ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart39d11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF542967.1| Triticum aestivum annexin P35-like mRNA, partial ... 389 e-105
2ref|XM_467846.1| Oryza sativa (japonica cultivar-group), mRNA 178 1e-41
3dbj|AK101787.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 1e-41
4dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 165 2e-37
5dbj|AP005012.3| Oryza sativa (japonica cultivar-group) genomic D... 165 2e-37
6dbj|AP004119.3| Oryza sativa (japonica cultivar-group) genomic D... 165 2e-37
7dbj|AK072559.1| Oryza sativa (japonica cultivar-group) cDNA clon... 127 4e-26
8emb|X98245.1|ZMANNP35 Z.mays mRNA for annexin p35 115 1e-22
9gb|AY105105.1| Zea mays PCO122403 mRNA sequence 115 1e-22
10dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 111 2e-21
11dbj|AP004727.2| Oryza sativa (japonica cultivar-group) genomic D... 111 2e-21
12emb|X98244.2|ZMANNP33 Z.mays mRNA for annexin p33 76 1e-10
13gb|AY105151.1| Zea mays PCO072293 mRNA sequence 76 1e-10
14gb|AF373160.1| Rana macrocnemis macrocnemis haplotype M5 cytochr... 46 0.11
15gb|AF373159.1| Rana macrocnemis camerani haplotype M4 cytochrome... 46 0.11
16gb|AF373158.1| Rana macrocnemis macrocnemis haplotype M3 cytochr... 46 0.11
17gb|AF373157.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 46 0.11
18gb|AF373156.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 46 0.11
19gb|AF373155.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 46 0.11
20gb|AF373154.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 46 0.11
21gb|AF373153.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 46 0.11
22gb|AF373152.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.11
23gb|AF373151.1| Rana macrocnemis camerani haplotype M1 cytochrome... 46 0.11
24gb|AF373150.1| Rana macrocnemis camerani haplotype M1 cytochrome... 46 0.11
25gb|AF373149.1| Rana macrocnemis camerani haplotype M1 cytochrome... 46 0.11
26gb|AF373148.1| Rana macrocnemis camerani haplotype M1 cytochrome... 46 0.11
27gb|AF373147.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.11
28gb|AF373146.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.11
29gb|AF373145.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.11
30gb|AF373144.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.11
31gb|AF373143.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.11
32gb|AF373142.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.11
33gb|AF373141.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.11
34gb|AF373140.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.11
35gb|AF373139.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.11
36gb|AF373138.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.11
37gb|AF373137.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 46 0.11
38gb|AF373136.1| Rana macrocnemis camerani haplotype C6 cytochrome... 46 0.11
39gb|AF373135.1| Rana macrocnemis camerani haplotype C5 cytochrome... 46 0.11
40gb|AF373134.1| Rana macrocnemis camerani haplotype C5 cytochrome... 46 0.11
41gb|AF373133.1| Rana macrocnemis camerani haplotype C5 cytochrome... 46 0.11
42gb|AF373132.1| Rana macrocnemis camerani haplotype C4 cytochrome... 46 0.11
43gb|AF373131.1| Rana macrocnemis camerani haplotype C4 cytochrome... 46 0.11
44gb|AF373130.1| Rana macrocnemis camerani haplotype C4 cytochrome... 46 0.11
45gb|AF373129.1| Rana macrocnemis camerani haplotype C4 cytochrome... 46 0.11
46gb|AF373128.1| Rana macrocnemis camerani haplotype C4 cytochrome... 46 0.11
47gb|AF373127.1| Rana macrocnemis macrocnemis haplotype C4 cytochr... 46 0.11
48gb|AF373126.1| Rana macrocnemis macrocnemis haplotype C3 cytochr... 46 0.11
49gb|AF373125.1| Rana macrocnemis macrocnemis haplotype C2 cytochr... 46 0.11
50gb|AF373124.1| Rana macrocnemis macrocnemis haplotype C2 cytochr... 46 0.11
51gb|AF373123.1| Rana macrocnemis macrocnemis haplotype C2 cytochr... 46 0.11
52gb|AF373122.1| Rana macrocnemis camerani haplotype C1 cytochrome... 46 0.11
53gb|AF373121.1| Rana macrocnemis camerani haplotype C1 cytochrome... 46 0.11
54gb|AF373120.1| Rana macrocnemis camerani haplotype C1 cytochrome... 46 0.11
55gb|AF373119.1| Rana macrocnemis camerani haplotype C1 cytochrome... 46 0.11
56gb|AF373118.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 46 0.11
57gb|AF373117.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 46 0.11
58gb|AF373116.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 46 0.11
59gb|AF373115.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 46 0.11
60gb|AF373114.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 46 0.11
61gb|AY147969.1| Rana macrocnemis pseudodalmatina cytochrome b (cy... 46 0.11
62gb|AY147968.1| Rana macrocnemis macrocnemis cytochrome b (cytb) ... 46 0.11
63gb|AY147964.1| Rana holtzi cytochrome b (cytb) gene, partial cds... 46 0.11
64gb|AY147960.1| Rana macrocnemis cytochrome b (cytb) gene, partia... 46 0.11
65gb|AF021076.1| Megarthrus americanus cytochrome b (cytb) gene, m... 44 0.44
66gb|AC113587.16| Mus musculus chromosome 15, clone RP24-424I13, c... 42 1.7
67gb|DQ106808.1| Ephippiger provincialis clone Eprov7 cytochrome b... 42 1.7
68gb|AC104833.6| Mus Musculus Strain C57BL6/J Chromosome 15 BAC, R... 42 1.7
69dbj|AK082224.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 42 1.7
70dbj|AB201221.1| Microhyla ornata mitochondrial cytb gene for cyt... 42 1.7
71dbj|AB201218.1| Microhyla ornata mitochondrial cytb gene for cyt... 42 1.7
72dbj|AB201216.1| Microhyla ornata mitochondrial cytb gene for cyt... 42 1.7
73emb|AL136039.4|CNS01DVU Human chromosome 14 DNA sequence BAC R-7... 42 1.7
74ref|XM_775596.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 6.8
75emb|AJ298865.1|XLA298865 Xenopus laevis mRNA for winged helix tr... 40 6.8
76gb|AC011415.3| Homo sapiens chromosome 5 clone CTB-87P21, comple... 40 6.8
77gb|AC149341.2| Phakopsora pachyrhizi clone JGIAFNA-25D19, comple... 40 6.8

