ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart39c07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_648008.1| Entamoeba histolytica HM-1:IMSS hypothetical pr... 46 0.016
2gb|AY921645.1| Zea mays 12-oxo-phytodienoic acid reductase (OPR8... 40 0.99
3gb|AC125050.6| Mus musculus BAC clone RP23-372I18 from chromosom... 40 0.99
4emb|AL589846.5| Human DNA sequence from clone RP11-199O16 on chr... 40 0.99
5gb|AC000107.2|AC000107 Genomic sequence for Arabidopsis thaliana... 40 0.99
6dbj|AK106409.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 0.99
7gb|AY108381.1| Zea mays PCO088244 mRNA sequence 40 0.99
8gb|AC174930.1| Oryza sativa (japonica cultivar-group) BAC clone ... 40 0.99
9gb|AC150648.2| Mus musculus BAC clone RP23-235N5 from 7, complet... 40 0.99
10ref|NM_202428.1| Arabidopsis thaliana OPR1; 12-oxophytodienoate ... 38 3.9
11ref|NM_106318.3| Arabidopsis thaliana OPR1; 12-oxophytodienoate ... 38 3.9
12gb|BT020365.1| Arabidopsis thaliana At1g76680 gene, complete cds 38 3.9
13gb|AY921644.1| Zea mays 12-oxo-phytodienoic acid reductase (OPR7... 38 3.9
14emb|Z99109.2|BSUB0006 Bacillus subtilis complete genome (section... 38 3.9
15emb|Y10617.1|AT12OXOPR A.thaliana mRNA for 12-oxo-phytodienoate ... 38 3.9
16emb|CR759811.8| Zebrafish DNA sequence from clone CH211-190M18 i... 38 3.9
17emb|BX629343.11| Zebrafish DNA sequence from clone DKEY-66M17 in... 38 3.9
18gb|AC125469.3| Homo sapiens BAC clone RP11-761E16 from 4, comple... 38 3.9
19gb|AC113424.2| Homo sapiens chromosome 5 clone RP11-624C4, compl... 38 3.9
20gb|AY074874.1| Arabidopsis thaliana At1g76680/F28O16_5 mRNA, com... 38 3.9
21gb|AC000070.2| Homo sapiens Chromosome 22q11.2 Cosmid Clone 105a... 38 3.9
22gb|AC114734.4| Homo sapiens BAC clone CTD-2018D8 from 4, complet... 38 3.9
23gb|AC010718.5|AC010718 Arabidopsis thaliana chromosome 1 BAC F28... 38 3.9
24gb|AY087801.1| Arabidopsis thaliana clone 38527 mRNA, complete s... 38 3.9
25gb|AY106967.1| Zea mays PCO088243 mRNA sequence 38 3.9
26gb|U92460.1|ATU92460 Arabidopsis thaliana 12-oxophytodienoate re... 38 3.9
27dbj|D86376.1| Bacillus subtilis ArgF and med genes, partial and ... 38 3.9

>ref|XM_648008.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (94.t00028)
            partial mRNA
          Length = 1644

 Score = 46.1 bits (23), Expect = 0.016
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 14   caatatatggatcaatcattatttatg 40
            ||||||||| |||||||||||||||||
Sbjct: 1264 caatatatgaatcaatcattatttatg 1290



to top

>gb|AY921645.1| Zea mays 12-oxo-phytodienoic acid reductase (OPR8) mRNA, complete cds
          Length = 1529

 Score = 40.1 bits (20), Expect = 0.99
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 64   aacgggtagtcggtgtaaccgacgacgg 91
            ||||||||||| |||||||| |||||||
Sbjct: 1269 aacgggtagtccgtgtaaccaacgacgg 1242



to top

>gb|AC125050.6| Mus musculus BAC clone RP23-372I18 from chromosome 7, complete sequence
          Length = 199810

 Score = 40.1 bits (20), Expect = 0.99
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 39    tggttcaatgacacatcaag 58
             ||||||||||||||||||||
Sbjct: 70383 tggttcaatgacacatcaag 70364



to top

>emb|AL589846.5| Human DNA sequence from clone RP11-199O16 on chromosome 9, complete
             sequence
          Length = 44495

