ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart38e10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC165168.3| Mus musculus BAC clone RP23-12D3 from chromosome ... 42 0.19
2gb|AC127289.4| Mus musculus BAC clone RP23-359O14 from chromosom... 42 0.19
3gb|AC126052.4| Mus musculus BAC clone RP23-277H6 from 7, complet... 42 0.19
4gb|AF205517.1|AF205517 Pontederia cordata 26S ribosomal RNA gene... 40 0.74
5ref|XM_705868.1| Candida albicans SC5314 hypothetical protein (C... 38 2.9
6emb|AL353756.5| Human DNA sequence from clone RP11-415D9 on chro... 38 2.9
7gb|AC159336.13| Mus musculus 10 BAC RP24-430N21 (Roswell Park Ca... 38 2.9
8emb|AL928579.6| Mouse DNA sequence from clone RP23-302M15 on chr... 38 2.9
9emb|BX004857.10| Zebrafish DNA sequence from clone CH211-217I17,... 38 2.9
10emb|BX005456.6| Zebrafish DNA sequence from clone DKEY-192D15 in... 38 2.9
11gb|AC153852.9| Mus musculus 10 BAC RP23-136F8 (Roswell Park Canc... 38 2.9
12dbj|AK156855.1| Mus musculus activated spleen cDNA, RIKEN full-l... 38 2.9
13gb|AC010859.5| Homo sapiens chromosome , clone RP11-3D19, comple... 38 2.9
14dbj|AK030229.1| Mus musculus adult male testis cDNA, RIKEN full-... 38 2.9
15emb|AJ333591.1|HSA333591 Homo sapiens genomic sequence surroundi... 38 2.9
16emb|AJ337883.1|HSA337883 Homo sapiens genomic sequence surroundi... 38 2.9
17gb|AY688752.1| Frullania moniliata NADH dehydrogenase subunit 5 ... 38 2.9
18dbj|AP005791.2| Homo sapiens genomic DNA, chromosome 8q22, clone... 38 2.9
19emb|AL845485.16| Mouse DNA sequence from clone RP23-237D23 on ch... 38 2.9
20gb|AC122293.3| Mus musculus BAC clone RP23-257O9 from 10, comple... 38 2.9
21emb|AJ429531.1|SAR429531 Scrophularia arguta chloroplast atpE ge... 38 2.9

>gb|AC165168.3| Mus musculus BAC clone RP23-12D3 from chromosome 19, complete sequence
          Length = 215151

 Score = 42.1 bits (21), Expect = 0.19
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 18    tcaaaaaagggggggcaaaaa 38
             |||||||||||||||||||||
Sbjct: 30784 tcaaaaaagggggggcaaaaa 30764



to top

>gb|AC127289.4| Mus musculus BAC clone RP23-359O14 from chromosome 19, complete sequence
          Length = 203047

 Score = 42.1 bits (21), Expect = 0.19
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 18     tcaaaaaagggggggcaaaaa 38
              |||||||||||||||||||||
Sbjct: 108674 tcaaaaaagggggggcaaaaa 108654



to top

>gb|AC126052.4| Mus musculus BAC clone RP23-277H6 from 7, complete sequence
          Length = 202833

 Score = 42.1 bits (21), Expect = 0.19
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 17     ctcaaaaaagggggggcaaaa 37
              |||||||||||||||||||||
Sbjct: 146997 ctcaaaaaagggggggcaaaa 146977



to top

>gb|AF205517.1|AF205517 Pontederia cordata 26S ribosomal RNA gene, partial sequence
          Length = 993

 Score = 40.1 bits (20), Expect = 0.74
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 10  gccccccctcaaaaaagggggggc 33
           |||||||| |||||||||||||||
Sbjct: 765 gcccccccccaaaaaagggggggc 742



to top

>ref|XM_705868.1| Candida albicans SC5314 hypothetical protein (CaO19.10721), mRNA
          Length = 312

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 13  ccccctcaaaaaagggggg 31
           |||||||||||||||||||
Sbjct: 223 ccccctcaaaaaagggggg 205



to top

>emb|AL353756.5| Human DNA sequence from clone RP11-415D9 on chromosome 9, complete
              sequence
          Length = 146155

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 20     aaaaaagggggggcaaaaa 38
              |||||||||||||||||||
Sbjct: 137348 aaaaaagggggggcaaaaa 137330



to top

>gb|AC159336.13| Mus musculus 10 BAC RP24-430N21 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 180454

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 9      tgccccccctcaaaaaagg 27
              |||||||||||||||||||
Sbjct: 110613 tgccccccctcaaaaaagg 110595



to top

>emb|AL928579.6| Mouse DNA sequence from clone RP23-302M15 on chromosome 4, complete
              sequence
          Length = 184057