>gb|AF542967.1| Triticum aestivum annexin P35-like mRNA, partial sequence
          Length = 766

 Score =  389 bits (196), Expect = e-105
 Identities = 257/276 (93%), Gaps = 1/276 (0%)
 Strand = Plus / Minus

                                                                       
Query: 230 tccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcg 289
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 642 tccagcgggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcg 583

                                                                       
Query: 290 gcacgagtggttatcaccctagtaa-gggtgtgctcgtctgtaccgacaccaccaagagc 348
           || ||||||||||| ||||| |||| |||||| ||||||||| ||||| || ||||| ||
Sbjct: 582 gcgcgagtggttatgaccctcgtaaagggtgttctcgtctgtgccgacgcctccaagggc 523

                                                                       
Query: 349 caaccggatgaccttctcaaagtatctgtcggggcaagtgaaacaccttatgatcgccct 408
           ||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 522 caaccggatgatcttctcaaagtatctgtcagggcaagtgaaacaccttatgatcgccct 463

                                                                       
Query: 409 cagggtcgagaggaactcgtcctggggatcttccttgaggtccttggtgatagggtgact 468
           |||||| ||||||||||||| || ||| ||||||||||||||||| ||||| ||||||||
Sbjct: 462 cagggttgagaggaactcgttcttggggtcttccttgaggtccttagtgatggggtgact 403

                                               
Query: 469 aaactgatcattgtagctgttgaatgttgcaagtag 504
            |||||||||||||||||||||||||||||||||||
Sbjct: 402 gaactgatcattgtagctgttgaatgttgcaagtag 367



to top

>ref|XM_467846.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1223

 Score =  178 bits (90), Expect = 1e-41
 Identities = 279/342 (81%)
 Strand = Plus / Minus

                                                                        
Query: 162  actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 221
            |||||||||| || || ||||| |  ||||| || |||||||||||||| || || | ||
Sbjct: 1058 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 999