 Score = 40.1 bits (20), Expect = 0.99
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     ttttcacatggcaatatatg 22
             ||||||||||||||||||||
Sbjct: 17566 ttttcacatggcaatatatg 17547



to top

>gb|AC000107.2|AC000107 Genomic sequence for Arabidopsis thaliana BAC F17F8 from chromosome I,
             complete sequence
          Length = 102393

 Score = 40.1 bits (20), Expect = 0.99
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 17    tatatggatcaatcattatttatg 40
             ||||||||| ||||||||||||||
Sbjct: 27805 tatatggatgaatcattatttatg 27828



to top

>dbj|AK106409.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-H07, full
            insert sequence
          Length = 1360

 Score = 40.1 bits (20), Expect = 0.99
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 64   aacgggtagtcggtgtaaccgacgacgg 91
            ||||||||||||||||| ||| ||||||
Sbjct: 1150 aacgggtagtcggtgtagccggcgacgg 1123



to top

>gb|AY108381.1| Zea mays PCO088244 mRNA sequence
          Length = 694

 Score = 40.1 bits (20), Expect = 0.99
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 64  aacgggtagtcggtgtaaccgacgacgg 91
           ||||||||||| |||||||| |||||||
Sbjct: 434 aacgggtagtccgtgtaaccaacgacgg 407



to top

>gb|AC174930.1| Oryza sativa (japonica cultivar-group) BAC clone OSJNBa0043H01, from
             chromosome 4, complete sequence
          Length = 15426

 Score = 40.1 bits (20), Expect = 0.99
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 64    aacgggtagtcggtgtaaccgacgacgg 91
             ||||||||||||||||| ||| ||||||
Sbjct: 12779 aacgggtagtcggtgtagccggcgacgg 12806



to top

>gb|AC150648.2| Mus musculus BAC clone RP23-235N5 from 7, complete sequence
          Length = 190414

 Score = 40.1 bits (20), Expect = 0.99
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 39     tggttcaatgacacatcaag 58
              ||||||||||||||||||||
Sbjct: 156206 tggttcaatgacacatcaag 156187



to top

>ref|NM_202428.1| Arabidopsis thaliana OPR1; 12-oxophytodienoate reductase AT1G76680
            (OPR1) transcript variant AT1G76680.2 mRNA, complete cds
          Length = 1460

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 67   gggtagtcggtgtaaccgacgac 89
            ||||| |||||||||||||||||
Sbjct: 1242 gggtaatcggtgtaaccgacgac 1220



to top

>ref|NM_106318.3| Arabidopsis thaliana OPR1; 12-oxophytodienoate reductase AT1G76680
            (OPR1) transcript variant AT1G76680.1 mRNA, complete cds
          Length = 1451

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 67   gggtagtcggtgtaaccgacgac 89
            ||||| |||||||||||||||||
Sbjct: 1233 gggtaatcggtgtaaccgacgac 1211



to top

>gb|BT020365.1| Arabidopsis thaliana At1g76680 gene, complete cds
          Length = 1119

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 67   gggtagtcggtgtaaccgacgac 89
            ||||| |||||||||||||||||
Sbjct: 1097 gggtaatcggtgtaaccgacgac 1075



to top

>gb|AY921644.1| Zea mays 12-oxo-phytodienoic acid reductase (OPR7) mRNA, complete cds
          Length = 1594

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 69   gtagtcggtgtaaccgacgacgg 91
            |||||| ||||||||||||||||
Sbjct: 1400 gtagtccgtgtaaccgacgacgg 1378



to top

>emb|Z99109.2|BSUB0006 Bacillus subtilis complete genome (section 6 of 21): from 1011039 to
              1209781
          Length = 198743

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 3      ttttcacatggcaatatat 21
              |||||||||||||||||||
Sbjct: 196403 ttttcacatggcaatatat 196385



to top

>emb|Y10617.1|AT12OXOPR A.thaliana mRNA for 12-oxo-phytodienoate reductase
          Length = 1311

