ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart38c09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY123420.1| Triticum aestivum putative 40S ribosomal protein ... 579 e-162
2gb|AF479033.1| Triticum aestivum 40S ribosomal protein mRNA, par... 373 e-100
3gb|AY107461.1| Zea mays PCO108959 mRNA sequence 293 3e-76
4ref|XM_463024.1| Oryza sativa (japonica cultivar-group), OSJNBa0... 270 4e-69
5dbj|AK099146.1| Oryza sativa (japonica cultivar-group) cDNA clon... 270 4e-69
6dbj|AK061051.1| Oryza sativa (japonica cultivar-group) cDNA clon... 270 4e-69
7ref|XM_479106.1| Oryza sativa (japonica cultivar-group), mRNA 149 1e-32
8dbj|AK066905.1| Oryza sativa (japonica cultivar-group) cDNA clon... 149 1e-32
9gb|AY106013.1| Zea mays PCO066457 mRNA sequence 149 1e-32
10gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 141 3e-30
11dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 141 3e-30
12gb|AC146468.1| Oryza sativa (japonica cultivar-group) chromosome... 141 3e-30
13dbj|D38596.1|RICRPS3A Oryza sativa mRNA, partial homologous to ... 141 3e-30
14dbj|AB091077.1| Zinnia elegans ZeRPS3 mRNA for putative ribosoma... 139 1e-29
15ref|NM_122944.2| Arabidopsis thaliana structural constituent of ... 133 6e-28
16gb|AY098949.1| Arabidopsis thaliana AT5g35530/MOK9_14 mRNA, comp... 133 6e-28
17gb|AY058057.1| Arabidopsis thaliana AT5g35530/MOK9_14 mRNA, comp... 133 6e-28
18gb|AY084320.1| Arabidopsis thaliana clone 10394 mRNA, complete s... 129 1e-26
19gb|BT012908.1| Lycopersicon esculentum clone 114026F, mRNA sequence 109 9e-21
20gb|DQ241842.1| Solanum tuberosum clone 182H03 unknown mRNA 109 9e-21
21ref|NM_128718.3| Arabidopsis thaliana structural constituent of ... 92 2e-15
22gb|AY091208.1| Arabidopsis thaliana putative 40S ribosomal prote... 92 2e-15
23gb|AY046041.1| Arabidopsis thaliana putative 40S ribosomal prote... 92 2e-15
24gb|AY081517.1| Arabidopsis thaliana 40S ribosomal protein; conta... 92 2e-15
25gb|AY054622.1| Arabidopsis thaliana 40S ribosomal protein (At2g3... 92 2e-15
26gb|AY052749.1| Arabidopsis thaliana At2g31610/T9H9.13 mRNA, comp... 92 2e-15
27gb|AF378887.1|AF378887 Arabidopsis thaliana At2g31610/T9H9.13 mR... 92 2e-15
28emb|BX819975.1|CNS0A8H0 Arabidopsis thaliana Full-length cDNA Co... 92 2e-15
29gb|AC079038.3|AC079038 Oryza sativa chromosome 7 clone OSJNBb002... 86 1e-13
30dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
31dbj|AP006458.4| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
32emb|BX820098.1|CNS0A8HS Arabidopsis thaliana Full-length cDNA Co... 86 1e-13
33dbj|AP005895.3| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
34dbj|AB015477.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 84 5e-13
35emb|BX831845.1|CNS0A14G Arabidopsis thaliana Full-length cDNA Co... 78 3e-11
36gb|DQ294256.1| Solanum tuberosum clone 084G12 40S ribosomal prot... 76 1e-10
37emb|BX818844.1|CNS0A8YC Arabidopsis thaliana Full-length cDNA Co... 68 3e-08
38gb|AC146759.29| Medicago truncatula clone mth2-173e19, complete ... 64 5e-07
39dbj|AP004944.1| Lotus japonicus genomic DNA, chromosome 1, clone... 62 2e-06
40gb|AC007071.7| Arabidopsis thaliana chromosome 2 clone T9H9 map ... 60 7e-06
41ref|NM_115247.2| Arabidopsis thaliana nucleic acid binding / str... 56 1e-04
42gb|AY059090.1| Arabidopsis thaliana putative ribosomal protein S... 56 1e-04
43gb|AY035022.1| Arabidopsis thaliana putative ribosomal protein S... 56 1e-04
44emb|AL132960.2|ATF5K20 Arabidopsis thaliana DNA chromosome 3, BA... 56 1e-04
45gb|AF428405.1|AF428405 Arabidopsis thaliana AT3g53870/F5K20_170 ... 56 1e-04
46emb|BX824880.1|CNS0A5OP Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
47emb|BX823126.1|CNS0A5V8 Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
48gb|AY088808.1| Arabidopsis thaliana clone 9568 mRNA, complete se... 56 1e-04
49ref|XM_745219.1| Aspergillus fumigatus Af293 40s ribosomal prote... 54 5e-04
50ref|XM_566546.1| Cryptococcus neoformans var. neoformans JEC21 r... 52 0.002
51emb|CR733948.2|CNS0GT3F Tetraodon nigroviridis full-length cDNA 52 0.002
52emb|CR732997.2|CNS0GSHS Tetraodon nigroviridis full-length cDNA 52 0.002
53emb|CR732118.2|CNS0GRUJ Tetraodon nigroviridis full-length cDNA 52 0.002
54emb|CR727128.2|CNS0GNZY Tetraodon nigroviridis full-length cDNA 52 0.002
55emb|CR725578.1|CNS0GMSW Tetraodon nigroviridis full-length cDNA 52 0.002
56emb|CR720047.2|CNS0GIJ9 Tetraodon nigroviridis full-length cDNA 52 0.002
57emb|CR722968.2|CNS0GKSE Tetraodon nigroviridis full-length cDNA 52 0.002
58emb|CR721986.2|CNS0GK14 Tetraodon nigroviridis full-length cDNA 52 0.002
59emb|CR721973.2|CNS0GK0R Tetraodon nigroviridis full-length cDNA 52 0.002
60emb|CR720943.2|CNS0GJ85 Tetraodon nigroviridis full-length cDNA 52 0.002
61emb|CR720588.2|CNS0GIYA Tetraodon nigroviridis full-length cDNA 52 0.002
62emb|CR720528.2|CNS0GIWM Tetraodon nigroviridis full-length cDNA 52 0.002
63emb|CR718492.2|CNS0GHC2 Tetraodon nigroviridis full-length cDNA 52 0.002
64emb|CR718473.2|CNS0GHBJ Tetraodon nigroviridis full-length cDNA 52 0.002
65emb|CR717704.2|CNS0GGQ6 Tetraodon nigroviridis full-length cDNA 52 0.002
66emb|CR717299.2|CNS0GGEX Tetraodon nigroviridis full-length cDNA 52 0.002
67emb|CR717118.2|CNS0GG9Z Tetraodon nigroviridis full-length cDNA 52 0.002
68emb|CR716945.2|CNS0GG56 Tetraodon nigroviridis full-length cDNA 52 0.002
69emb|CR716173.2|CNS0GFJQ Tetraodon nigroviridis full-length cDNA 52 0.002
70emb|CR716064.2|CNS0GFGS Tetraodon nigroviridis full-length cDNA 52 0.002
71emb|CR715921.2|CNS0GFCT Tetraodon nigroviridis full-length cDNA 52 0.002
72emb|CR714979.2|CNS0GEMN Tetraodon nigroviridis full-length cDNA 52 0.002
73emb|CR714034.2|CNS0GDWE Tetraodon nigroviridis full-length cDNA 52 0.002
74emb|CR710531.2|CNS0GB73 Tetraodon nigroviridis full-length cDNA 52 0.002
75emb|CR710154.2|CNS0GAWM Tetraodon nigroviridis full-length cDNA 52 0.002
76emb|CR708944.2|CNS0G9Z0 Tetraodon nigroviridis full-length cDNA 52 0.002
77emb|CR705890.2|CNS0G7M6 Tetraodon nigroviridis full-length cDNA 52 0.002
78emb|CR707049.2|CNS0G8ID Tetraodon nigroviridis full-length cDNA 52 0.002
79emb|CR707000.2|CNS0G8H0 Tetraodon nigroviridis full-length cDNA 52 0.002
80emb|CR705879.2|CNS0G7LV Tetraodon nigroviridis full-length cDNA 52 0.002
81emb|CR705519.2|CNS0G7BV Tetraodon nigroviridis full-length cDNA 52 0.002
82emb|CR705142.2|CNS0G71E Tetraodon nigroviridis full-length cDNA 52 0.002
83emb|CR703509.2|CNS0G5S1 Tetraodon nigroviridis full-length cDNA 52 0.002
84emb|CR702546.2|CNS0G51A Tetraodon nigroviridis full-length cDNA 52 0.002
85emb|CR701940.2|CNS0G4KG Tetraodon nigroviridis full-length cDNA 52 0.002
86emb|CR701500.2|CNS0G488 Tetraodon nigroviridis full-length cDNA 52 0.002
87emb|CR701498.2|CNS0G486 Tetraodon nigroviridis full-length cDNA 52 0.002
88emb|CR691318.2|CNS0FWDE Tetraodon nigroviridis full-length cDNA 52 0.002
89emb|CR696663.2|CNS0G0HV Tetraodon nigroviridis full-length cDNA 52 0.002
90emb|CR695909.2|CNS0FZWX Tetraodon nigroviridis full-length cDNA 52 0.002
91emb|CR695523.2|CNS0FZM7 Tetraodon nigroviridis full-length cDNA 52 0.002
92emb|CR695491.2|CNS0FZLB Tetraodon nigroviridis full-length cDNA 52 0.002
93emb|CR693485.2|CNS0FY1L Tetraodon nigroviridis full-length cDNA 52 0.002
94emb|CR693322.2|CNS0FXX2 Tetraodon nigroviridis full-length cDNA 52 0.002
95emb|CR693236.2|CNS0FXUO Tetraodon nigroviridis full-length cDNA 52 0.002
96emb|CR692761.2|CNS0FXHH Tetraodon nigroviridis full-length cDNA 52 0.002
97emb|CR692671.2|CNS0FXEZ Tetraodon nigroviridis full-length cDNA 52 0.002
98emb|CR690335.2|CNS0FVM3 Tetraodon nigroviridis full-length cDNA 52 0.002
99emb|CR690227.2|CNS0FVJ3 Tetraodon nigroviridis full-length cDNA 52 0.002
100emb|CR687816.2|CNS0FTO4 Tetraodon nigroviridis full-length cDNA 52 0.002
101emb|CR685672.2|CNS0FS0K Tetraodon nigroviridis full-length cDNA 52 0.002
102emb|CR684111.2|CNS0FQT7 Tetraodon nigroviridis full-length cDNA 52 0.002
103emb|CR683013.2|CNS0FPYP Tetraodon nigroviridis full-length cDNA 52 0.002
104emb|CR682931.1|CNS0FPWF Tetraodon nigroviridis full-length cDNA 52 0.002
105emb|CR682564.2|CNS0FPM8 Tetraodon nigroviridis full-length cDNA 52 0.002
106emb|CR681592.2|CNS0FOV8 Tetraodon nigroviridis full-length cDNA 52 0.002
107emb|CR681108.2|CNS0FOHS Tetraodon nigroviridis full-length cDNA 52 0.002
108emb|CR681368.2|CNS0FOP0 Tetraodon nigroviridis full-length cDNA 52 0.002
109emb|CR680023.2|CNS0FNNN Tetraodon nigroviridis full-length cDNA 52 0.002
110emb|CR678768.2|CNS0FMOS Tetraodon nigroviridis full-length cDNA 52 0.002
111emb|CR676931.2|CNS0FLA7 Tetraodon nigroviridis full-length cDNA 52 0.002
112emb|CR674862.2|CNS0FJP0 Tetraodon nigroviridis full-length cDNA 52 0.002
113emb|CR674066.2|CNS0FJ2W Tetraodon nigroviridis full-length cDNA 52 0.002
114emb|CR670148.2|CNS0FG22 Tetraodon nigroviridis full-length cDNA 52 0.002
115emb|CR669238.2|CNS0FFCS Tetraodon nigroviridis full-length cDNA 52 0.002
116emb|CR668609.2|CNS0FEVB Tetraodon nigroviridis full-length cDNA 52 0.002
117emb|CR668354.2|CNS0FEO8 Tetraodon nigroviridis full-length cDNA 52 0.002
118emb|CR668281.2|CNS0FEM7 Tetraodon nigroviridis full-length cDNA 52 0.002
119emb|CR667570.2|CNS0FE2G Tetraodon nigroviridis full-length cDNA 52 0.002
120emb|CR667442.2|CNS0FDYW Tetraodon nigroviridis full-length cDNA 52 0.002
121emb|CR667436.2|CNS0FDYQ Tetraodon nigroviridis full-length cDNA 52 0.002
122emb|CR662572.2|CNS0FA7M Tetraodon nigroviridis full-length cDNA 52 0.002
123emb|CR662555.2|CNS0FA75 Tetraodon nigroviridis full-length cDNA 52 0.002
124emb|CR661602.2|CNS0F9GO Tetraodon nigroviridis full-length cDNA 52 0.002
125emb|CR658012.2|CNS0F6OY Tetraodon nigroviridis full-length cDNA 52 0.002
126emb|CR660736.2|CNS0F8SM Tetraodon nigroviridis full-length cDNA 52 0.002
127emb|CR659660.2|CNS0F7YQ Tetraodon nigroviridis full-length cDNA 52 0.002
128emb|CR658791.2|CNS0F7AL Tetraodon nigroviridis full-length cDNA 52 0.002
129emb|CR657579.2|CNS0F6CX Tetraodon nigroviridis full-length cDNA 52 0.002
130emb|CR653000.2|CNS0F2TQ Tetraodon nigroviridis full-length cDNA 52 0.002
131emb|CR651572.2|CNS0F1Q2 Tetraodon nigroviridis full-length cDNA 52 0.002
132emb|CR650942.2|CNS0F18K Tetraodon nigroviridis full-length cDNA 52 0.002
133emb|CR649707.2|CNS0F0A9 Tetraodon nigroviridis full-length cDNA 52 0.002
134emb|CR649423.2|CNS0F02D Tetraodon nigroviridis full-length cDNA 52 0.002
135emb|CR649142.2|CNS0EZUK Tetraodon nigroviridis full-length cDNA 52 0.002
136emb|CR647678.2|CNS0EYPW Tetraodon nigroviridis full-length cDNA 52 0.002
137emb|CR643232.2|CNS0EVAE Tetraodon nigroviridis full-length cDNA 52 0.002
138emb|CR645116.2|CNS0EWQQ Tetraodon nigroviridis full-length cDNA 52 0.002
139emb|CR645008.2|CNS0EWNQ Tetraodon nigroviridis full-length cDNA 52 0.002
140emb|CR644758.2|CNS0EWGS Tetraodon nigroviridis full-length cDNA 52 0.002
141emb|CR642184.2|CNS0EUHA Tetraodon nigroviridis full-length cDNA 52 0.002
142emb|CR642006.2|CNS0EUCC Tetraodon nigroviridis full-length cDNA 52 0.002
143emb|CR641349.2|CNS0ETU3 Tetraodon nigroviridis full-length cDNA 52 0.002
144emb|CR641032.2|CNS0ETLA Tetraodon nigroviridis full-length cDNA 52 0.002
145emb|CR639385.2|CNS0ESBJ Tetraodon nigroviridis full-length cDNA 52 0.002
146emb|CR638796.2|CNS0ERV6 Tetraodon nigroviridis full-length cDNA 52 0.002
147emb|CR637247.2|CNS0EQO5 Tetraodon nigroviridis full-length cDNA 52 0.002
148emb|CR637338.2|CNS0EQQO Tetraodon nigroviridis full-length cDNA 52 0.002
149emb|CR636161.2|CNS0EPTZ Tetraodon nigroviridis full-length cDNA 52 0.002
150emb|CR634906.2|CNS0EOV4 Tetraodon nigroviridis full-length cDNA 52 0.002
151emb|CR634367.2|CNS0EOG5 Tetraodon nigroviridis full-length cDNA 52 0.002
152gb|DQ122868.1| Chlamydomonas incerta 40S ribosomal protein S3 mR... 52 0.002
153emb|CR679463.2|CNS0FN83 Tetraodon nigroviridis full-length cDNA 50 0.007
154ref|XM_754010.1| Ustilago maydis 521 hypothetical protein (UM029... 48 0.028
155gb|AF402810.1| Ictalurus punctatus 40S ribosomal protein S3 mRNA... 48 0.028
156gb|AY521669.1| Pseudopleuronectes americanus 40S ribosomal prote... 48 0.028
157gb|AY394937.1| Danio rerio clone RK045A1H03 ribosomal protein S3... 46 0.11
158gb|AY389945.1| Latimeria chalumnae ribosomal protein S3 mRNA, pa... 46 0.11
159ref|NM_201153.1| Danio rerio ribosomal protein S3 (rps3), mRNA 46 0.11
160gb|BC045902.1| Danio rerio ribosomal protein S3, mRNA (cDNA clon... 46 0.11
161gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chr... 44 0.44
162gb|BC061265.1| Xenopus tropicalis ribosomal protein S3, mRNA (cD... 44 0.44
163ref|XM_385609.1| Gibberella zeae PH-1 chromosome 3 hypothetical ... 44 0.44
164emb|V01441.1|XLRIB4 Fragment of Xenopus laevis mRNA for ribosoma... 44 0.44
165ref|NM_203788.1| Xenopus tropicalis ribosomal protein S3 (MGC756... 44 0.44
166emb|Z34529.1|XLRIBS1R X.laevis rpS1b mRNA for ribosomal protein S1 44 0.44
167emb|CR848247.2| Xenopus tropicalis finished cDNA, clone TTpA010a01 44 0.44
168ref|XM_527224.1| PREDICTED: Pan troglodytes similar to ribosomal... 42 1.8
169gb|BC078664.1| Homo sapiens cDNA clone IMAGE:3941503, containing... 42 1.8
170gb|BC034149.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clo... 42 1.8
171gb|BC003137.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clo... 42 1.8
172ref|XM_656599.1| Aspergillus nidulans FGSC A4 hypothetical prote... 42 1.8
173gb|BC100284.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clo... 42 1.8
174gb|BC017103.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clo... 42 1.8
175gb|BC029981.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clo... 42 1.8
176ref|NM_001005.3| Homo sapiens ribosomal protein S3 (RPS3), mRNA 42 1.8
177emb|CR861393.1| Pongo pygmaeus mRNA; cDNA DKFZp459J022 (from clo... 42 1.8
178emb|CR623585.1| full-length cDNA clone CS0DA007YC19 of Neuroblas... 42 1.8
179emb|CR620902.1| full-length cDNA clone CS0DJ012YN02 of T cells (... 42 1.8
180emb|CR620201.1| full-length cDNA clone CS0DL012YJ20 of B cells (... 42 1.8
181emb|CR619698.1| full-length cDNA clone CS0DL005YA23 of B cells (... 42 1.8
182emb|CR617487.1| full-length cDNA clone CS0DK010YL21 of HeLa cell... 42 1.8
183emb|CR611679.1| full-length cDNA clone CS0DB002YE09 of Neuroblas... 42 1.8
184emb|CR610898.1| full-length cDNA clone CS0DD004YP10 of Neuroblas... 42 1.8
185emb|CR610850.1| full-length cDNA clone CS0DH003YE11 of T cells (... 42 1.8
186emb|CR611021.1| full-length cDNA clone CS0DL002YG06 of B cells (... 42 1.8
187emb|CR609618.1| full-length cDNA clone CS0DI083YP04 of Placenta ... 42 1.8
188emb|CR607881.1| full-length cDNA clone CS0DF032YC19 of Fetal bra... 42 1.8
189emb|CR608382.1| full-length cDNA clone CS0DM008YP04 of Fetal liv... 42 1.8
190emb|CR606914.1| full-length cDNA clone CS0DN003YN07 of Adult bra... 42 1.8
191emb|CR599459.1| full-length cDNA clone CS0DA012YB22 of Neuroblas... 42 1.8
192emb|CR599018.1| full-length cDNA clone CS0DK010YN19 of HeLa cell... 42 1.8
193emb|CR598363.1| full-length cDNA clone CS0CAP007YJ19 of Thymus o... 42 1.8
194emb|CR598084.1| full-length cDNA clone CS0DD009YH06 of Neuroblas... 42 1.8
195emb|CR597126.1| full-length cDNA clone CS0DK011YF16 of HeLa cell... 42 1.8
196emb|CR595698.1| full-length cDNA clone CS0DL005YD17 of B cells (... 42 1.8
197emb|CR593831.1| full-length cDNA clone CS0DI031YM23 of Placenta ... 42 1.8
198emb|CR591204.1| full-length cDNA clone CS0DC019YA14 of Neuroblas... 42 1.8
199gb|S42658.1| S3 ribosomal protein [human, colon, mRNA, 826 nt] 42 1.8
200gb|BC013196.1|BC013196 Homo sapiens, clone IMAGE:4347401, mRNA, ... 42 1.8
201gb|BC003577.1|BC003577 Homo sapiens, clone IMAGE:3544292, mRNA, ... 42 1.8
202dbj|AK223048.1| Homo sapiens mRNA for ribosomal protein S3 varia... 42 1.8
203ref|NM_001009239.1| Rattus norvegicus ribosomal protein S3 (Rps3... 42 1.8
204gb|AC131235.4| Homo sapiens 3 BAC RP11-778D9 (Roswell Park Cance... 42 1.8
205ref|XM_575143.1| PREDICTED: Rattus norvegicus similar to 40S rib... 42 1.8
206gb|AY892063.1| Synthetic construct Homo sapiens clone FLH027749.... 42 1.8
207gb|BC071917.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clo... 42 1.8
208emb|X51536.1|RRRPS3 Rat mRNA for ribosomal protein S3 42 1.8
209gb|DQ206605.1| Monosiga brevicollis isolate TOA26 ribosomal prot... 42 1.8
210gb|BC013231.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clo... 42 1.8
211gb|U14992.1|HSU14992 Human IMR-90 ribosomal protein S3 (rpS3) mR... 42 1.8
212gb|U14991.1|HSU14991 Human XP2NE ribosomal protein S3 (rpS3) mRN... 42 1.8
213gb|U14990.1|HSU14990 Human XP1PO ribosomal protein S3 (rpS3) mRN... 42 1.8
214gb|BC088450.1| Rattus norvegicus ribosomal protein S3, mRNA (cDN... 42 1.8
215emb|X55715.1|HSHUMS3 Human Hums3 mRNA for 40S ribosomal protein s3 42 1.8
216gb|AC078872.13| Homo sapiens 12q BAC RP11-542G14 (Roswell Park C... 42 1.8
217dbj|AB062288.1| Homo sapiens OK/SW-cl.26 mRNA for IMR-90 ribosom... 42 1.8
218ref|XM_593742.2| PREDICTED: Bos taurus similar to serologically ... 40 6.9
219ref|XM_360299.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 6.9
220gb|AC093458.6| Homo sapiens BAC clone RP11-445N20 from 7, comple... 40 6.9
221ref|XM_784326.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 6.9
222emb|AL513332.9| Human DNA sequence from clone RP11-58B8 on chrom... 40 6.9
223gb|CP000316.1| Polaromonas sp. JS666, complete genome 40 6.9
224ref|XM_502846.1| Yarrowia lipolytica CLIB122, YALI0D15114g predi... 40 6.9
225emb|AL356954.16| Human DNA sequence from clone RP11-520F24 on ch... 40 6.9
226gb|AC134516.1| Oryza sativa (japonica cultivar-group) chromosome... 40 6.9
227ref|XM_788097.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 6.9
228emb|BX842627.1| Neurospora crassa DNA linkage group I BAC clone ... 40 6.9
229gb|AC007286.18| Homo sapiens 12q15 BAC RPCI11-298M11 (Roswell Pa... 40 6.9
230gb|AC116926.1| Genomic sequence for Oryza sativa (japonica culti... 40 6.9
231gb|AC023163.25| Homo sapiens 12 BAC RP11-239B4 (Roswell Park Can... 40 6.9
232dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
233gb|AC006582.13|AC006582 Pan troglodytes 12cp12 BAC RPCI43-77C18 ... 40 6.9
234emb|CR555302.7| Zebrafish DNA sequence from clone CH211-212C19 i... 40 6.9
235gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 6.9
236emb|AL928672.14| Zebrafish DNA sequence from clone CH211-136O4, ... 40 6.9
237emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 40 6.9