                                                                        
Query: 222  cagccttctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 281
            ||||   |||||  ||||| ||||| ||||||||||| ||||||||||||| ||||||||
Sbjct: 998  cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 939

                                                                        
Query: 282  ccacctcggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccac 341
            | |||||||||||||| ||||| | ||| ||||| | || ||||||||| || |  || |
Sbjct: 938  ctacctcggcacgagttgttatgatccttgtaagagagttctcgtctgtgcccattcctc 879

                                                                        
Query: 342  caagagccaaccggatgaccttctcaaagtatctgtcggggcaagtgaaacaccttatga 401
            | |||||||| || ||||| ||||||||||||||||| ||||||||||| || |||||||
Sbjct: 878  ctagagccaatcgaatgactttctcaaagtatctgtcagggcaagtgaagcatcttatga 819

                                                                        
Query: 402  tcgccctcagggtcgagaggaactcgtcctggggatcttccttgaggtccttggtgatag 461
            ||||||| || ||    |||||||||||||  |||||  | || || ||||| ||||| |
Sbjct: 818  tcgcccttagtgtaccaaggaactcgtccttaggatcagctttaagatccttagtgattg 759

                                                      
Query: 462  ggtgactaaactgatcattgtagctgttgaatgttgcaagta 503
            | || |  |||||||||||||| || ||||||||||| ||||
Sbjct: 758  gatggccgaactgatcattgtaactattgaatgttgctagta 717



to top

>dbj|AK101787.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033065F07, full
            insert sequence
          Length = 1223

 Score =  178 bits (90), Expect = 1e-41
 Identities = 279/342 (81%)
 Strand = Plus / Minus

                                                                        
Query: 162  actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 221
            |||||||||| || || ||||| |  ||||| || |||||||||||||| || || | ||
Sbjct: 1058 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 999

                                                                        
Query: 222  cagccttctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 281
            ||||   |||||  ||||| ||||| ||||||||||| ||||||||||||| ||||||||
Sbjct: 998  cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 939

                                                                        
Query: 282  ccacctcggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccac 341
            | |||||||||||||| ||||| | ||| ||||| | || ||||||||| || |  || |
Sbjct: 938  ctacctcggcacgagttgttatgatccttgtaagagagttctcgtctgtgcccattcctc 879

                                                                        
Query: 342  caagagccaaccggatgaccttctcaaagtatctgtcggggcaagtgaaacaccttatga 401
            | |||||||| || ||||| ||||||||||||||||| ||||||||||| || |||||||
Sbjct: 878  ctagagccaatcgaatgactttctcaaagtatctgtcagggcaagtgaagcatcttatga 819

                                                                        
Query: 402  tcgccctcagggtcgagaggaactcgtcctggggatcttccttgaggtccttggtgatag 461
            ||||||| || ||    |||||||||||||  |||||  | || || ||||| ||||| |
Sbjct: 818  tcgcccttagtgtaccaaggaactcgtccttaggatcagctttaagatccttagtgattg 759

                                                      
Query: 462  ggtgactaaactgatcattgtagctgttgaatgttgcaagta 503
            | || |  |||||||||||||| || ||||||||||| ||||
Sbjct: 758  gatggccgaactgatcattgtaactattgaatgttgctagta 717



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  165 bits (83), Expect = 2e-37
 Identities = 206/247 (83%)
 Strand = Plus / Plus

                                                                            
Query: 162      actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 221
                |||||||||| || || ||||| |  ||||| || |||||||||||||| || || | ||
Sbjct: 31716862 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 31716921

                                                                            
Query: 222      cagccttctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 281
                ||||   |||||  ||||| ||||| ||||||||||| ||||||||||||| ||||||||
Sbjct: 31716922 cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 31716981

                                                                            
Query: 282      ccacctcggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccac 341
                | |||||||||||||| ||||| | ||| ||||| | || ||||||||| || |  || |
Sbjct: 31716982 ctacctcggcacgagttgttatgatccttgtaagagagttctcgtctgtgcccattcctc 31717041

                                                                            
Query: 342      caagagccaaccggatgaccttctcaaagtatctgtcggggcaagtgaaacaccttatga 401
                | |||||||| || ||||| ||||||||||||||||| ||||||||||| || |||||||
Sbjct: 31717042 ctagagccaatcgaatgactttctcaaagtatctgtcagggcaagtgaagcatcttatga 31717101

