ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart39d03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC102127.11| Mus musculus chromosome 1, clone RP23-202A19, co... 40 5.5
2emb|AL445586.6| Human DNA sequence from clone RP11-352F21 on chr... 40 5.5
3gb|AC157812.4| Mus musculus chromosome 1, clone RP24-400L13, com... 40 5.5
4emb|AL163817.1|ATF18O22 Arabidopsis thaliana DNA chromosome 5, B... 40 5.5
5gb|AC099544.2| Homo sapiens chromosome 3 clone RP11-600G19, comp... 40 5.5
6gb|AC021785.10| Homo sapiens chromosome , clone RP11-21C17, comp... 40 5.5
7gb|AC182754.1| Gasterosteus aculeatus clone VMRC28-42C14, comple... 40 5.5
8gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome 40 5.5
9dbj|AB023113.1| Bombyx mori DNA, M1.80a RAPD sequence 40 5.5

>gb|AC102127.11| Mus musculus chromosome 1, clone RP23-202A19, complete sequence
          Length = 196674

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 166    aatcacttttggttgatcag 185
              ||||||||||||||||||||
Sbjct: 118460 aatcacttttggttgatcag 118479



to top

>emb|AL445586.6| Human DNA sequence from clone RP11-352F21 on chromosome 9, complete
              sequence
          Length = 198498

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 152    gaaaaattaacataaatcactttt 175
              |||||||||| |||||||||||||
Sbjct: 168555 gaaaaattaagataaatcactttt 168532



to top

>gb|AC157812.4| Mus musculus chromosome 1, clone RP24-400L13, complete sequence
          Length = 150328

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 166   aatcacttttggttgatcag 185
             ||||||||||||||||||||
Sbjct: 57898 aatcacttttggttgatcag 57917



to top

>emb|AL163817.1|ATF18O22 Arabidopsis thaliana DNA chromosome 5, BAC clone F18O22 (ESSA project)
          Length = 100269

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 80    actaaaaatcgaaaacacaa 99
             ||||||||||||||||||||
Sbjct: 71507 actaaaaatcgaaaacacaa 71526



to top

>gb|AC099544.2| Homo sapiens chromosome 3 clone RP11-600G19, complete sequence
          Length = 184019

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 82    taaaaatcgaaaacacaaac 101
             ||||||||||||||||||||
Sbjct: 79765 taaaaatcgaaaacacaaac 79746



to top

>gb|AC021785.10| Homo sapiens chromosome , clone RP11-21C17, complete sequence
          Length = 156232

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 55    taaatgagtcgtttttattg 74
             ||||||||||||||||||||
Sbjct: 43809 taaatgagtcgtttttattg 43828



to top

>gb|AC182754.1| Gasterosteus aculeatus clone VMRC28-42C14, complete sequence
          Length = 138028

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 158    ttaacataaatcacttttgg 177
              ||||||||||||||||||||
Sbjct: 133779 ttaacataaatcacttttgg 133798



to top

>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome
          Length = 7215267

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 75      gggatactaaaaatcgaaaa 94
               ||||||||||||||||||||
Sbjct: 7126959 gggatactaaaaatcgaaaa 7126978



to top

>dbj|AB023113.1| Bombyx mori DNA, M1.80a RAPD sequence
          Length = 771

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 281 cccagtaccaatactccatg 300
           ||||||||||||||||||||
Sbjct: 567 cccagtaccaatactccatg 548


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,484,841
Number of Sequences: 3902068
Number of extensions: 3484841
Number of successful extensions: 61741
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61721
Number of HSP's gapped (non-prelim): 20
length of query: 409
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 387
effective length of database: 17,147,199,772
effective search space: 6635966311764
effective search space used: 6635966311764
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top