>gb|AY123420.1| Triticum aestivum putative 40S ribosomal protein S3 mRNA, complete
           cds
          Length = 1004

 Score =  579 bits (292), Expect = e-162
 Identities = 373/399 (93%), Gaps = 2/399 (0%)
 Strand = Plus / Minus

                                                                       
Query: 116 aggtaaccaaacgttgcatagcccac--ttgtcacaaggataggaaacaagctaggacca 173
           |||||||||| ||||||||||||| |  || ||||| |||||| |||| ||||| |||||
Sbjct: 873 aggtaaccaagcgttgcatagccctcgcttatcacagggatagaaaactagctacgacca 814

                                                                       
Query: 174 aaatgatgtgccgtttcatggtctgcttgcactactgggagtttaggcctcaatcaaagc 233
           |||||||||| ||||||||||||||||||| ||||||||| ||||| |||||| ||||||
Sbjct: 813 aaatgatgtgacgtttcatggtctgcttgctctactgggactttagacctcaaccaaagc 754

                                                                       
Query: 234 cggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcagggg 293
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 753 cggggggcgcagctcgttctcctccttcggggggtggatggtgacgaggtcaggcagcgg 694

                                                                       
Query: 294 ggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatacc 353
            |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 693 agtggtagggccaagcttgcccttggggtcccagtcaagcataatcttcaccttgatacc 634

                                                                       
Query: 354 aagaacgccctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacggg 413
           ||||||||||||||||||||||||||| ||||| || |||||||||||||| ||||||||
Sbjct: 633 aagaacgccctgtctgagaagaacgtgcctaactgcagcatcaatgtactcgttgacggg 574

                                                                       
Query: 414 ctgaccagatgagatcatgtagccgtccttgaacttcatggacttcgccctctgggccct 473
           ||||||||||||||||||||||||||||||||||||||| ||||| || |||||||||||
Sbjct: 573 ctgaccagatgagatcatgtagccgtccttgaacttcatcgacttggctctctgggccct 514

                                                  
Query: 474 aagcttgccactcacaatgacctcacaacccttagcacc 512
            ||||||||||||||||||||||||||||||||||||||
Sbjct: 513 gagcttgccactcacaatgacctcacaacccttagcacc 475



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 47  aaacttagtttaaacgaaattaaaatggcagcataacatagaa 89
           ||||||||||||||||||||||| || ||||||| ||| ||||
Sbjct: 941 aaacttagtttaaacgaaattaacatagcagcattacacagaa 899



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 80  taacatagaagcattacacataaacttttgt 110
           |||||||| ||||||||||| ||||||||||
Sbjct: 921 taacatagcagcattacacagaaacttttgt 891



to top

>gb|AF479033.1| Triticum aestivum 40S ribosomal protein mRNA, partial cds
          Length = 240

 Score =  373 bits (188), Expect = e-100
 Identities = 224/236 (94%)
 Strand = Plus / Minus

                                                                       
Query: 216 ttaggcctcaatcaaagccggggggcgcagctcgtcctcctccttcggggggtggatggt 275
           |||| |||||| ||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 240 ttagacctcaaccaaagccggtgggcgcagctcgtcctcctccttcggggggtggatggt 181