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 67   gggtagtcggtgtaaccgacgac 89
            ||||| |||||||||||||||||
Sbjct: 1162 gggtaatcggtgtaaccgacgac 1140



to top

>emb|CR759811.8| Zebrafish DNA sequence from clone CH211-190M18 in linkage group 13,
             complete sequence
          Length = 132853

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 6     tcacatggcaatatatgga 24
             |||||||||||||||||||
Sbjct: 82220 tcacatggcaatatatgga 82202



to top

>emb|BX629343.11| Zebrafish DNA sequence from clone DKEY-66M17 in linkage group 13,
              complete sequence
          Length = 207677

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 6      tcacatggcaatatatgga 24
              |||||||||||||||||||
Sbjct: 133388 tcacatggcaatatatgga 133370



to top

>gb|AC125469.3| Homo sapiens BAC clone RP11-761E16 from 4, complete sequence
          Length = 14706

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 3    ttttcacatggcaatatat 21
            |||||||||||||||||||
Sbjct: 1375 ttttcacatggcaatatat 1357



to top

>gb|AC113424.2| Homo sapiens chromosome 5 clone RP11-624C4, complete sequence
          Length = 194717

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 6      tcacatggcaatatatgga 24
              |||||||||||||||||||
Sbjct: 119751 tcacatggcaatatatgga 119733



to top

>gb|AY074874.1| Arabidopsis thaliana At1g76680/F28O16_5 mRNA, complete cds
          Length = 1252

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 67   gggtagtcggtgtaaccgacgac 89
            ||||| |||||||||||||||||
Sbjct: 1167 gggtaatcggtgtaaccgacgac 1145



to top

>gb|AC000070.2| Homo sapiens Chromosome 22q11.2 Cosmid Clone 105a In DGCR Region,
             complete sequence
          Length = 38699

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 17    tatatggatcaatcattatttat 39
             ||||||||| |||||||||||||
Sbjct: 28256 tatatggatgaatcattatttat 28278



to top

>gb|AC114734.4| Homo sapiens BAC clone CTD-2018D8 from 4, complete sequence
          Length = 78693

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 3     ttttcacatggcaatatat 21
             |||||||||||||||||||
Sbjct: 78068 ttttcacatggcaatatat 78050



to top

>gb|AC010718.5|AC010718 Arabidopsis thaliana chromosome 1 BAC F28O16 genomic sequence, complete
             sequence
          Length = 87684

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 67    gggtagtcggtgtaaccgacgac 89
             ||||| |||||||||||||||||
Sbjct: 15021 gggtaatcggtgtaaccgacgac 14999



to top

>gb|AY087801.1| Arabidopsis thaliana clone 38527 mRNA, complete sequence
          Length = 1280

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 67   gggtagtcggtgtaaccgacgac 89
            ||||| |||||||||||||||||
Sbjct: 1167 gggtaatcggtgtaaccgacgac 1145



to top

>gb|AY106967.1| Zea mays PCO088243 mRNA sequence
          Length = 765

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 69  gtagtcggtgtaaccgacgacgg 91
           |||||| ||||||||||||||||
Sbjct: 571 gtagtccgtgtaaccgacgacgg 549



to top

>gb|U92460.1|ATU92460 Arabidopsis thaliana 12-oxophytodienoate reductase OPR1 and
            12-oxophytodienoate reductase OPR2 genes, complete cds
          Length = 7079

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 67   gggtagtcggtgtaaccgacgac 89
            ||||| |||||||||||||||||
Sbjct: 4615 gggtaatcggtgtaaccgacgac 4593



to top

>dbj|D86376.1| Bacillus subtilis ArgF and med genes, partial and complete cds
          Length = 4608

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 3    ttttcacatggcaatatat 21
            |||||||||||||||||||
Sbjct: 4429 ttttcacatggcaatatat 4411


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 818,253
Number of Sequences: 3902068
Number of extensions: 818253
Number of successful extensions: 53644
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 53609
Number of HSP's gapped (non-prelim): 35
length of query: 91
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 70
effective length of database: 17,151,101,840
effective search space: 1200577128800
effective search space used: 1200577128800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top