                       
Query: 402      tcgccct 408
                |||||||
Sbjct: 31717102 tcgccct 31717108



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                  
Query: 470      aactgatcattgtagctgttgaatgttgcaagta 503
                |||||||||||||| || ||||||||||| ||||
Sbjct: 31717419 aactgatcattgtaactattgaatgttgctagta 31717452



to top

>dbj|AP005012.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0627E03
          Length = 159861

 Score =  165 bits (83), Expect = 2e-37
 Identities = 206/247 (83%)
 Strand = Plus / Plus

                                                                         
Query: 162   actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 221
             |||||||||| || || ||||| |  ||||| || |||||||||||||| || || | ||
Sbjct: 12660 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 12719

                                                                         
Query: 222   cagccttctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 281
             ||||   |||||  ||||| ||||| ||||||||||| ||||||||||||| ||||||||
Sbjct: 12720 cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 12779

                                                                         
Query: 282   ccacctcggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccac 341
             | |||||||||||||| ||||| | ||| ||||| | || ||||||||| || |  || |
Sbjct: 12780 ctacctcggcacgagttgttatgatccttgtaagagagttctcgtctgtgcccattcctc 12839

                                                                         
Query: 342   caagagccaaccggatgaccttctcaaagtatctgtcggggcaagtgaaacaccttatga 401
             | |||||||| || ||||| ||||||||||||||||| ||||||||||| || |||||||
Sbjct: 12840 ctagagccaatcgaatgactttctcaaagtatctgtcagggcaagtgaagcatcttatga 12899

                    
Query: 402   tcgccct 408
             |||||||
Sbjct: 12900 tcgccct 12906



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 470   aactgatcattgtagctgttgaatgttgcaagta 503
             |||||||||||||| || ||||||||||| ||||
Sbjct: 13217 aactgatcattgtaactattgaatgttgctagta 13250



to top

>dbj|AP004119.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1288_G09
          Length = 109672

 Score =  165 bits (83), Expect = 2e-37
 Identities = 206/247 (83%)
 Strand = Plus / Plus

                                                                         
Query: 162   actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 221
             |||||||||| || || ||||| |  ||||| || |||||||||||||| || || | ||
Sbjct: 96649 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 96708

                                                                         
Query: 222   cagccttctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 281
             ||||   |||||  ||||| ||||| ||||||||||| ||||||||||||| ||||||||
Sbjct: 96709 cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 96768

                                                                         
Query: 282   ccacctcggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccac 341
             | |||||||||||||| ||||| | ||| ||||| | || ||||||||| || |  || |
Sbjct: 96769 ctacctcggcacgagttgttatgatccttgtaagagagttctcgtctgtgcccattcctc 96828

                                                                         
Query: 342   caagagccaaccggatgaccttctcaaagtatctgtcggggcaagtgaaacaccttatga 401
             | |||||||| || ||||| ||||||||||||||||| ||||||||||| || |||||||
Sbjct: 96829 ctagagccaatcgaatgactttctcaaagtatctgtcagggcaagtgaagcatcttatga 96888

                    
Query: 402   tcgccct 408
             |||||||
Sbjct: 96889 tcgccct 96895



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 470   aactgatcattgtagctgttgaatgttgcaagta 503
             |||||||||||||| || ||||||||||| ||||
Sbjct: 97206 aactgatcattgtaactattgaatgttgctagta 97239



to top

>dbj|AK072559.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132A10, full
           insert sequence
          Length = 1274

 Score =  127 bits (64), Expect = 4e-26
 Identities = 220/272 (80%)
 Strand = Plus / Minus

                                                                       
Query: 229 ctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctc 288
           |||||| ||||| |||||||||||||||||||||||| | |||| |||||| ||||||||
Sbjct: 977 ctccagcgggacactgttcctcttctggtacgcctccgtgatcagcttcagatccacctc 918

                                                                       
Query: 289 ggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccaccaagagc 348
           |||||||||||| || | |||||| |||| || ||||||||| || |  ||  | |  ||
Sbjct: 917 ggcacgagtggtaatgatcctagtgagggagttctcgtctgttcccatgcctgcgatggc 858