                                                                       
Query: 276 gacgaggtcaggcaggggggtggtagggccaagtttgcccttggggtcccagtcaagcat 335
           ||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 180 gacaaggtcaggcagcggggtggtagggccaagcttgcccttggggtcccagtcaagcat 121

                                                                       
Query: 336 aatcttcaccttgataccaagaacgccctgtctgagaagaacgtgtctaacagctgcatc 395
           ||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||
Sbjct: 120 aatcttcaccttgataccaagaacgccctgtctgagaagaacgtgcctaactgcagcatc 61

                                                                   
Query: 396 aatgtactcattgacgggctgaccagatgagatcatgtagccgtccttgaacttca 451
           ||||||||| || |||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 60  aatgtactcgttaacgggctgaccagatgagatcatgtacccgtccttgaacttca 5



to top

>gb|AY107461.1| Zea mays PCO108959 mRNA sequence
          Length = 794

 Score =  293 bits (148), Expect = 3e-76
 Identities = 247/280 (88%)
 Strand = Plus / Minus

                                                                       
Query: 233 ccggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcaggg 292
           |||| |||||| |||||||||| |||||||||| ||||||||| || ||||| || || |
Sbjct: 478 ccggagggcgcggctcgtcctcgtccttcggggtgtggatggtcaccaggtccggaagag 419

                                                                       
Query: 293 gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 352
           | ||| | |||||||  |||||||| ||||||||||||||||| ||||||||||||||||
Sbjct: 418 gagtgatcgggccaaccttgcccttcgggtcccagtcaagcatgatcttcaccttgatac 359

                                                                       
Query: 353 caagaacgccctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgg 412
           | ||||| ||||||||||||||||||||||| ||||| |  ||||||||||| || || |
Sbjct: 358 cgagaacaccctgtctgagaagaacgtgtctcacagccgagtcaatgtactcgttcactg 299

                                                                       
Query: 413 gctgaccagatgagatcatgtagccgtccttgaacttcatggacttcgccctctgggccc 472
           ||||||||||||||||||||||||| |||||||||||||||||||| || || |||||||
Sbjct: 298 gctgaccagatgagatcatgtagccatccttgaacttcatggacttggctctttgggccc 239

                                                   
Query: 473 taagcttgccactcacaatgacctcacaacccttagcacc 512
           | ||||| ||||||||||| |||||||||||||| |||||
Sbjct: 238 tgagctttccactcacaatcacctcacaacccttggcacc 199



to top

>ref|XM_463024.1| Oryza sativa (japonica cultivar-group), OSJNBa0008D12.4 mRNA
          Length = 1112

 Score =  270 bits (136), Expect = 4e-69
 Identities = 244/280 (87%)
 Strand = Plus / Minus

                                                                       
Query: 233 ccggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcaggg 292
           |||| ||||||||||| ||||||||||| || |  |||||||| || || || ||||| |
Sbjct: 780 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 721

                                                                       
Query: 293 gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 352
           ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 720 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 661

                                                                       
Query: 353 caagaacgccctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgg 412
           ||||||| |||||||| || || |||||||| ||||| |  ||||||||||||||||| |
Sbjct: 660 caagaacaccctgtctcaggagcacgtgtctcacagccgagtcaatgtactcattgactg 601

                                                                       
Query: 413 gctgaccagatgagatcatgtagccgtccttgaacttcatggacttcgccctctgggccc 472
           |||||||||||||||||||||| || |||||||||||||||||||| || || |||||||
Sbjct: 600 gctgaccagatgagatcatgtaaccatccttgaacttcatggacttggctctttgggccc 541

                                                   
Query: 473 taagcttgccactcacaatgacctcacaacccttagcacc 512
           | ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 540 tgagctttccacttacaatgacctcgcaacccttggcacc 501



to top

>dbj|AK099146.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023061B16, full
           insert sequence
          Length = 1054

 Score =  270 bits (136), Expect = 4e-69
 Identities = 244/280 (87%)
 Strand = Plus / Minus

                                                                       
Query: 233 ccggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcaggg 292
           |||| ||||||||||| ||||||||||| || |  |||||||| || || || ||||| |
Sbjct: 790 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 731

                                                                       
Query: 293 gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 352
           ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 730 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 671

                                                                       
Query: 353 caagaacgccctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgg 412
           ||||||| |||||||| || || |||||||| ||||| |  ||||||||||||||||| |
Sbjct: 670 caagaacaccctgtctcaggagcacgtgtctcacagccgagtcaatgtactcattgactg 611

                                                                       
Query: 413 gctgaccagatgagatcatgtagccgtccttgaacttcatggacttcgccctctgggccc 472
           |||||||||||||||||||||| || |||||||||||||||||||| || || |||||||
Sbjct: 610 gctgaccagatgagatcatgtaaccatccttgaacttcatggacttggctctttgggccc 551

                                                   
Query: 473 taagcttgccactcacaatgacctcacaacccttagcacc 512
           | ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 550 tgagctttccacttacaatgacctcgcaacccttggcacc 511



to top

>dbj|AK061051.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-G04, full
           insert sequence
          Length = 1084

 Score =  270 bits (136), Expect = 4e-69
 Identities = 244/280 (87%)
 Strand = Plus / Minus

                                                                       
Query: 233 ccggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcaggg 292
           |||| ||||||||||| ||||||||||| || |  |||||||| || || || ||||| |
Sbjct: 792 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 733

                                                                       
Query: 293 gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 352
           ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 732 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 673

                                                                       
Query: 353 caagaacgccctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgg 412
           ||||||| |||||||| || || |||||||| ||||| |  ||||||||||||||||| |
Sbjct: 672 caagaacaccctgtctcaggagcacgtgtctcacagccgagtcaatgtactcattgactg 613

                                                                       
Query: 413 gctgaccagatgagatcatgtagccgtccttgaacttcatggacttcgccctctgggccc 472
           |||||||||||||||||||||| || |||||||||||||||||||| || || |||||||
Sbjct: 612 gctgaccagatgagatcatgtaaccatccttgaacttcatggacttggctctttgggccc 553

                                                   
Query: 473 taagcttgccactcacaatgacctcacaacccttagcacc 512
           | ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 552 tgagctttccacttacaatgacctcgcaacccttggcacc 513



to top

>ref|XM_479106.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 926

 Score =  149 bits (75), Expect = 1e-32
 Identities = 171/203 (84%)
 Strand = Plus / Minus

                                                                       
Query: 310 ttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtctg 369
           |||||||| || ||||| |||||||||||||| ||||| ||||| || || |||||||| 
Sbjct: 678 ttgcccttcggatcccaatcaagcataatcttgaccttaatacccagcacaccctgtctc 619

                                                                       
Query: 370 agaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccagatgagatc 429
           |||||||| ||||||||||| |  ||||| |||   || || || | |||||| || |||
Sbjct: 618 agaagaacatgtctaacagcagagtcaatatacaagttaacaggataaccagaagaaatc 559

                                                                       
Query: 430 atgtagccgtccttgaacttcatggacttcgccctctgggccctaagcttgccactcaca 489
           ||||| |||||||||||||||||||| || || | ||| ||||||||||| |||||||||
Sbjct: 558 atgtatccgtccttgaacttcatggatttagcacgctgagccctaagcttcccactcaca 499

                                  
Query: 490 atgacctcacaacccttagcacc 512
           || |||||||| |||||||||||
Sbjct: 498 ataacctcacagcccttagcacc 476



to top

>dbj|AK066905.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013092O21, full
           insert sequence
          Length = 926

 Score =  149 bits (75), Expect = 1e-32
 Identities = 171/203 (84%)
 Strand = Plus / Minus

                                                                       
Query: 310 ttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtctg 369
           |||||||| || ||||| |||||||||||||| ||||| ||||| || || |||||||| 
Sbjct: 678 ttgcccttcggatcccaatcaagcataatcttgaccttaatacccagcacaccctgtctc 619

                                                                       
Query: 370 agaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccagatgagatc 429
           |||||||| ||||||||||| |  ||||| |||   || || || | |||||| || |||
Sbjct: 618 agaagaacatgtctaacagcagagtcaatatacaagttaacaggataaccagaagaaatc 559

                                                                       
Query: 430 atgtagccgtccttgaacttcatggacttcgccctctgggccctaagcttgccactcaca 489
           ||||| |||||||||||||||||||| || || | ||| ||||||||||| |||||||||
Sbjct: 558 atgtatccgtccttgaacttcatggatttagcacgctgagccctaagcttcccactcaca 499

                                  
Query: 490 atgacctcacaacccttagcacc 512
           || |||||||| |||||||||||
Sbjct: 498 ataacctcacagcccttagcacc 476



to top

>gb|AY106013.1| Zea mays PCO066457 mRNA sequence
          Length = 819

 Score =  149 bits (75), Expect = 1e-32
 Identities = 171/203 (84%)
 Strand = Plus / Minus

                                                                       
Query: 310 ttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtctg 369
           |||||||| || |||||||| ||||||||||| |||||||||||||| || |||||||| 
Sbjct: 643 ttgccctttggatcccagtccagcataatcttaaccttgataccaagcacaccctgtctc 584

                                                                       
Query: 370 agaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccagatgagatc 429
           |  ||||| ||||| ||||||| |||||||||    ||||| || |||||||| || |||
Sbjct: 583 aatagaacatgtctcacagctgaatcaatgtataggttgacaggatgaccagaagaaatc 524

                                                                       
Query: 430 atgtagccgtccttgaacttcatggacttcgccctctgggccctaagcttgccactcaca 489
           ||||| || |||||||||||||| ||||| || | ||| ||||| ||||| ||||| |||
Sbjct: 523 atgtacccatccttgaacttcatagacttagcacgctgagccctgagcttaccacttaca 464

                                  
Query: 490 atgacctcacaacccttagcacc 512
           || |||||||| |||||||||||
Sbjct: 463 ataacctcacagcccttagcacc 441



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  141 bits (71), Expect = 3e-30
 Identities = 119/135 (88%)
 Strand = Plus / Plus

                                                                            
Query: 362      cctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccag 421
                ||||||| || || |||||||| ||||| |  ||||||||||||||||| ||||||||||
Sbjct: 20905975 cctgtctcaggagcacgtgtctcacagccgagtcaatgtactcattgactggctgaccag 20906034

                                                                            
Query: 422      atgagatcatgtagccgtccttgaacttcatggacttcgccctctgggccctaagcttgc 481
                ||||||||||||| || |||||||||||||||||||| || || |||||||| ||||| |
Sbjct: 20906035 atgagatcatgtaaccatccttgaacttcatggacttggctctttgggccctgagctttc 20906094

                               
Query: 482      cactcacaatgacct 496
                |||| ||||||||||
Sbjct: 20906095 cacttacaatgacct 20906109



 Score =  121 bits (61), Expect = 2e-24
 Identities = 115/133 (86%)
 Strand = Plus / Plus

                                                                            
Query: 233      ccggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcaggg 292
                |||| ||||||||||| ||||||||||| || |  |||||||| || || || ||||| |
Sbjct: 20905760 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 20905819

                                                                            
Query: 293      gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 352
                ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 20905820 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 20905879

                             
Query: 353      caagaacgccctg 365
                ||||||| |||||
Sbjct: 20905880 caagaacaccctg 20905892



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  141 bits (71), Expect = 3e-30
 Identities = 119/135 (88%)
 Strand = Plus / Plus

                                                                            
Query: 362      cctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccag 421
                ||||||| || || |||||||| ||||| |  ||||||||||||||||| ||||||||||
Sbjct: 20899004 cctgtctcaggagcacgtgtctcacagccgagtcaatgtactcattgactggctgaccag 20899063

                                                                            
Query: 422      atgagatcatgtagccgtccttgaacttcatggacttcgccctctgggccctaagcttgc 481
                ||||||||||||| || |||||||||||||||||||| || || |||||||| ||||| |
Sbjct: 20899064 atgagatcatgtaaccatccttgaacttcatggacttggctctttgggccctgagctttc 20899123

                               
Query: 482      cactcacaatgacct 496
                |||| ||||||||||
Sbjct: 20899124 cacttacaatgacct 20899138



 Score =  121 bits (61), Expect = 2e-24
 Identities = 115/133 (86%)
 Strand = Plus / Plus

                                                                            
Query: 233      ccggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcaggg 292
                |||| ||||||||||| ||||||||||| || |  |||||||| || || || ||||| |
Sbjct: 20898789 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 20898848

                                                                            
Query: 293      gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 352
                ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 20898849 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 20898908

                             
Query: 353      caagaacgccctg 365
                ||||||| |||||
Sbjct: 20898909 caagaacaccctg 20898921



to top

>gb|AC146468.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0008D12
             map MAP_LOC, complete sequence
          Length = 167323

 Score =  141 bits (71), Expect = 3e-30
 Identities = 119/135 (88%)
 Strand = Plus / Minus

                                                                         
Query: 362   cctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccag 421
             ||||||| || || |||||||| ||||| |  ||||||||||||||||| ||||||||||
Sbjct: 16948 cctgtctcaggagcacgtgtctcacagccgagtcaatgtactcattgactggctgaccag 16889

                                                                         
Query: 422   atgagatcatgtagccgtccttgaacttcatggacttcgccctctgggccctaagcttgc 481
             ||||||||||||| || |||||||||||||||||||| || || |||||||| ||||| |
Sbjct: 16888 atgagatcatgtaaccatccttgaacttcatggacttggctctttgggccctgagctttc 16829

                            
Query: 482   cactcacaatgacct 496
             |||| ||||||||||
Sbjct: 16828 cacttacaatgacct 16814



 Score =  121 bits (61), Expect = 2e-24
 Identities = 115/133 (86%)
 Strand = Plus / Minus

                                                                         
Query: 233   ccggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcaggg 292
             |||| ||||||||||| ||||||||||| || |  |||||||| || || || ||||| |
Sbjct: 17163 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 17104