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 20     aaaaaagggggggcaaaaa 38
              |||||||||||||||||||
Sbjct: 108455 aaaaaagggggggcaaaaa 108473



to top

>emb|BX004857.10| Zebrafish DNA sequence from clone CH211-217I17, complete sequence
          Length = 155624

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 7     tttgccccccctcaaaaaa 25
             |||||||||||||||||||
Sbjct: 71335 tttgccccccctcaaaaaa 71317



to top

>emb|BX005456.6| Zebrafish DNA sequence from clone DKEY-192D15 in linkage group 20
             Contains the genes for two novel proteins similar to
             vertebrate NIMA (never in mitosis gene a)-related
             expressed kinase family, a novel gene and a CpG island,
             complete sequence
          Length = 105510

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 7     tttgccccccctcaaaaaa 25
             |||||||||||||||||||
Sbjct: 20664 tttgccccccctcaaaaaa 20682



to top

>gb|AC153852.9| Mus musculus 10 BAC RP23-136F8 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 222518

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 9    tgccccccctcaaaaaagg 27
            |||||||||||||||||||
Sbjct: 3444 tgccccccctcaaaaaagg 3426



to top

>dbj|AK156855.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830103I17 product:unclassifiable, full
            insert sequence
          Length = 2378

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 20   aaaaaagggggggcaaaaa 38
            |||||||||||||||||||
Sbjct: 1355 aaaaaagggggggcaaaaa 1373



to top

>gb|AC010859.5| Homo sapiens chromosome , clone RP11-3D19, complete sequence
          Length = 171301

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 20    aaaaaagggggggcaaaaa 38
             |||||||||||||||||||
Sbjct: 19398 aaaaaagggggggcaaaaa 19380



to top

>dbj|AK030229.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
            library, clone:4933426D11 product:unclassifiable, full
            insert sequence
          Length = 2235

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 20   aaaaaagggggggcaaaaa 38
            |||||||||||||||||||
Sbjct: 1225 aaaaaagggggggcaaaaa 1207



to top

>emb|AJ333591.1|HSA333591 Homo sapiens genomic sequence surrounding NotI site, clone
           NL6-FB13R
          Length = 653

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 26/27 (96%), Gaps = 1/27 (3%)
 Strand = Plus / Plus

                                      
Query: 6   ttttgccccccctcaaaaaaggggggg 32
           |||||||||||| ||||||||||||||
Sbjct: 529 ttttgccccccc-caaaaaaggggggg 554



to top

>emb|AJ337883.1|HSA337883 Homo sapiens genomic sequence surrounding NotI site, clone NB6-267C
          Length = 943

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 13  ccccctcaaaaaagggggg 31
           |||||||||||||||||||
Sbjct: 847 ccccctcaaaaaagggggg 829



to top

>gb|AY688752.1| Frullania moniliata NADH dehydrogenase subunit 5 (nad5) gene,
           complete sequence; mitochondrial
          Length = 1800

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 21  aaaaagggggggcaaaaac 39
           |||||||||||||||||||
Sbjct: 840 aaaaagggggggcaaaaac 858



to top

>dbj|AP005791.2| Homo sapiens genomic DNA, chromosome 8q22, clone: KB1357H4, complete
              sequence
          Length = 160208

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 20     aaaaaagggggggcaaaaa 38
              |||||||||||||||||||
Sbjct: 119133 aaaaaagggggggcaaaaa 119115



to top

>emb|AL845485.16| Mouse DNA sequence from clone RP23-237D23 on chromosome 2, complete
              sequence
          Length = 230213

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 18     tcaaaaaagggggggcaaa 36
              |||||||||||||||||||
Sbjct: 198340 tcaaaaaagggggggcaaa 198322



to top

>gb|AC122293.3| Mus musculus BAC clone RP23-257O9 from 10, complete sequence
          Length = 209942

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 20     aaaaaagggggggcaaaaa 38
              |||||||||||||||||||
Sbjct: 154173 aaaaaagggggggcaaaaa 154155



to top

>emb|AJ429531.1|SAR429531 Scrophularia arguta chloroplast atpE gene (partial), tRNA-Met gene
           and tRNA-Val gene
          Length = 1448

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 20  aaaaaagggggggcaaaaa 38
           |||||||||||||||||||
Sbjct: 920 aaaaaagggggggcaaaaa 902


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 275,413
Number of Sequences: 3902068
Number of extensions: 275413
Number of successful extensions: 30272
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 30231
Number of HSP's gapped (non-prelim): 42
length of query: 73
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 52
effective length of database: 17,151,101,840
effective search space: 891857295680
effective search space used: 891857295680
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top