                                                                       
Query: 349 caaccggatgaccttctcaaagtatctgtcggggcaagtgaaacaccttatgatcgccct 408
           ||||| |||||| ||||| ||||| ||||| ||||||  ||| || |  ||||| || | 
Sbjct: 857 caacctgatgactttctcgaagtacctgtcagggcaacagaagcagcggatgattgcacg 798

                                                                       
Query: 409 cagggtcgagaggaactcgtcctggggatcttccttgaggtccttggtgatagggtgact 468
           ||| || || ||||||||||||| ||||||  ||||||| |||||| |||| ||||||| 
Sbjct: 797 cagcgtggaaaggaactcgtccttgggatcagccttgagatccttgttgattgggtgacc 738

                                           
Query: 469 aaactgatcattgtagctgttgaatgttgcaa 500
           | | | ||||||||| |  |||||||| ||||
Sbjct: 737 atattcatcattgtaacgattgaatgtcgcaa 706



to top

>emb|X98245.1|ZMANNP35 Z.mays mRNA for annexin p35
          Length = 1257

 Score =  115 bits (58), Expect = 1e-22
 Identities = 259/326 (79%)
 Strand = Plus / Minus

                                                                        
Query: 179  gcaagcatcatatcttcatagtctctggttgtgtccttggaaacagccttctccaggggg 238
            |||||||| ||||| ||||| ||||| ||||| || ||||  |||||   |||||| || 
Sbjct: 1057 gcaagcataatatcctcataatctctagttgtatctttggccacagcacgctccagcggc 998

                                                                        
Query: 239  acgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcggcacgagtg 298
            || ||||| |||||||| || ||||||||||||| ||||||||| |||||||| ||||| 
Sbjct: 997  acactgtttctcttctgataagcctcctttatcagcttcaggtcgacctcggcgcgagta 938

                                                                        
Query: 299  gttatcaccctagtaagggtgtgctcgtctgtaccgacaccaccaagagccaaccggatg 358
            ||||  ||||| || |||   | ||| || || || |  || ||||||||||  || |||
Sbjct: 937  gttacgaccctggtgaggtcatcctcatcagtgcccatgcctccaagagccagtcgaatg 878

                                                                        
Query: 359  accttctcaaagtatctgtcggggcaagtgaaacaccttatgatcgccctcagggtcgag 418
            || ||||| ||||||||||| ||||| ||||| ||||  |||||||||| ||| || || 
Sbjct: 877  actttctcgaagtatctgtcagggcaggtgaagcaccggatgatcgcccgcagtgttgaa 818

                                                                        
Query: 419  aggaactcgtcctggggatcttccttgaggtccttggtgatagggtgactaaactgatca 478
            || ||||| |||| ||| ||  | || || |||||| |||| |  ||| | |||||||| 
Sbjct: 817  agaaactcatccttggggtcagctttcagatccttgttgattgcatgagtgaactgatcc 758

                                      
Query: 479  ttgtagctgttgaatgttgcaagtag 504
            |||||||| |||||||||||||||||
Sbjct: 757  ttgtagctattgaatgttgcaagtag 732



to top

>gb|AY105105.1| Zea mays PCO122403 mRNA sequence
          Length = 1401

 Score =  115 bits (58), Expect = 1e-22
 Identities = 259/326 (79%)
 Strand = Plus / Minus

                                                                        
Query: 179  gcaagcatcatatcttcatagtctctggttgtgtccttggaaacagccttctccaggggg 238
            |||||||| ||||| ||||| ||||| ||||| || ||||  |||||   |||||| || 
Sbjct: 1151 gcaagcataatatcctcataatctctagttgtatctttggccacagcacgctccagcggc 1092

                                                                        
Query: 239  acgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcggcacgagtg 298
            || ||||| |||||||| || ||||||||||||| ||||||||| |||||||| ||||| 
Sbjct: 1091 acactgtttctcttctgataagcctcctttatcagcttcaggtcgacctcggcgcgagta 1032

                                                                        
Query: 299  gttatcaccctagtaagggtgtgctcgtctgtaccgacaccaccaagagccaaccggatg 358
            ||||  ||||| || |||   | ||| || || || |  || ||||||||||  || |||
Sbjct: 1031 gttacgaccctggtgaggtcatcctcatcagtgcccatgcctccaagagccagtcgaatg 972