                                                                         
Query: 293   gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 352
             ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 17103 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 17044

                          
Query: 353   caagaacgccctg 365
             ||||||| |||||
Sbjct: 17043 caagaacaccctg 17031



to top

>dbj|D38596.1|RICRPS3A Oryza sativa mRNA, partial  homologous to ribosomal protein S3
           coding sequence
          Length = 368

 Score =  141 bits (71), Expect = 3e-30
 Identities = 119/135 (88%)
 Strand = Plus / Minus

                                                                       
Query: 362 cctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccag 421
           ||||||| || || |||||||| ||||| |  ||||||||||||||||| ||||||||||
Sbjct: 212 cctgtctcaggagcacgtgtctcacagccgagtcaatgtactcattgactggctgaccag 153

                                                                       
Query: 422 atgagatcatgtagccgtccttgaacttcatggacttcgccctctgggccctaagcttgc 481
           ||||||||||||| || |||||||||||||||||||| || || |||||||| ||||| |
Sbjct: 152 atgagatcatgtaaccatccttgaacttcatggacttggctctttgggccctgagctttc 93

                          
Query: 482 cactcacaatgacct 496
           |||| ||||||||||
Sbjct: 92  cacttacaatgacct 78



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 314 ccttggggtcccagtcaagcataatcttc 342
           |||||||||||||||| ||||| ||||||
Sbjct: 346 ccttggggtcccagtcgagcatgatcttc 318



to top

>dbj|AB091077.1| Zinnia elegans ZeRPS3 mRNA for putative ribosomal protein S3,
           partial cds
          Length = 509

 Score =  139 bits (70), Expect = 1e-29
 Identities = 136/158 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 gggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacg 360
           ||||||||||||||  | ||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 172 gggccaagtttgccagtcgggtcccagtcaagcatgatcttaaccttgataccaagaaca 113

                                                                       
Query: 361 ccctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgacca 420
           |||||||| ||||| |||||||| ||||| |  || |||||||| ||||| || ||||||
Sbjct: 112 ccctgtctaagaagcacgtgtctcacagcagagtcgatgtactctttgactggttgacca 53

                                                 
Query: 421 gatgagatcatgtagccgtccttgaacttcatggactt 458
           ||||| | |||||| || ||||| |||||||| |||||
Sbjct: 52  gatgacaccatgtaaccatccttaaacttcatcgactt 15



to top

>ref|NM_122944.2| Arabidopsis thaliana structural constituent of ribosome AT5G35530
           mRNA, complete cds
          Length = 1028

 Score =  133 bits (67), Expect = 6e-28
 Identities = 130/151 (86%)
 Strand = Plus / Minus

                                                                       
Query: 308 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 367
           |||||||||||||||||||||||||||| ||||||||||||| |||||| || |||||||
Sbjct: 657 gtttgcccttggggtcccagtcaagcatgatcttcaccttgagaccaagcacaccctgtc 598

                                                                       
Query: 368 tgagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccagatgaga 427
           | |||||||| || ||||| || ||||||||||| || |||   |||||||| || || |
Sbjct: 597 taagaagaacatgcctaactgcagcatcaatgtattccttggttggctgacctgaggaaa 538

                                          
Query: 428 tcatgtagccgtccttgaacttcatggactt 458
            |||||| || |||||||||||||| |||||
Sbjct: 537 ccatgtaaccatccttgaacttcatcgactt 507



to top

>gb|AY098949.1| Arabidopsis thaliana AT5g35530/MOK9_14 mRNA, complete cds
          Length = 747

 Score =  133 bits (67), Expect = 6e-28
 Identities = 130/151 (86%)
 Strand = Plus / Minus

                                                                       
Query: 308 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 367
           |||||||||||||||||||||||||||| ||||||||||||| |||||| || |||||||
Sbjct: 592 gtttgcccttggggtcccagtcaagcatgatcttcaccttgagaccaagcacaccctgtc 533

                                                                       
Query: 368 tgagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccagatgaga 427
           | |||||||| || ||||| || ||||||||||| || |||   |||||||| || || |
Sbjct: 532 taagaagaacatgcctaactgcagcatcaatgtattccttggttggctgacctgaggaaa 473

                                          
Query: 428 tcatgtagccgtccttgaacttcatggactt 458
            |||||| || |||||||||||||| |||||
Sbjct: 472 ccatgtaaccatccttgaacttcatcgactt 442



to top

>gb|AY058057.1| Arabidopsis thaliana AT5g35530/MOK9_14 mRNA, complete cds
          Length = 955

 Score =  133 bits (67), Expect = 6e-28
 Identities = 130/151 (86%)
 Strand = Plus / Minus

                                                                       
Query: 308 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 367
           |||||||||||||||||||||||||||| ||||||||||||| |||||| || |||||||
Sbjct: 656 gtttgcccttggggtcccagtcaagcatgatcttcaccttgagaccaagcacaccctgtc 597

                                                                       
Query: 368 tgagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccagatgaga 427
           | |||||||| || ||||| || ||||||||||| || |||   |||||||| || || |
Sbjct: 596 taagaagaacatgcctaactgcagcatcaatgtattccttggttggctgacctgaggaaa 537

                                          
Query: 428 tcatgtagccgtccttgaacttcatggactt 458
            |||||| || |||||||||||||| |||||
Sbjct: 536 ccatgtaaccatccttgaacttcatcgactt 506



to top

>gb|AY084320.1| Arabidopsis thaliana clone 10394 mRNA, complete sequence
          Length = 985

 Score =  129 bits (65), Expect = 1e-26
 Identities = 125/145 (86%)
 Strand = Plus / Minus

                                                                       
Query: 308 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 367
           |||||||||||||||||||||||||||| ||||||||||||| |||||| || |||||||
Sbjct: 657 gtttgcccttggggtcccagtcaagcatgatcttcaccttgagaccaagcacaccctgtc 598

                                                                       
Query: 368 tgagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccagatgaga 427
           | |||||||| || ||||| || ||||||||||| || |||   |||||||| || || |
Sbjct: 597 taagaagaacatgcctaactgcagcatcaatgtattccttggttggctgacctgaggaaa 538

                                    
Query: 428 tcatgtagccgtccttgaacttcat 452
            |||||| || ||||||||||||||
Sbjct: 537 ccatgtaaccatccttgaacttcat 513



to top

>gb|BT012908.1| Lycopersicon esculentum clone 114026F, mRNA sequence
          Length = 999

 Score =  109 bits (55), Expect = 9e-21
 Identities = 127/151 (84%)
 Strand = Plus / Minus

                                                                       
Query: 308 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 367
           |||| ||||| || |||||||||||||| ||||| || ||||||||||| || ||||| |
Sbjct: 678 gtttacccttaggatcccagtcaagcatgatcttgactttgataccaagcacaccctgcc 619

                                                                       
Query: 368 tgagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccagatgaga 427
           | || ||||| || || ||||||||||||||||| || || || || || ||||| || |
Sbjct: 618 ttagtagaacatgccttacagctgcatcaatgtattctttaaccggttggccagaagaaa 559

                                          
Query: 428 tcatgtagccgtccttgaacttcatggactt 458
           ||||||| |||||||| ||||||||||||||
Sbjct: 558 tcatgtaaccgtccttaaacttcatggactt 528



to top

>gb|DQ241842.1| Solanum tuberosum clone 182H03 unknown mRNA
          Length = 938

 Score =  109 bits (55), Expect = 9e-21
 Identities = 127/151 (84%)
 Strand = Plus / Minus

                                                                       
Query: 308 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 367
           |||| ||||| || |||||||||||||| ||||| || ||||||||||| |||||||| |
Sbjct: 628 gtttacccttaggatcccagtcaagcatgatcttgactttgataccaagcacgccctgcc 569

                                                                       
Query: 368 tgagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccagatgaga 427
           | || || || || |||||||||||||||||||| || || || || || ||||| || |
Sbjct: 568 taagtagcacatgcctaacagctgcatcaatgtattctttaaccggttggccagaagaaa 509

                                          
Query: 428 tcatgtagccgtccttgaacttcatggactt 458
           ||||||| || ||||| ||||||||||||||
Sbjct: 508 tcatgtaaccatccttaaacttcatggactt 478



to top

>ref|NM_128718.3| Arabidopsis thaliana structural constituent of ribosome AT2G31610
           mRNA, complete cds
          Length = 1077

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 124/150 (82%)
 Strand = Plus / Minus

                                                                       
Query: 309 tttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtct 368
           ||||||| | ||||||||||||||||| |||||||||||||| || |  || ||||||||
Sbjct: 662 tttgcccgtagggtcccagtcaagcatgatcttcaccttgattcccaacaccccctgtct 603

                                                                       
Query: 369 gagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccagatgagat 428
           ||| | ||| ||||| || || ||||| ||||| || ||    || ||||||||||| | 
Sbjct: 602 gagcaaaacatgtctcactgcagcatcgatgtattccttagttggttgaccagatgaaac 543

                                         
Query: 429 catgtagccgtccttgaacttcatggactt 458
           |||||| || ||||||||||||||||||||
Sbjct: 542 catgtaaccatccttgaacttcatggactt 513



to top

>gb|AY091208.1| Arabidopsis thaliana putative 40S ribosomal protein (At2g31610)
           mRNA, complete cds
          Length = 784

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 124/150 (82%)
 Strand = Plus / Minus

                                                                       
Query: 309 tttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtct 368
           ||||||| | ||||||||||||||||| |||||||||||||| || |  || ||||||||
Sbjct: 591 tttgcccgtagggtcccagtcaagcatgatcttcaccttgattcccaacaccccctgtct 532

                                                                       
Query: 369 gagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccagatgagat 428
           ||| | ||| ||||| || || ||||| ||||| || ||    || ||||||||||| | 
Sbjct: 531 gagcaaaacatgtctcactgcagcatcgatgtattccttagttggttgaccagatgaaac 472

                                         
Query: 429 catgtagccgtccttgaacttcatggactt 458
           |||||| || ||||||||||||||||||||
Sbjct: 471 catgtaaccatccttgaacttcatggactt 442



to top

>gb|AY046041.1| Arabidopsis thaliana putative 40S ribosomal protein; contains
           C-terminal domain (At2g31610) mRNA, complete cds
          Length = 987

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 124/150 (82%)
 Strand = Plus / Minus

                                                                       
Query: 309 tttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtct 368
           ||||||| | ||||||||||||||||| |||||||||||||| || |  || ||||||||
Sbjct: 662 tttgcccgtagggtcccagtcaagcatgatcttcaccttgattcccaacaccccctgtct 603

                                                                       
Query: 369 gagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccagatgagat 428
           ||| | ||| ||||| || || ||||| ||||| || ||    || ||||||||||| | 
Sbjct: 602 gagcaaaacatgtctcactgcagcatcgatgtattccttagttggttgaccagatgaaac 543

                                         
Query: 429 catgtagccgtccttgaacttcatggactt 458
           |||||| || ||||||||||||||||||||
Sbjct: 542 catgtaaccatccttgaacttcatggactt 513



to top

>gb|AY081517.1| Arabidopsis thaliana 40S ribosomal protein; contains C-terminal
           domain (At2g31610) mRNA, complete cds
          Length = 863

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 124/150 (82%)
 Strand = Plus / Minus

                                                                       
Query: 309 tttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtct 368
           ||||||| | ||||||||||||||||| |||||||||||||| || |  || ||||||||
Sbjct: 591 tttgcccgtagggtcccagtcaagcatgatcttcaccttgattcccaacaccccctgtct 532

                                                                       
Query: 369 gagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccagatgagat 428
           ||| | ||| ||||| || || ||||| ||||| || ||    || ||||||||||| | 
Sbjct: 531 gagcaaaacatgtctcactgcagcatcgatgtattccttagttggttgaccagatgaaac 472

                                         
Query: 429 catgtagccgtccttgaacttcatggactt 458
           |||||| || ||||||||||||||||||||
Sbjct: 471 catgtaaccatccttgaacttcatggactt 442



to top

>gb|AY054622.1| Arabidopsis thaliana 40S ribosomal protein (At2g31610; T9H9.13)
           mRNA, complete cds
          Length = 992

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 124/150 (82%)
 Strand = Plus / Minus

                                                                       
Query: 309 tttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtct 368
           ||||||| | ||||||||||||||||| |||||||||||||| || |  || ||||||||
Sbjct: 662 tttgcccgtagggtcccagtcaagcatgatcttcaccttgattcccaacaccccctgtct 603

                                                                       
Query: 369 gagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccagatgagat 428
           ||| | ||| ||||| || || ||||| ||||| || ||    || ||||||||||| | 
Sbjct: 602 gagcaaaacatgtctcactgcagcatcgatgtattccttagttggttgaccagatgaaac 543

                                         
Query: 429 catgtagccgtccttgaacttcatggactt 458
           |||||| || ||||||||||||||||||||
Sbjct: 542 catgtaaccatccttgaacttcatggactt 513



to top

>gb|AY052749.1| Arabidopsis thaliana At2g31610/T9H9.13 mRNA, complete cds
          Length = 753

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 124/150 (82%)
 Strand = Plus / Minus

                                                                       
Query: 309 tttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtct 368
           ||||||| | ||||||||||||||||| |||||||||||||| || |  || ||||||||
Sbjct: 591 tttgcccgtagggtcccagtcaagcatgatcttcaccttgattcccaacaccccctgtct 532

                                                                       
Query: 369 gagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccagatgagat 428
           ||| | ||| ||||| || || ||||| ||||| || ||    || ||||||||||| | 
Sbjct: 531 gagcaaaacatgtctcactgcagcatcgatgtattccttagttggttgaccagatgaaac 472

