ccacgagttcttgatgatccagta 424
             ||||||||| ||||||||||||||
Sbjct: 58810 ccacgagtttttgatgatccagta 58833



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 401   ccacgagttcttgatgatccagta 424
             ||||||||| ||||||||||||||
Sbjct: 57046 ccacgagtttttgatgatccagta 57069



to top

>gb|AF527926.1| Candida glabrata strain NRRL Y-65 actin (act1) gene, partial cds
          Length = 897

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 54  tcaaaatagcgtgtggcaaa 73
           ||||||||||||||||||||
Sbjct: 403 tcaaaatagcgtgtggcaaa 384



to top

>ref|XM_540519.2| PREDICTED: Canis familiaris similar to tumor protein p53 inducible
            protein 5 (LOC483400), mRNA
          Length = 2205

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 412  tgatgatccagtatggcttc 431
            ||||||||||||||||||||
Sbjct: 1589 tgatgatccagtatggcttc 1608



to top

>ref|XM_821191.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.1060) partial mRNA
          Length = 1350

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>ref|XM_821190.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.1050) partial mRNA
          Length = 1350

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>ref|XM_821189.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.1040) partial mRNA
          Length = 1350

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>ref|XM_821188.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.1030) partial mRNA
          Length = 1350

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>ref|XM_821187.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.1020) partial mRNA
          Length = 1353

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>ref|XM_821186.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.1010) partial mRNA
          Length = 1353

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>ref|XM_821185.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.1000) partial mRNA
          Length = 1350

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>ref|XM_821184.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.990) partial mRNA
          Length = 1350

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>ref|XM_821183.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.980) partial mRNA
          Length = 1353

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>ref|XM_821182.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.970) partial mRNA
          Length = 1353

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>ref|XM_821181.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.960) partial mRNA
          Length = 1353

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>ref|XM_448768.1| Candida glabrata CBS138, CAGL0K12694g partial mRNA
          Length = 1083

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 54  tcaaaatagcgtgtggcaaa 73
           ||||||||||||||||||||
Sbjct: 484 tcaaaatagcgtgtggcaaa 465



to top

>gb|AC149637.11| Medicago truncatula clone mth2-181h2, complete sequence
          Length = 116616

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 65/80 (81%)
 Strand = Plus / Plus

                                                                         
Query: 357   cccctgcagatcttgtagtaccccttgtccccccagttctcgccccacgagttcttgatg 416
             |||||||| || || ||||| || || || |||||  |||| ||||| ||||| || || 
Sbjct: 63662 cccctgcatattttatagtatccattttctccccaagtctcaccccatgagtttttaatt 63721

                                 
Query: 417   atccagtatggcttctcctt 436
             ||||| ||||||||||||||
Sbjct: 63722 atccaatatggcttctcctt 63741



to top

>emb|AL023805.2|HS811H13 Human DNA sequence from clone RP4-811H13 on chromosome 20p12
           Contains part of the PLCB4 gene for phospholipase C beta
           4 and a CpG island, complete sequence
          Length = 137779

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 23  gacagaattattcagaagtt 42
           ||||||||||||||||||||
Sbjct: 560 gacagaattattcagaagtt 541



to top

>emb|X99936.1|ZMSEE1 Z.mays mRNA for cysteine proteinase, See1
          Length = 1412

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 397  cgccccacgagttcttgatgatccagta 424
            ||||||| ||||||||||||| ||||||
Sbjct: 1053 cgccccatgagttcttgatgagccagta 1026



to top

>emb|X16465.1|TBCYSPRO Trypanosoma brucei mRNA for cysteine proteinase
          Length = 1621

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||| ||||||||||||||
Sbjct: 958 ccacgagtttttgatgatccagta 935



to top

>emb|X54353.1|TBCSTPRO Trypanosome mRNA for a cysteine protease
          Length = 1636

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||| ||||||||||||||
Sbjct: 962 ccacgagtttttgatgatccagta 939



to top

>emb|CR380957.1| Candida glabrata strain CBS138 chromosome K complete sequence
          Length = 1302002

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 54      tcaaaatagcgtgtggcaaa 73
               ||||||||||||||||||||
Sbjct: 1259029 tcaaaatagcgtgtggcaaa 1259010



to top

>emb|AJ389073.1|CGL389073 Candida glabrata partial act1 gene, strain CBS 138 T, isolate WM 53
          Length = 979

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 54  tcaaaatagcgtgtggcaaa 73
           ||||||||||||||||||||
Sbjct: 434 tcaaaatagcgtgtggcaaa 415



to top

>emb|AJ389072.1|CGL389072 Candida glabrata partial act1 gene, strain DUMC 19-1112, isolate WM
           54
          Length = 979

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 54  tcaaaatagcgtgtggcaaa 73
           ||||||||||||||||||||
Sbjct: 434 tcaaaatagcgtgtggcaaa 415



to top

>emb|AJ297265.1|TBR297265 Trypanosoma brucei rhodesiense partial mRNA for cysteine protease
           (rhodesain gene)
          Length = 1350

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 401 ccacgagttcttgatgatccagta 424
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>emb|CR860490.1| Pongo pygmaeus mRNA; cDNA DKFZp469F0716 (from clone DKFZp469F0716)
          Length = 3762

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 234  tccaggagggccgccgatca 253
            ||||||||||||||||||||
Sbjct: 1426 tccaggagggccgccgatca 1407



to top

>gb|AC087182.12| Oryza sativa chromosome 10 BAC OSJNBa0029C15 genomic sequence, complete
             sequence
          Length = 148816

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 73    acatcacatgcatgggcgta 92
             ||||||||||||||||||||
Sbjct: 65430 acatcacatgcatgggcgta 65449


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,291,602
Number of Sequences: 3902068
Number of extensions: 3291602
Number of successful extensions: 60477
Number of sequences better than 10.0: 270
Number of HSP's better than 10.0 without gapping: 271
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 59855
Number of HSP's gapped (non-prelim): 612
length of query: 470
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 448
effective length of database: 17,147,199,772
effective search space: 7681945497856
effective search space used: 7681945497856
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top