                                                                        
Query: 359  accttctcaaagtatctgtcggggcaagtgaaacaccttatgatcgccctcagggtcgag 418
            || ||||| ||||||||||| ||||| ||||| ||||  |||||||||| ||| || || 
Sbjct: 971  actttctcgaagtatctgtcagggcaggtgaagcaccggatgatcgcccgcagtgttgaa 912

                                                                        
Query: 419  aggaactcgtcctggggatcttccttgaggtccttggtgatagggtgactaaactgatca 478
            || ||||| |||| ||| ||  | || || |||||| |||| |  ||| | |||||||| 
Sbjct: 911  agaaactcatccttggggtcagctttcagatccttgttgattgcatgagtgaactgatcc 852

                                      
Query: 479  ttgtagctgttgaatgttgcaagtag 504
            |||||||| |||||||||||||||||
Sbjct: 851  ttgtagctattgaatgttgcaagtag 826



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  111 bits (56), Expect = 2e-21
 Identities = 182/224 (81%)
 Strand = Plus / Minus

                                                                           
Query: 229     ctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctc 288
               |||||| ||||| |||||||||||||||||||||||| | |||| |||||| ||||||||
Sbjct: 6264228 ctccagcgggacactgttcctcttctggtacgcctccgtgatcagcttcagatccacctc 6264169

                                                                           
Query: 289     ggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccaccaagagc 348
               |||||||||||| || | |||||| |||| || ||||||||| || |  ||  | |  ||
Sbjct: 6264168 ggcacgagtggtaatgatcctagtgagggagttctcgtctgttcccatgcctgcgatggc 6264109

                                                                           
Query: 349     caaccggatgaccttctcaaagtatctgtcggggcaagtgaaacaccttatgatcgccct 408
               ||||| |||||| ||||| ||||| ||||| ||||||  ||| || |  ||||| || | 
Sbjct: 6264108 caacctgatgactttctcgaagtacctgtcagggcaacagaagcagcggatgattgcacg 6264049

                                                           
Query: 409     cagggtcgagaggaactcgtcctggggatcttccttgaggtcct 452
               ||| || || ||||||||||||| ||||||  ||||||| ||||
Sbjct: 6264048 cagcgtggaaaggaactcgtccttgggatcagccttgagatcct 6264005



to top

>dbj|AP004727.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0516A04
          Length = 145107

 Score =  111 bits (56), Expect = 2e-21
 Identities = 182/224 (81%)
 Strand = Plus / Minus

                                                                         
Query: 229   ctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctc 288
             |||||| ||||| |||||||||||||||||||||||| | |||| |||||| ||||||||
Sbjct: 58304 ctccagcgggacactgttcctcttctggtacgcctccgtgatcagcttcagatccacctc 58245

                                                                         
Query: 289   ggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccaccaagagc 348
             |||||||||||| || | |||||| |||| || ||||||||| || |  ||  | |  ||
Sbjct: 58244 ggcacgagtggtaatgatcctagtgagggagttctcgtctgttcccatgcctgcgatggc 58185

                                                                         
Query: 349   caaccggatgaccttctcaaagtatctgtcggggcaagtgaaacaccttatgatcgccct 408
             ||||| |||||| ||||| ||||| ||||| ||||||  ||| || |  ||||| || | 
Sbjct: 58184 caacctgatgactttctcgaagtacctgtcagggcaacagaagcagcggatgattgcacg 58125

                                                         
Query: 409   cagggtcgagaggaactcgtcctggggatcttccttgaggtcct 452
             ||| || || ||||||||||||| ||||||  ||||||| ||||
Sbjct: 58124 cagcgtggaaaggaactcgtccttgggatcagccttgagatcct 58081



to top

>emb|X98244.2|ZMANNP33 Z.mays mRNA for annexin p33
          Length = 1277

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 86/102 (84%)
 Strand = Plus / Minus

                                                                       
Query: 229 ctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctc 288
           |||||| || ||||||||||||||||||||||||||||| ||||  || |||||||||||
Sbjct: 960 ctccagcggcacgctgttcctcttctggtacgcctccttaatcagtttgaggtccacctc 901