                                         
Query: 429 catgtagccgtccttgaacttcatggactt 458
           |||||| || ||||||||||||||||||||
Sbjct: 471 catgtaaccatccttgaacttcatggactt 442



to top

>gb|AF378887.1|AF378887 Arabidopsis thaliana At2g31610/T9H9.13 mRNA, complete cds
          Length = 956

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 124/150 (82%)
 Strand = Plus / Minus

                                                                       
Query: 309 tttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtct 368
           ||||||| | ||||||||||||||||| |||||||||||||| || |  || ||||||||
Sbjct: 662 tttgcccgtagggtcccagtcaagcatgatcttcaccttgattcccaacaccccctgtct 603

                                                                       
Query: 369 gagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccagatgagat 428
           ||| | ||| ||||| || || ||||| ||||| || ||    || ||||||||||| | 
Sbjct: 602 gagcaaaacatgtctcactgcagcatcgatgtattccttagttggttgaccagatgaaac 543

                                         
Query: 429 catgtagccgtccttgaacttcatggactt 458
           |||||| || ||||||||||||||||||||
Sbjct: 542 catgtaaccatccttgaacttcatggactt 513



to top

>emb|BX819975.1|CNS0A8H0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS55ZF11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1056

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 124/150 (82%)
 Strand = Plus / Minus

                                                                       
Query: 309 tttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtct 368
           ||||||| | ||||||||||||||||| |||||||||||||| || |  || ||||||||
Sbjct: 640 tttgcccgtagggtcccagtcaagcatgatcttcaccttgattcccaacaccccctgtct 581

                                                                       
Query: 369 gagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccagatgagat 428
           ||| | ||| ||||| || || ||||| ||||| || ||    || ||||||||||| | 
Sbjct: 580 gagcaaaacatgtctcactgcagcatcgatgtattccttagttggttgaccagatgaaac 521

                                         
Query: 429 catgtagccgtccttgaacttcatggactt 458
           |||||| || ||||||||||||||||||||
Sbjct: 520 catgtaaccatccttgaacttcatggactt 491



to top

>gb|AC079038.3|AC079038 Oryza sativa chromosome 7 clone OSJNBb0024A20, complete sequence
          Length = 129838

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 112/135 (82%)
 Strand = Plus / Minus

                                                                          
Query: 362    cctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccag 421
              ||||||| |||||||| ||||||||||| |  ||||| |||   || || || | |||||
Sbjct: 122733 cctgtctcagaagaacatgtctaacagcagagtcaatatacaagttaacaggataaccag 122674

                                                                          
Query: 422    atgagatcatgtagccgtccttgaacttcatggacttcgccctctgggccctaagcttgc 481
              | || |||||||| |||||||||||||||||||| || || | ||| ||||||||||| |
Sbjct: 122673 aagaaatcatgtatccgtccttgaacttcatggatttagcacgctgagccctaagcttcc 122614

                             
Query: 482    cactcacaatgacct 496
              |||||||||| ||||
Sbjct: 122613 cactcacaataacct 122599



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                          
Query: 310    ttgcccttggggtcccagtcaagcataatcttcaccttgatacc 353
              |||||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 122878 ttgcccttcggatcccaatcaagcataatcttgaccttaatacc 122835



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 112/135 (82%)
 Strand = Plus / Plus

                                                                            
Query: 362      cctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccag 421
                ||||||| |||||||| ||||||||||| |  ||||| |||   || || || | |||||
Sbjct: 24966420 cctgtctcagaagaacatgtctaacagcagagtcaatatacaagttaacaggataaccag 24966479

                                                                            
Query: 422      atgagatcatgtagccgtccttgaacttcatggacttcgccctctgggccctaagcttgc 481
                | || |||||||| |||||||||||||||||||| || || | ||| ||||||||||| |
Sbjct: 24966480 aagaaatcatgtatccgtccttgaacttcatggatttagcacgctgagccctaagcttcc 24966539

                               
Query: 482      cactcacaatgacct 496
                |||||||||| ||||
Sbjct: 24966540 cactcacaataacct 24966554



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                            
Query: 310      ttgcccttggggtcccagtcaagcataatcttcaccttgatacc 353
                |||||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 24966275 ttgcccttcggatcccaatcaagcataatcttgaccttaatacc 24966318



to top

>dbj|AP006458.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OSJNBa0072I06
          Length = 162411

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 112/135 (82%)
 Strand = Plus / Plus

                                                                          
Query: 362    cctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccag 421
              ||||||| |||||||| ||||||||||| |  ||||| |||   || || || | |||||
Sbjct: 150052 cctgtctcagaagaacatgtctaacagcagagtcaatatacaagttaacaggataaccag 150111

                                                                          
Query: 422    atgagatcatgtagccgtccttgaacttcatggacttcgccctctgggccctaagcttgc 481
              | || |||||||| |||||||||||||||||||| || || | ||| ||||||||||| |
Sbjct: 150112 aagaaatcatgtatccgtccttgaacttcatggatttagcacgctgagccctaagcttcc 150171

                             
Query: 482    cactcacaatgacct 496
              |||||||||| ||||
Sbjct: 150172 cactcacaataacct 150186



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                          
Query: 310    ttgcccttggggtcccagtcaagcataatcttcaccttgatacc 353
              |||||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 149907 ttgcccttcggatcccaatcaagcataatcttgaccttaatacc 149950



to top

>emb|BX820098.1|CNS0A8HS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS73ZG08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1228

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 115/139 (82%)
 Strand = Plus / Minus

                                                                       
Query: 320 ggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtctgagaagaacgt 379
           |||||||||||||||| |||||||||||||| || |  || ||||||||||| | ||| |
Sbjct: 916 ggtcccagtcaagcatgatcttcaccttgattcccaacaccccctgtctgagcaaaacat 857

                                                                       
Query: 380 gtctaacagctgcatcaatgtactcattgacgggctgaccagatgagatcatgtagccgt 439
           |||| || || ||||| ||||| || ||    || ||||||||||| | |||||| || |
Sbjct: 856 gtctcactgcagcatcgatgtattccttagttggttgaccagatgaaaccatgtaaccat 797

                              
Query: 440 ccttgaacttcatggactt 458
           |||||||||||||||||||
Sbjct: 796 ccttgaacttcatggactt 778



to top

>dbj|AP005895.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
            clone:OSJNBb0018L13
          Length = 131155

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 112/135 (82%)
 Strand = Plus / Plus

                                                                        
Query: 362  cctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccag 421
            ||||||| |||||||| ||||||||||| |  ||||| |||   || || || | |||||
Sbjct: 7100 cctgtctcagaagaacatgtctaacagcagagtcaatatacaagttaacaggataaccag 7159

                                                                        
Query: 422  atgagatcatgtagccgtccttgaacttcatggacttcgccctctgggccctaagcttgc 481
            | || |||||||| |||||||||||||||||||| || || | ||| ||||||||||| |
Sbjct: 7160 aagaaatcatgtatccgtccttgaacttcatggatttagcacgctgagccctaagcttcc 7219

                           
Query: 482  cactcacaatgacct 496
            |||||||||| ||||
Sbjct: 7220 cactcacaataacct 7234



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 310  ttgcccttggggtcccagtcaagcataatcttcaccttgatacc 353
            |||||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 6955 ttgcccttcggatcccaatcaagcataatcttgaccttaatacc 6998



to top

>dbj|AB015477.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOK9
          Length = 87459

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 54/58 (93%)
 Strand = Plus / Plus

                                                                       
Query: 308   gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctg 365
             |||||||||||||||||||||||||||| ||||||||||||| |||||| || |||||
Sbjct: 49326 gtttgcccttggggtcccagtcaagcatgatcttcaccttgagaccaagcacaccctg 49383



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 80/97 (82%)
 Strand = Plus / Plus

                                                                         
Query: 362   cctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccag 421
             ||||||| |||||||| || ||||| || ||||||||||| || |||   |||||||| |
Sbjct: 49471 cctgtctaagaagaacatgcctaactgcagcatcaatgtattccttggttggctgacctg 49530

                                                  
Query: 422   atgagatcatgtagccgtccttgaacttcatggactt 458
             | || | |||||| || |||||||||||||| |||||
Sbjct: 49531 aggaaaccatgtaaccatccttgaacttcatcgactt 49567



to top

>emb|BX831845.1|CNS0A14G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH33ZB11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 82/95 (86%), Gaps = 1/95 (1%)
 Strand = Plus / Minus

                                                                       
Query: 308 gtttgcccttggggtcccagtcaagcataatcttcaccttga-taccaagaacgccctgt 366
           ||||||||||||||||||||| |||||| |||||||||||||  || ||| || ||||||
Sbjct: 642 gtttgcccttggggtcccagtaaagcatgatcttcaccttgagaacaaagcacaccctgt 583

                                              
Query: 367 ctgagaagaacgtgtctaacagctgcatcaatgta 401
           || |||||||| || || || || |||||||||||
Sbjct: 582 ctaagaagaacatgcctcactgcagcatcaatgta 548



to top

>gb|DQ294256.1| Solanum tuberosum clone 084G12 40S ribosomal protein-like protein
           mRNA, complete cds
          Length = 968

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 308 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 367
           |||| ||||| || |||||||||||||| ||||| || ||||||||||| |||||||| |
Sbjct: 631 gtttacccttaggatcccagtcaagcatgatcttgactttgataccaagcacgccctgcc 572

                                         
Query: 368 tgagaagaacgtgtctaacagctgcatcaa 397
           | || || || || ||||||||||||||||
Sbjct: 571 taagtagcacatgcctaacagctgcatcaa 542



to top

>emb|BX818844.1|CNS0A8YC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB18ZG02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 969

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 121/150 (80%)
 Strand = Plus / Minus

                                                                       
Query: 309 tttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtct 368
           ||||||| | |||||||||| |||||| | ||||||||| || || |  || ||||||||
Sbjct: 624 tttgcccgtagggtcccagtgaagcatgaacttcacctttattcccaacaccccctgtct 565

                                                                       
Query: 369 gagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccagatgagat 428
           ||| | ||| | |||||| || ||||| ||||| || ||    || ||||||||||| | 
Sbjct: 564 gagcaaaacatttctaactgcagcatcgatgtattccttagttggttgaccagatgaaac 505

                                         
Query: 429 catgtagccgtccttgaacttcatggactt 458
           |||||| || ||||||||||||||||||||
Sbjct: 504 catgtaaccatccttgaacttcatggactt 475



to top

>gb|AC146759.29| Medicago truncatula clone mth2-173e19, complete sequence
          Length = 133602

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 92/112 (82%)
 Strand = Plus / Minus

                                                                          
Query: 362    cctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgggctgaccag 421
              ||||||| || ||||| ||||| ||||| |  |||||||| || ||||| || || ||||
Sbjct: 101261 cctgtctaaggagaacatgtctcacagcagagtcaatgtagtccttgactggttgtccag 101202

                                                                  
Query: 422    atgagatcatgtagccgtccttgaacttcatggacttcgccctctgggccct 473
              | || |||||||| ||||| |||||||||||||| || || || ||||||||
Sbjct: 101201 aagaaatcatgtaaccgtctttgaacttcatggatttggctctttgggccct 101150



to top

>dbj|AP004944.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT43B20, TM0117a,
             complete sequence
          Length = 33359

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                                
Query: 322   tcccagtcaagcataatcttcaccttgataccaag 356
             |||||||||||||||||||| ||||||||||||||
Sbjct: 28359 tcccagtcaagcataatcttaaccttgataccaag 28393



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                        
Query: 394   tcaatgtactcattgacgggctgaccagatgagatcatgtagccgtccttgaacttcat 452
             |||||||| || ||||| || || ||||| || |||||||| || ||||||||||||||
Sbjct: 28546 tcaatgtaatccttgactggttgcccagaagaaatcatgtacccatccttgaacttcat 28604



to top

>gb|AC007071.7| Arabidopsis thaliana chromosome 2 clone T9H9 map nga361, complete
             sequence
          Length = 79734

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                       
Query: 309   tttgcccttggggtcccagtcaagcataatcttcaccttgat 350
             ||||||| | ||||||||||||||||| ||||||||||||||
Sbjct: 40251 tttgcccgtagggtcccagtcaagcatgatcttcaccttgat 40210



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                         
Query: 415   tgaccagatgagatcatgtagccgtccttgaacttcatggactt 458
             ||||||||||| | |||||| || ||||||||||||||||||||
Sbjct: 40056 tgaccagatgaaaccatgtaaccatccttgaacttcatggactt 40013



to top

>ref|NM_115247.2| Arabidopsis thaliana nucleic acid binding / structural constituent
           of ribosome AT3G53870 mRNA, complete cds
          Length = 976

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 311 tgcccttggggtcccagtcaagcataatcttcaccttgat 350
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 642 tgcccttagggtcccaatcaagcataaccttcaccttgat 603



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 415 tgaccagatgagatcatgtagccgtccttgaacttcatggactt 458
           ||||||||||| | ||||||||| || ||||||||||| |||||
Sbjct: 538 tgaccagatgacaccatgtagccatctttgaacttcatagactt 495



to top

>gb|AY059090.1| Arabidopsis thaliana putative ribosomal protein S3a homolog
           (At3g53870) mRNA, complete cds
          Length = 781

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 311 tgcccttggggtcccagtcaagcataatcttcaccttgat 350
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 589 tgcccttagggtcccaatcaagcataaccttcaccttgat 550



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 415 tgaccagatgagatcatgtagccgtccttgaacttcatggactt 458
           ||||||||||| | ||||||||| || ||||||||||| |||||
Sbjct: 485 tgaccagatgacaccatgtagccatctttgaacttcatagactt 442



to top

>gb|AY035022.1| Arabidopsis thaliana putative ribosomal protein S3a homolog
           (At3g53870) mRNA, complete cds
          Length = 957

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 311 tgcccttggggtcccagtcaagcataatcttcaccttgat 350
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 642 tgcccttagggtcccaatcaagcataaccttcaccttgat 603



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 415 tgaccagatgagatcatgtagccgtccttgaacttcatggactt 458
           ||||||||||| | ||||||||| || ||||||||||| |||||
Sbjct: 538 tgaccagatgacaccatgtagccatctttgaacttcatagactt 495



to top

>emb|AL132960.2|ATF5K20 Arabidopsis thaliana DNA chromosome 3, BAC clone F5K20
          Length = 119407

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                     
Query: 311   tgcccttggggtcccagtcaagcataatcttcaccttgat 350
             ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 55130 tgcccttagggtcccaatcaagcataaccttcaccttgat 55091



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                         
Query: 415   tgaccagatgagatcatgtagccgtccttgaacttcatggactt 458
             ||||||||||| | ||||||||| || ||||||||||| |||||
Sbjct: 54941 tgaccagatgacaccatgtagccatctttgaacttcatagactt 54898



to top

>gb|AF428405.1|AF428405 Arabidopsis thaliana AT3g53870/F5K20_170 mRNA, complete cds
          Length = 926

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 311 tgcccttggggtcccagtcaagcataatcttcaccttgat 350
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 642 tgcccttagggtcccaatcaagcataaccttcaccttgat 603



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 415 tgaccagatgagatcatgtagccgtccttgaacttcatggactt 458
           ||||||||||| | ||||||||| || ||||||||||| |||||
Sbjct: 538 tgaccagatgacaccatgtagccatctttgaacttcatagactt 495



to top

>emb|BX824880.1|CNS0A5OP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH7ZC06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 883

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 311 tgcccttggggtcccagtcaagcataatcttcaccttgat 350
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 622 tgcccttagggtcccaatcaagcataaccttcaccttgat 583



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 415 tgaccagatgagatcatgtagccgtccttgaacttcatggactt 458
           ||||||||||| | ||||||||| || ||||||||||| |||||
Sbjct: 518 tgaccagatgacaccatgtagccatctttgaacttcatagactt 475



to top

>emb|BX823126.1|CNS0A5V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB91ZH06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 907

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 311 tgcccttggggtcccagtcaagcataatcttcaccttgat 350
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 625 tgcccttagggtcccaatcaagcataaccttcaccttgat 586



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 415 tgaccagatgagatcatgtagccgtccttgaacttcatggactt 458
           ||||||||||| | ||||||||| || ||||||||||| |||||
Sbjct: 521 tgaccagatgacaccatgtagccatctttgaacttcatagactt 478



to top

>gb|AY088808.1| Arabidopsis thaliana clone 9568 mRNA, complete sequence
          Length = 970

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 311 tgcccttggggtcccagtcaagcataatcttcaccttgat 350
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 643 tgcccttagggtcccaatcaagcataaccttcaccttgat 604



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 415 tgaccagatgagatcatgtagccgtccttgaacttcatggactt 458
           ||||||||||| | ||||||||| || ||||||||||| |||||
Sbjct: 539 tgaccagatgacaccatgtagccatctttgaacttcatagactt 496



to top

>ref|XM_745219.1| Aspergillus fumigatus Af293 40s ribosomal protein S3 (Afu1g05630)
           partial mRNA
          Length = 801

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 102/127 (80%)
 Strand = Plus / Minus

                                                                       
Query: 332 gcataatcttcaccttgataccaagaacgccctgtctgagaagaacgtgtctaacagctg 391
           |||| ||||| ||||||||||||||||| ||||| | |||||| ||||| |    |||  
Sbjct: 577 gcatgatcttgaccttgataccaagaacaccctggcggagaaggacgtgacgggtagcgc 518

                                                                       
Query: 392 catcaatgtactcattgacgggctgaccagatgagatcatgtagccgtccttgaacttca 451
             |||||| |||| ||| |||||||||| ||   ||||||| | |||||| |||||||||
Sbjct: 517 tgtcaatgaactccttggcgggctgaccggagtggatcatgaaaccgtccgtgaacttca 458

                  
Query: 452 tggactt 458
           |||||||
Sbjct: 457 tggactt 451



to top

>ref|XM_566546.1| Cryptococcus neoformans var. neoformans JEC21 ribosomal protein S3
           (CNA01060) partial mRNA
          Length = 901

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 333 cataatcttcaccttgataccaagaacgccctgtctgagaagaacgtgtc 382
           ||||||||| ||||||||||| || || ||||||| ||| ||||||||||
Sbjct: 621 cataatcttgaccttgataccgagcacaccctgtcggaggagaacgtgtc 572



to top

>emb|CR733948.2|CNS0GT3F Tetraodon nigroviridis full-length cDNA
          Length = 836

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 478 aacttcatggacttggccctctggcccctcagcttgcc 441



to top

>emb|CR732997.2|CNS0GSHS Tetraodon nigroviridis full-length cDNA
          Length = 1074

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 734 aacttcatggacttggccctctggcccctcagcttgcc 697



to top

>emb|CR732118.2|CNS0GRUJ Tetraodon nigroviridis full-length cDNA
          Length = 1090

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 733 aacttcatggacttggccctctggcccctcagcttgcc 696



to top

>emb|CR727128.2|CNS0GNZY Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR725578.1|CNS0GMSW Tetraodon nigroviridis full-length cDNA
          Length = 1071

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 713 aacttcatggacttggccctctggcccctcagcttgcc 676



to top

>emb|CR720047.2|CNS0GIJ9 Tetraodon nigroviridis full-length cDNA
          Length = 835

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 471 aacttcatggacttggccctctggcccctcagcttgcc 434



to top

>emb|CR722968.2|CNS0GKSE Tetraodon nigroviridis full-length cDNA
          Length = 839

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR721986.2|CNS0GK14 Tetraodon nigroviridis full-length cDNA
          Length = 840

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR721973.2|CNS0GK0R Tetraodon nigroviridis full-length cDNA
          Length = 836

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR720943.2|CNS0GJ85 Tetraodon nigroviridis full-length cDNA
          Length = 835

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 477 aacttcatggacttggccctctggcccctcagcttgcc 440



to top

>emb|CR720588.2|CNS0GIYA Tetraodon nigroviridis full-length cDNA
          Length = 834

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR720528.2|CNS0GIWM Tetraodon nigroviridis full-length cDNA
          Length = 837

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR718492.2|CNS0GHC2 Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR718473.2|CNS0GHBJ Tetraodon nigroviridis full-length cDNA
          Length = 644

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 284 aacttcatggacttggccctctggcccctcagcttgcc 247



to top

>emb|CR717704.2|CNS0GGQ6 Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR717299.2|CNS0GGEX Tetraodon nigroviridis full-length cDNA
          Length = 662

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 304 aacttcatggacttggccctctggcccctcagcttgcc 267



to top

>emb|CR717118.2|CNS0GG9Z Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR716945.2|CNS0GG56 Tetraodon nigroviridis full-length cDNA
          Length = 840

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR716173.2|CNS0GFJQ Tetraodon nigroviridis full-length cDNA
          Length = 839

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR716064.2|CNS0GFGS Tetraodon nigroviridis full-length cDNA
          Length = 836

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 477 aacttcatggacttggccctctggcccctcagcttgcc 440



to top

>emb|CR715921.2|CNS0GFCT Tetraodon nigroviridis full-length cDNA
          Length = 841

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR714979.2|CNS0GEMN Tetraodon nigroviridis full-length cDNA
          Length = 839

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 481 aacttcatggacttggccctctggcccctcagcttgcc 444



to top

>emb|CR714034.2|CNS0GDWE Tetraodon nigroviridis full-length cDNA
          Length = 839

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR710531.2|CNS0GB73 Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR710154.2|CNS0GAWM Tetraodon nigroviridis full-length cDNA
          Length = 839

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 481 aacttcatggacttggccctctggcccctcagcttgcc 444



to top

>emb|CR708944.2|CNS0G9Z0 Tetraodon nigroviridis full-length cDNA
          Length = 612

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 252 aacttcatggacttggccctctggcccctcagcttgcc 215



to top

>emb|CR705890.2|CNS0G7M6 Tetraodon nigroviridis full-length cDNA
          Length = 758

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 400 aacttcatggacttggccctctggcccctcagcttgcc 363



to top

>emb|CR707049.2|CNS0G8ID Tetraodon nigroviridis full-length cDNA
          Length = 839

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR707000.2|CNS0G8H0 Tetraodon nigroviridis full-length cDNA
          Length = 836

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR705879.2|CNS0G7LV Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR705519.2|CNS0G7BV Tetraodon nigroviridis full-length cDNA
          Length = 836

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR705142.2|CNS0G71E Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR703509.2|CNS0G5S1 Tetraodon nigroviridis full-length cDNA
          Length = 839

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR702546.2|CNS0G51A Tetraodon nigroviridis full-length cDNA
          Length = 837

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 471 aacttcatggacttggccctctggcccctcagcttgcc 434



to top

>emb|CR701940.2|CNS0G4KG Tetraodon nigroviridis full-length cDNA
          Length = 840

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR701500.2|CNS0G488 Tetraodon nigroviridis full-length cDNA
          Length = 837

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR701498.2|CNS0G486 Tetraodon nigroviridis full-length cDNA
          Length = 839

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR691318.2|CNS0FWDE Tetraodon nigroviridis full-length cDNA
          Length = 836

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR696663.2|CNS0G0HV Tetraodon nigroviridis full-length cDNA
          Length = 843

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR695909.2|CNS0FZWX Tetraodon nigroviridis full-length cDNA
          Length = 843

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR695523.2|CNS0FZM7 Tetraodon nigroviridis full-length cDNA
          Length = 836

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR695491.2|CNS0FZLB Tetraodon nigroviridis full-length cDNA
          Length = 844

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR693485.2|CNS0FY1L Tetraodon nigroviridis full-length cDNA
          Length = 843

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR693322.2|CNS0FXX2 Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR693236.2|CNS0FXUO Tetraodon nigroviridis full-length cDNA
          Length = 836

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR692761.2|CNS0FXHH Tetraodon nigroviridis full-length cDNA
          Length = 840

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR692671.2|CNS0FXEZ Tetraodon nigroviridis full-length cDNA
          Length = 843

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR690335.2|CNS0FVM3 Tetraodon nigroviridis full-length cDNA
          Length = 843

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR690227.2|CNS0FVJ3 Tetraodon nigroviridis full-length cDNA
          Length = 822

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 462 aacttcatggacttggccctctggcccctcagcttgcc 425



to top

>emb|CR687816.2|CNS0FTO4 Tetraodon nigroviridis full-length cDNA
          Length = 830

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 471 aacttcatggacttggccctctggcccctcagcttgcc 434



to top

>emb|CR685672.2|CNS0FS0K Tetraodon nigroviridis full-length cDNA
          Length = 1034

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 243 aacttcatggacttggccctctggcccctcagcttgcc 206



to top

>emb|CR684111.2|CNS0FQT7 Tetraodon nigroviridis full-length cDNA
          Length = 834

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 474 aacttcatggacttggccctctggcccctcagcttgcc 437



to top

>emb|CR683013.2|CNS0FPYP Tetraodon nigroviridis full-length cDNA
          Length = 839

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR682931.1|CNS0FPWF Tetraodon nigroviridis full-length cDNA
          Length = 1029

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 242 aacttcatggacttggccctctggcccctcagcttgcc 205



to top

>emb|CR682564.2|CNS0FPM8 Tetraodon nigroviridis full-length cDNA
          Length = 822

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 462 aacttcatggacttggccctctggcccctcagcttgcc 425



to top

>emb|CR681592.2|CNS0FOV8 Tetraodon nigroviridis full-length cDNA
          Length = 821

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 462 aacttcatggacttggccctctggcccctcagcttgcc 425



to top

>emb|CR681108.2|CNS0FOHS Tetraodon nigroviridis full-length cDNA
          Length = 840

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR681368.2|CNS0FOP0 Tetraodon nigroviridis full-length cDNA
          Length = 840

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR680023.2|CNS0FNNN Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR678768.2|CNS0FMOS Tetraodon nigroviridis full-length cDNA
          Length = 828

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 469 aacttcatggacttggccctctggcccctcagcttgcc 432



to top

>emb|CR676931.2|CNS0FLA7 Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR674862.2|CNS0FJP0 Tetraodon nigroviridis full-length cDNA
          Length = 843

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 478 aacttcatggacttggccctctggcccctcagcttgcc 441



to top

>emb|CR674066.2|CNS0FJ2W Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR670148.2|CNS0FG22 Tetraodon nigroviridis full-length cDNA
          Length = 844

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR669238.2|CNS0FFCS Tetraodon nigroviridis full-length cDNA
          Length = 840

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR668609.2|CNS0FEVB Tetraodon nigroviridis full-length cDNA
          Length = 797

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 461 aacttcatggacttggccctctggcccctcagcttgcc 424



to top

>emb|CR668354.2|CNS0FEO8 Tetraodon nigroviridis full-length cDNA
          Length = 835

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 476 aacttcatggacttggccctctggcccctcagcttgcc 439



to top

>emb|CR668281.2|CNS0FEM7 Tetraodon nigroviridis full-length cDNA
          Length = 848

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 486 aacttcatggacttggccctctggcccctcagcttgcc 449



to top

>emb|CR667570.2|CNS0FE2G Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR667442.2|CNS0FDYW Tetraodon nigroviridis full-length cDNA
          Length = 845

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR667436.2|CNS0FDYQ Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR662572.2|CNS0FA7M Tetraodon nigroviridis full-length cDNA
          Length = 844

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR662555.2|CNS0FA75 Tetraodon nigroviridis full-length cDNA
          Length = 839

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR661602.2|CNS0F9GO Tetraodon nigroviridis full-length cDNA
          Length = 836

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR658012.2|CNS0F6OY Tetraodon nigroviridis full-length cDNA
          Length = 844

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR660736.2|CNS0F8SM Tetraodon nigroviridis full-length cDNA
          Length = 836