                                                     
Query: 289 ggcacgagtggttatcaccctagtaagggtgtgctcgtctgt 330
            || || ||||| || ||||| || |||| || ||| |||||
Sbjct: 900 agcgcgggtggtgatgaccctggtcagggagttctcatctgt 859



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 359 accttctcaaagtatctgtcggggcaagtgaaacaccttatgatcgccctcagggtcgag 418
           |||||||||||||| ||||| |||||| |||| ||||  |||||||||| ||| ||   |
Sbjct: 830 accttctcaaagtacctgtcagggcaactgaagcaccggatgatcgcccgcagcgttctg 771

                            
Query: 419 aggaactcgtcctgggg 435
           ||| |||||||||||||
Sbjct: 770 aggtactcgtcctgggg 754



to top

>gb|AY105151.1| Zea mays PCO072293 mRNA sequence
          Length = 1369

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 86/102 (84%)
 Strand = Plus / Minus

                                                                       
Query: 229 ctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctc 288
           |||||| || ||||||||||||||||||||||||||||| ||||  || |||||||||||
Sbjct: 977 ctccagcggcacgctgttcctcttctggtacgcctccttaatcagtttgaggtccacctc 918

                                                     
Query: 289 ggcacgagtggttatcaccctagtaagggtgtgctcgtctgt 330
            || || ||||| || ||||| || |||| || ||| |||||
Sbjct: 917 agcgcgggtggtgatgaccctggtcagggagttctcatctgt 876



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 359 accttctcaaagtatctgtcggggcaagtgaaacaccttatgatcgccctcagggtcgag 418
           |||||||||||||| ||||| |||||| |||| ||||  |||||||||| ||| ||   |
Sbjct: 847 accttctcaaagtacctgtcagggcaactgaagcaccggatgatcgcccgcagcgttctg 788

                            
Query: 419 aggaactcgtcctgggg 435
           ||| |||||||||||||
Sbjct: 787 aggtactcgtcctgggg 771



to top

>gb|AF373160.1| Rana macrocnemis macrocnemis haplotype M5 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373159.1| Rana macrocnemis camerani haplotype M4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373158.1| Rana macrocnemis macrocnemis haplotype M3 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373157.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373156.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373155.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373154.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373153.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373152.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373151.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373150.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373149.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373148.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373147.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373146.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373145.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373144.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373143.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373142.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373141.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373140.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373139.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373138.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373137.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373136.1| Rana macrocnemis camerani haplotype C6 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373135.1| Rana macrocnemis camerani haplotype C5 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373134.1| Rana macrocnemis camerani haplotype C5 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373133.1| Rana macrocnemis camerani haplotype C5 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373132.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373131.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373130.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373129.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373128.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373127.1| Rana macrocnemis macrocnemis haplotype C4 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373126.1| Rana macrocnemis macrocnemis haplotype C3 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373125.1| Rana macrocnemis macrocnemis haplotype C2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373124.1| Rana macrocnemis macrocnemis haplotype C2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373123.1| Rana macrocnemis macrocnemis haplotype C2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373122.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373121.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373120.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373119.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373118.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373117.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373116.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373115.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AF373114.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462



to top

>gb|AY147969.1| Rana macrocnemis pseudodalmatina cytochrome b (cytb) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 465

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 378 atctcttattcctccatcaaaca 400



to top

>gb|AY147968.1| Rana macrocnemis macrocnemis cytochrome b (cytb) gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 465

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 378 atctcttattcctccatcaaaca 400



to top

>gb|AY147964.1| Rana holtzi cytochrome b (cytb) gene, partial cds; mitochondrial
           gene for mitochondrial product
          Length = 465

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 378 atctcttattcctccatcaaaca 400



to top

>gb|AY147960.1| Rana macrocnemis cytochrome b (cytb) gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 465

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 111 atctcttattcctccatcaaaca 133
           |||||||||||||||||||||||
Sbjct: 378 atctcttattcctccatcaaaca 400



to top

>gb|AF021076.1| Megarthrus americanus cytochrome b (cytb) gene, mitochondrial gene
           encoding mitochondrial protein, partial cds
          Length = 465