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 476 aacttcatggacttggccctctggcccctcagcttgcc 439



to top

>emb|CR659660.2|CNS0F7YQ Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR658791.2|CNS0F7AL Tetraodon nigroviridis full-length cDNA
          Length = 795

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 461 aacttcatggacttggccctctggcccctcagcttgcc 424



to top

>emb|CR657579.2|CNS0F6CX Tetraodon nigroviridis full-length cDNA
          Length = 751

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 468 aacttcatggacttggccctctggcccctcagcttgcc 431



to top

>emb|CR653000.2|CNS0F2TQ Tetraodon nigroviridis full-length cDNA
          Length = 839

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR651572.2|CNS0F1Q2 Tetraodon nigroviridis full-length cDNA
          Length = 836

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR650942.2|CNS0F18K Tetraodon nigroviridis full-length cDNA
          Length = 608

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 252 aacttcatggacttggccctctggcccctcagcttgcc 215



to top

>emb|CR649707.2|CNS0F0A9 Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR649423.2|CNS0F02D Tetraodon nigroviridis full-length cDNA
          Length = 836

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR649142.2|CNS0EZUK Tetraodon nigroviridis full-length cDNA
          Length = 840

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR647678.2|CNS0EYPW Tetraodon nigroviridis full-length cDNA
          Length = 835

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR643232.2|CNS0EVAE Tetraodon nigroviridis full-length cDNA
          Length = 844

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR645116.2|CNS0EWQQ Tetraodon nigroviridis full-length cDNA
          Length = 821

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR645008.2|CNS0EWNQ Tetraodon nigroviridis full-length cDNA
          Length = 840

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR644758.2|CNS0EWGS Tetraodon nigroviridis full-length cDNA
          Length = 841

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR642184.2|CNS0EUHA Tetraodon nigroviridis full-length cDNA
          Length = 1027

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 669 aacttcatggacttggccctctggcccctcagcttgcc 632



to top

>emb|CR642006.2|CNS0EUCC Tetraodon nigroviridis full-length cDNA
          Length = 836

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR641349.2|CNS0ETU3 Tetraodon nigroviridis full-length cDNA
          Length = 841

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR641032.2|CNS0ETLA Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR639385.2|CNS0ESBJ Tetraodon nigroviridis full-length cDNA
          Length = 840

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR638796.2|CNS0ERV6 Tetraodon nigroviridis full-length cDNA
          Length = 844

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR637247.2|CNS0EQO5 Tetraodon nigroviridis full-length cDNA
          Length = 842

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR637338.2|CNS0EQQO Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 480 aacttcatggacttggccctctggcccctcagcttgcc 443



to top

>emb|CR636161.2|CNS0EPTZ Tetraodon nigroviridis full-length cDNA
          Length = 834

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR634906.2|CNS0EOV4 Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>emb|CR634367.2|CNS0EOG5 Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 445 aacttcatggacttcgccctctgggccctaagcttgcc 482
           |||||||||||||| ||||||||| |||| ||||||||
Sbjct: 479 aacttcatggacttggccctctggcccctcagcttgcc 442



to top

>gb|DQ122868.1| Chlamydomonas incerta 40S ribosomal protein S3 mRNA, complete cds
          Length = 886

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 429 catgtagccgtccttgaacttcatggactt 458
           ||||||||| ||||||||||||||||||||
Sbjct: 486 catgtagccatccttgaacttcatggactt 457



to top

>emb|CR679463.2|CNS0FN83 Tetraodon nigroviridis full-length cDNA
          Length = 830

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 445 aacttcatggacttcgccctctgggccctaagcttgc 481
           |||||||||||||| ||||||||| |||| |||||||
Sbjct: 475 aacttcatggacttggccctctggcccctcagcttgc 439



to top

>ref|XM_754010.1| Ustilago maydis 521 hypothetical protein (UM02956.1) partial mRNA
          Length = 720

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 318 ggggtcccagtcaagcataatcttcaccttgataccaagaacgccctg 365
           |||||||||| |  |||| ||||| ||||||||||||||||| |||||
Sbjct: 552 ggggtcccagccctgcatgatcttgaccttgataccaagaacaccctg 505



to top

>gb|AF402810.1| Ictalurus punctatus 40S ribosomal protein S3 mRNA, complete cds
          Length = 799

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 445 aacttcatggacttcgccctctgggccctaagcttgccactcacaatgacctcacaaccc 504
           |||||||||||||| ||||||||  |||| |||||||||  ||| |  |||||||| |||
Sbjct: 460 aacttcatggacttggccctctgacccctgagcttgccagacactaccacctcacagccc 401

                   
Query: 505 ttagcacc 512
           || |||||
Sbjct: 400 ttggcacc 393



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 317 tggggtcccagtcaagcataatcttcaccttgatacc 353
           |||||||||||  |||||| ||||| |||||||||||
Sbjct: 588 tggggtcccagggaagcatgatcttaaccttgatacc 552



to top

>gb|AY521669.1| Pseudopleuronectes americanus 40S ribosomal protein S3 (RPS3) mRNA,
           complete cds
          Length = 804

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 445 aacttcatggacttcgccctctgggccctaagcttgccactcacaatgacctcacaaccc 504
           |||||||||||||| ||||||||  | || |||||||||  ||| |  |||||||| |||
Sbjct: 466 aacttcatggactttgccctctgacctctcagcttgccagacaccaccacctcacagccc 407

                   
Query: 505 ttagcacc 512
           ||||||||
Sbjct: 406 ttagcacc 399



to top

>gb|AY394937.1| Danio rerio clone RK045A1H03 ribosomal protein S3 mRNA, complete
           cds
          Length = 821

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 317 tggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 367
           |||| ||||||  |||||| |||||||||||||| ||||| || |||||||
Sbjct: 584 tgggatcccagggaagcatgatcttcaccttgattccaagcacaccctgtc 534



to top

>gb|AY389945.1| Latimeria chalumnae ribosomal protein S3 mRNA, partial cds
          Length = 634

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 444 gaacttcatggacttcgccctctgggccctaagcttgccactcacaatgacctcacaacc 503
           ||||||||||||||| || |||||  |||| |||||||||   ||||  |||||||||||
Sbjct: 427 gaacttcatggacttggctctctgacccctgagcttgccagaaacaaccacctcacaacc 368

              
Query: 504 ctt 506
           |||
Sbjct: 367 ctt 365



to top

>ref|NM_201153.1| Danio rerio ribosomal protein S3 (rps3), mRNA
          Length = 850

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 317 tggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 367
           |||| ||||||  |||||| |||||||||||||| ||||| || |||||||
Sbjct: 610 tgggatcccagggaagcatgatcttcaccttgattccaagcacaccctgtc 560



to top

>gb|BC045902.1| Danio rerio ribosomal protein S3, mRNA (cDNA clone MGC:56088
           IMAGE:5410588), complete cds
          Length = 850

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 317 tggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 367
           |||| ||||||  |||||| |||||||||||||| ||||| || |||||||
Sbjct: 610 tgggatcccagggaagcatgatcttcaccttgattccaagcacaccctgtc 560



to top

>gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete
              sequence
          Length = 2300533

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                            
Query: 337    atcttcaccttgataccaagaacgccctgtctgagaagaacgtgtc 382
              ||||| ||||||||||| || || ||||||| ||| ||||||||||
Sbjct: 291022 atcttgaccttgataccgagcacaccctgtcggaggagaacgtgtc 290977



to top

>gb|BC061265.1| Xenopus tropicalis ribosomal protein S3, mRNA (cDNA clone MGC:75699
           IMAGE:5380544), complete cds
          Length = 882

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 330 aagcataatcttcaccttgataccaagaacgccctgtctgag 371
           |||||||||||| |||||||| ||||| || ||||| |||||
Sbjct: 605 aagcataatctttaccttgattccaaggacaccctgcctgag 564



to top

>ref|XM_385609.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG05433.1)
           partial mRNA
          Length = 768

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 45/50 (90%), Gaps = 2/50 (4%)
 Strand = Plus / Minus

                                                             
Query: 410 cgggctgaccaga-tgagatcatgtagccgtccttgaacttcatggactt 458
           ||||||||||||| ||| |||||| |||||||  ||||||||||||||||
Sbjct: 484 cgggctgaccagagtga-atcatgaagccgtcggtgaacttcatggactt 436



to top

>emb|V01441.1|XLRIB4 Fragment of Xenopus laevis mRNA for ribosomal protein S1
          Length = 382

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 330 aagcataatcttcaccttgataccaagaacgccctgtctgag 371
           |||||||||||| |||||||| || ||||| ||||| |||||
Sbjct: 190 aagcataatctttaccttgattcccagaacaccctgcctgag 149



to top

>ref|NM_203788.1| Xenopus tropicalis ribosomal protein S3 (MGC75699), mRNA
          Length = 882

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 330 aagcataatcttcaccttgataccaagaacgccctgtctgag 371
           |||||||||||| |||||||| ||||| || ||||| |||||
Sbjct: 605 aagcataatctttaccttgattccaaggacaccctgcctgag 564



to top

>emb|Z34529.1|XLRIBS1R X.laevis rpS1b mRNA for ribosomal protein S1
          Length = 842

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 330 aagcataatcttcaccttgataccaagaacgccctgtctgag 371
           |||||||||||| |||||||| || ||||| ||||| |||||
Sbjct: 596 aagcataatctttaccttgattcccagaacaccctgcctgag 555



to top

>emb|CR848247.2| Xenopus tropicalis finished cDNA, clone TTpA010a01
          Length = 892

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 330 aagcataatcttcaccttgataccaagaacgccctgtctgag 371
           |||||||||||| |||||||| ||||| || ||||| |||||
Sbjct: 576 aagcataatctttaccttgattccaaggacaccctgcctgag 535



to top

>ref|XM_527224.1| PREDICTED: Pan troglodytes similar to ribosomal protein S3; 40S
            ribosomal protein S3; IMR-90 ribosomal protein S3
            (LOC471846), mRNA
          Length = 1200

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 331  agcataatcttcaccttgataccaagaacgccctgtctgag 371
            ||||| |||||||||||||| || || || |||||||||||
Sbjct: 1040 agcatgatcttcaccttgatgcccagcacaccctgtctgag 1000



to top

>gb|BC078664.1| Homo sapiens cDNA clone IMAGE:3941503, containing frame-shift errors
          Length = 4397

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                     
Query: 331  agcataatcttcaccttgataccaagaacgccctgtctgag 371
            ||||| |||||||||||||| || || || |||||||||||
Sbjct: 2030 agcatgatcttcaccttgatgcccagcacaccctgtctgag 2070



to top

>gb|BC034149.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clone MGC:32779
           IMAGE:4665438), complete cds
          Length = 872

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 599 agcatgatcttcaccttgatgcccagcacaccctgtctgag 559



to top

>gb|BC003137.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clone MGC:3657
           IMAGE:2906158), complete cds
          Length = 832

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 575 agcatgatcttcaccttgatgcccagcacaccctgtctgag 535



to top

>ref|XM_656599.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4087.2), mRNA
          Length = 795

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 332 gcataatcttcaccttgataccaagaacgccctgtctgagaagaacgtg 380
           |||| ||||| |||||||||||||| || ||||| | ||| ||||||||
Sbjct: 571 gcatgatcttgaccttgataccaaggacaccctggcggaggagaacgtg 523



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 493 acctcacaacccttagcacc 512
           ||||||||||||||||||||
Sbjct: 410 acctcacaacccttagcacc 391



to top

>gb|BC100284.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clone MGC:117338
           IMAGE:6160514), complete cds
          Length = 851

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 587 agcatgatcttcaccttgatgcccagcacaccctgtctgag 547



to top

>gb|BC017103.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clone IMAGE:3503171),
            **** WARNING: chimeric clone ****
          Length = 1651

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 331  agcataatcttcaccttgataccaagaacgccctgtctgag 371
            ||||| |||||||||||||| || || || |||||||||||
Sbjct: 1391 agcatgatcttcaccttgatgcccagcacaccctgtctgag 1351



to top

>gb|BC029981.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clone IMAGE:4705217)
          Length = 774

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 520 agcatgatcttcaccttgatgcccagcacaccctgtctgag 480



to top

>ref|NM_001005.3| Homo sapiens ribosomal protein S3 (RPS3), mRNA
          Length = 855

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 599 agcatgatcttcaccttgatgcccagcacaccctgtctgag 559



to top

>emb|CR861393.1| Pongo pygmaeus mRNA; cDNA DKFZp459J022 (from clone DKFZp459J022)
          Length = 922

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 595 agcatgatcttcaccttgatgcccagcacaccctgtctgag 555



to top

>emb|CR623585.1| full-length cDNA clone CS0DA007YC19 of Neuroblastoma of Homo
           sapiens (human)
          Length = 824

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 579 agcatgatcttcaccttgatgcccagcacaccctgtctgag 539



to top

>emb|CR620902.1| full-length cDNA clone CS0DJ012YN02 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 817

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 572 agcatgatcttcaccttgatgcccagcacaccctgtctgag 532



to top

>emb|CR620201.1| full-length cDNA clone CS0DL012YJ20 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 818

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 573 agcatgatcttcaccttgatgcccagcacaccctgtctgag 533



to top

>emb|CR619698.1| full-length cDNA clone CS0DL005YA23 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 830

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 585 agcatgatcttcaccttgatgcccagcacaccctgtctgag 545



to top

>emb|CR617487.1| full-length cDNA clone CS0DK010YL21 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 821

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 576 agcatgatcttcaccttgatgcccagcacaccctgtctgag 536



to top

>emb|CR611679.1| full-length cDNA clone CS0DB002YE09 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 830

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 585 agcatgatcttcaccttgatgcccagcacaccctgtctgag 545



to top

>emb|CR610898.1| full-length cDNA clone CS0DD004YP10 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 796

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 585 agcatgatcttcaccttgatgcccagcacaccctgtctgag 545



to top

>emb|CR610850.1| full-length cDNA clone CS0DH003YE11 of T cells (Jurkat cell line) of
            Homo sapiens (human)
          Length = 1356