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 111 atctcttattcctccatcaaac 132
           ||||||||||||||||||||||
Sbjct: 185 atctcttattcctccatcaaac 206



to top

>gb|AC113587.16| Mus musculus chromosome 15, clone RP24-424I13, complete sequence
          Length = 191054

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 234    gggggacgctgttcctcttct 254
              |||||||||||||||||||||
Sbjct: 157842 gggggacgctgttcctcttct 157822



to top

>gb|DQ106808.1| Ephippiger provincialis clone Eprov7 cytochrome b (Cytb) gene,
           partial cds; mitochondrial
          Length = 427

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 113 ctcttattcctccatcaaaca 133
           |||||||||||||||||||||
Sbjct: 144 ctcttattcctccatcaaaca 164



to top

>gb|AC104833.6| Mus Musculus Strain C57BL6/J Chromosome 15 BAC, RP23-319B16, Complete
             Sequence, complete sequence
          Length = 171061

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 234   gggggacgctgttcctcttct 254
             |||||||||||||||||||||
Sbjct: 36422 gggggacgctgttcctcttct 36402



to top

>dbj|AK082224.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:C230026C11 product:hypothetical
            Beta tubulin containing protein, full insert sequence
          Length = 1819

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 234  gggggacgctgttcctcttct 254
            |||||||||||||||||||||
Sbjct: 1159 gggggacgctgttcctcttct 1139



to top

>dbj|AB201221.1| Microhyla ornata mitochondrial cytb gene for cytochrome b, partial
           cds, specimen_voucher:KUHE34324
          Length = 629

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 113 ctcttattcctccatcaaaca 133
           |||||||||||||||||||||
Sbjct: 456 ctcttattcctccatcaaaca 476



to top

>dbj|AB201218.1| Microhyla ornata mitochondrial cytb gene for cytochrome b, partial
           cds, specimen_voucher:KUHE34130
          Length = 625

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 113 ctcttattcctccatcaaaca 133
           |||||||||||||||||||||
Sbjct: 452 ctcttattcctccatcaaaca 472



to top

>dbj|AB201216.1| Microhyla ornata mitochondrial cytb gene for cytochrome b, partial
           cds, specimen_voucher:KUHE21982
          Length = 629

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 113 ctcttattcctccatcaaaca 133
           |||||||||||||||||||||
Sbjct: 456 ctcttattcctccatcaaaca 476



to top

>emb|AL136039.4|CNS01DVU Human chromosome 14 DNA sequence BAC R-799P8 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 174788

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 127   tcaaacataaggtagatcaaacata 151
             |||||||| ||||||||||||||||
Sbjct: 56048 tcaaacattaggtagatcaaacata 56024



to top

>ref|XM_775596.1| PREDICTED: Strongylocentrotus purpuratus similar to tudor domain
            containing 1 (LOC575181), mRNA
          Length = 7881

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 267  ttatcaccttcaggtccacc 286
            ||||||||||||||||||||
Sbjct: 5800 ttatcaccttcaggtccacc 5781



to top

>emb|AJ298865.1|XLA298865 Xenopus laevis mRNA for winged helix transcription factor (foxd3a
           gene)
          Length = 3240

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 78  aaacaacacactcgccagttttat 101
           |||||||||||||||| |||||||
Sbjct: 478 aaacaacacactcgcctgttttat 455



to top

>gb|AC011415.3| Homo sapiens chromosome 5 clone CTB-87P21, complete sequence
          Length = 116976

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 164   tctgctcccagaagtgcaag 183
             ||||||||||||||||||||
Sbjct: 94606 tctgctcccagaagtgcaag 94587



to top

>gb|AC149341.2| Phakopsora pachyrhizi clone JGIAFNA-25D19, complete sequence
          Length = 38997

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 112   tctcttattcctccatcaaa 131
             ||||||||||||||||||||
Sbjct: 21072 tctcttattcctccatcaaa 21091


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,034,846
Number of Sequences: 3902068
Number of extensions: 4034846
Number of successful extensions: 98591
Number of sequences better than 10.0: 77
Number of HSP's better than 10.0 without gapping: 77
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 98456
Number of HSP's gapped (non-prelim): 130
length of query: 504
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 482
effective length of database: 17,147,199,772
effective search space: 8264950290104
effective search space used: 8264950290104
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top