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 331  agcataatcttcaccttgataccaagaacgccctgtctgag 371
            ||||| |||||||||||||| || || || |||||||||||
Sbjct: 1203 agcatgatcttcaccttgatgcccagcacaccctgtctgag 1163



to top

>emb|CR611021.1| full-length cDNA clone CS0DL002YG06 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 817

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 576 agcatgatcttcaccttgatgcccagcacaccctgtctgag 536



to top

>emb|CR609618.1| full-length cDNA clone CS0DI083YP04 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1307

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 352 agcatgatcttcaccttgatgcccagcacaccctgtctgag 312



to top

>emb|CR607881.1| full-length cDNA clone CS0DF032YC19 of Fetal brain of Homo sapiens
           (human)
          Length = 1306

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 586 agcatgatcttcaccttgatgcccagcacaccctgtctgag 546



to top

>emb|CR608382.1| full-length cDNA clone CS0DM008YP04 of Fetal liver of Homo sapiens
           (human)
          Length = 830

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 585 agcatgatcttcaccttgatgcccagcacaccctgtctgag 545



to top

>emb|CR606914.1| full-length cDNA clone CS0DN003YN07 of Adult brain of Homo sapiens
           (human)
          Length = 836

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 591 agcatgatcttcaccttgatgcccagcacaccctgtctgag 551



to top

>emb|CR599459.1| full-length cDNA clone CS0DA012YB22 of Neuroblastoma of Homo
           sapiens (human)
          Length = 814

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 585 agcatgatcttcaccttgatgcccagcacaccctgtctgag 545



to top

>emb|CR599018.1| full-length cDNA clone CS0DK010YN19 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 831

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 586 agcatgatcttcaccttgatgcccagcacaccctgtctgag 546



to top

>emb|CR598363.1| full-length cDNA clone CS0CAP007YJ19 of Thymus of Homo sapiens
           (human)
          Length = 799

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 587 agcatgatcttcaccttgatgcccagcacaccctgtctgag 547



to top

>emb|CR598084.1| full-length cDNA clone CS0DD009YH06 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 825

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 580 agcatgatcttcaccttgatgcccagcacaccctgtctgag 540



to top

>emb|CR597126.1| full-length cDNA clone CS0DK011YF16 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 830

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 585 agcatgatcttcaccttgatgcccagcacaccctgtctgag 545



to top

>emb|CR595698.1| full-length cDNA clone CS0DL005YD17 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 830

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 585 agcatgatcttcaccttgatgcccagcacaccctgtctgag 545



to top

>emb|CR593831.1| full-length cDNA clone CS0DI031YM23 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 813

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 568 agcatgatcttcaccttgatgcccagcacaccctgtctgag 528



to top

>emb|CR591204.1| full-length cDNA clone CS0DC019YA14 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 803

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 558 agcatgatcttcaccttgatgcccagcacaccctgtctgag 518



to top

>gb|S42658.1| S3 ribosomal protein [human, colon, mRNA, 826 nt]
          Length = 826

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 577 agcatgatcttcaccttgatgcccagcacaccctgtctgag 537



to top

>gb|BC013196.1|BC013196 Homo sapiens, clone IMAGE:4347401, mRNA, partial cds
          Length = 852

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 567 agcatgatcttcaccttgatgcccagcacaccctgtctgag 527



to top

>gb|BC003577.1|BC003577 Homo sapiens, clone IMAGE:3544292, mRNA, partial cds
          Length = 826

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 567 agcatgatcttcaccttgatgcccagcacaccctgtctgag 527



to top

>dbj|AK223048.1| Homo sapiens mRNA for ribosomal protein S3 variant, clone: KAT00103
          Length = 922

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 575 agcatgatcttcaccttgatgcccagcacaccctgtctgag 535



to top

>ref|NM_001009239.1| Rattus norvegicus ribosomal protein S3 (Rps3), mRNA
          Length = 843

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||| ||||| || || ||||||||||||||
Sbjct: 581 agcatgatcttcactttgatgcccagcacgccctgtctgag 541



to top

>gb|AC131235.4| Homo sapiens 3 BAC RP11-778D9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 174521

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                      
Query: 331   agcataatcttcaccttgataccaagaacgccctgtctgag 371
             ||||| |||||||||||||| || || || |||||||||||
Sbjct: 61535 agcatgatcttcaccttgatgcccagcacaccctgtctgag 61575



to top

>ref|XM_575143.1| PREDICTED: Rattus norvegicus similar to 40S ribosomal protein S3
           (LOC499803), mRNA
          Length = 830

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||| ||||| || || ||||||||||||||
Sbjct: 587 agcatgatcttcactttgatgcccagcacgccctgtctgag 547



to top

>gb|AY892063.1| Synthetic construct Homo sapiens clone FLH027749.01L ribosomal
           protein S3 (RPS3) mRNA, partial cds
          Length = 732

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 569 agcatgatcttcaccttgatgcccagcacaccctgtctgag 529



to top

>gb|BC071917.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clone MGC:88599
           IMAGE:6297012), complete cds
          Length = 839

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 578 agcatgatcttcaccttgatgcccagcacaccctgtctgag 538



to top

>emb|X51536.1|RRRPS3 Rat mRNA for ribosomal protein S3
          Length = 817

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||| ||||| || || ||||||||||||||
Sbjct: 587 agcatgatcttcactttgatgcccagcacgccctgtctgag 547



to top

>gb|DQ206605.1| Monosiga brevicollis isolate TOA26 ribosomal protein 3 small
           subunit mRNA, partial cds
          Length = 572

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 331 agcataatcttcaccttgataccaa 355
           ||||||||||| |||||||||||||
Sbjct: 488 agcataatcttgaccttgataccaa 464



to top

>gb|BC013231.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clone IMAGE:3462987)
          Length = 843

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 587 agcatgatcttcaccttgatgcccagcacaccctgtctgag 547



to top

>gb|U14992.1|HSU14992 Human IMR-90 ribosomal protein S3 (rpS3) mRNA, complete cds
          Length = 754

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 569 agcatgatcttcaccttgatgcccagcacaccctgtctgag 529



to top

>gb|U14991.1|HSU14991 Human XP2NE ribosomal protein S3 (rpS3) mRNA, complete cds
          Length = 754

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 569 agcatgatcttcaccttgatgcccagcacaccctgtctgag 529



to top

>gb|U14990.1|HSU14990 Human XP1PO ribosomal protein S3 (rpS3) mRNA, complete cds
          Length = 754

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 569 agcatgatcttcaccttgatgcccagcacaccctgtctgag 529



to top

>gb|BC088450.1| Rattus norvegicus ribosomal protein S3, mRNA (cDNA clone MGC:95096
           IMAGE:7126819), complete cds
          Length = 843

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||| ||||| || || ||||||||||||||
Sbjct: 581 agcatgatcttcactttgatgcccagcacgccctgtctgag 541



to top

>emb|X55715.1|HSHUMS3 Human Hums3 mRNA for 40S ribosomal protein s3
          Length = 833

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 591 agcatgatcttcaccttgatgcccagcacaccctgtctgag 551



to top

>gb|AC078872.13| Homo sapiens 12q BAC RP11-542G14 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 166585

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                       
Query: 331    agcataatcttcaccttgataccaagaacgccctgtctgag 371
              ||||| |||||||||||||| || || || |||||||||||
Sbjct: 102409 agcatgatcttcaccttgatgcccagcacaccctgtctgag 102369



to top

>dbj|AB062288.1| Homo sapiens OK/SW-cl.26 mRNA for IMR-90 ribosomal protein S3,
           complete cds
          Length = 810

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 331 agcataatcttcaccttgataccaagaacgccctgtctgag 371
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 562 agcatgatcttcaccttgatgcccagcacaccctgtctgag 522



to top

>ref|XM_593742.2| PREDICTED: Bos taurus similar to serologically defined colon cancer
            antigen 33 like (LOC515677), partial mRNA
          Length = 3176

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 243  cagctcgtcctcctccttcggggg 266
            ||||| ||||||||||||||||||
Sbjct: 1934 cagcttgtcctcctccttcggggg 1911



to top

>ref|XM_360299.1| Magnaporthe grisea 70-15 hypothetical protein (MG05673.4) partial
           mRNA
          Length = 777

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 427 atcatgtagccgtccttgaacttcatggactt 458
           |||||| |||||||  ||||||||||||||||
Sbjct: 473 atcatgaagccgtcggtgaacttcatggactt 442



to top

>gb|AC093458.6| Homo sapiens BAC clone RP11-445N20 from 7, complete sequence
          Length = 16677

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 263   gggggtggatggtgacgaggtcag 286
             |||||||||||||| |||||||||
Sbjct: 12587 gggggtggatggtgccgaggtcag 12610



to top

>ref|XM_784326.1| PREDICTED: Strongylocentrotus purpuratus similar to cytosolic
           sialic acid 9-O-acetylesterase homolog (LOC584468),
           partial mRNA
          Length = 1182

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 331 agcataatcttcaccttgatacca 354
           ||||| ||||||||||||||||||
Sbjct: 714 agcattatcttcaccttgatacca 691



to top

>emb|AL513332.9| Human DNA sequence from clone RP11-58B8 on chromosome 9, complete
             sequence
          Length = 124531

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 63    aaattaaaatggcagcataacata 86
             |||||||||||| |||||||||||
Sbjct: 24006 aaattaaaatggaagcataacata 23983



to top

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 435     gccgtccttgaacttcatggactt 458
               ||||||||||||||| ||||||||
Sbjct: 3470231 gccgtccttgaacttgatggactt 3470208



to top

>ref|XM_502846.1| Yarrowia lipolytica CLIB122, YALI0D15114g predicted mRNA
          Length = 1758

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 384  aacagctgcatcaatgtact 403
            ||||||||||||||||||||
Sbjct: 1500 aacagctgcatcaatgtact 1481



to top

>emb|AL356954.16| Human DNA sequence from clone RP11-520F24 on chromosome 13 Contains an
              HNRPA1 (heterogenous nuclear ribonucleoprotein A1)
              pseudogene, an ELL-related RNA polymerase II, elongation
              factor (ELL2) pseudogene and a ribosomal protein L37
              (RPL37) pseudogene, complete sequence
          Length = 159235

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 63     aaattaaaatggcagcataacata 86
              |||||||||||| |||||||||||
Sbjct: 146748 aaattaaaatggaagcataacata 146725



to top

>gb|AC134516.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone OJA1208D02,
             complete sequence
          Length = 131922

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 155   aggaaacaagctaggaccaa 174
             ||||||||||||||||||||
Sbjct: 85738 aggaaacaagctaggaccaa 85719



to top

>ref|XM_788097.1| PREDICTED: Strongylocentrotus purpuratus similar to Sialate
           O-acetylesterase precursor (Sialic acid-specific
           9-O-acetylesterase) (Yolk sac protein 2) (LOC588411),
           mRNA
          Length = 1101

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 331 agcataatcttcaccttgatacca 354
           ||||| ||||||||||||||||||
Sbjct: 354 agcattatcttcaccttgatacca 331



to top

>emb|BX842627.1| Neurospora crassa DNA linkage group I BAC clone B8J22
          Length = 75335

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 153  ataggaaacaagctaggacc 172
            ||||||||||||||||||||
Sbjct: 7696 ataggaaacaagctaggacc 7677



to top

>gb|AC007286.18| Homo sapiens 12q15 BAC RPCI11-298M11 (Roswell Park Cancer Institute
             Human BAC Library) complete sequence
          Length = 93001

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 83    catagaagcattacacataa 102
             ||||||||||||||||||||
Sbjct: 80945 catagaagcattacacataa 80964



to top

>gb|AC116926.1| Genomic sequence for Oryza sativa (japonica cultivar-group) cultivar
             Nipponbare clone OJ1341F06, from chromosome 10, complete
             sequence
          Length = 102520

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 155   aggaaacaagctaggaccaa 174
             ||||||||||||||||||||
Sbjct: 88705 aggaaacaagctaggaccaa 88724



to top

>gb|AC023163.25| Homo sapiens 12 BAC RP11-239B4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 122882

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 83    catagaagcattacacataa 102
             ||||||||||||||||||||
Sbjct: 40405 catagaagcattacacataa 40386



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 155      aggaaacaagctaggaccaa 174
                ||||||||||||||||||||
Sbjct: 11277750 aggaaacaagctaggaccaa 11277731



to top

>gb|AC006582.13|AC006582 Pan troglodytes 12cp12 BAC RPCI43-77C18 (Roswell Park Cancer
            Institute Human BAC Library) complete sequence
          Length = 186092

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 83   catagaagcattacacataa 102
            ||||||||||||||||||||
Sbjct: 7614 catagaagcattacacataa 7633



to top

>emb|CR555302.7| Zebrafish DNA sequence from clone CH211-212C19 in linkage group 10,
              complete sequence
          Length = 202469

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 65     attaaaatggcagcataaca 84
              ||||||||||||||||||||
Sbjct: 151367 attaaaatggcagcataaca 151386



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 155      aggaaacaagctaggaccaa 174
                ||||||||||||||||||||
Sbjct: 11284190 aggaaacaagctaggaccaa 11284171



to top

>emb|AL928672.14| Zebrafish DNA sequence from clone CH211-136O4, complete sequence
          Length = 187939

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 65    attaaaatggcagcataaca 84
             ||||||||||||||||||||
Sbjct: 56077 attaaaatggcagcataaca 56096



to top

>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 384     aacagctgcatcaatgtact 403
               ||||||||||||||||||||
Sbjct: 1841825 aacagctgcatcaatgtact 1841806


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,107,078
Number of Sequences: 3902068
Number of extensions: 4107078
Number of successful extensions: 75685
Number of sequences better than 10.0: 237
Number of HSP's better than 10.0 without gapping: 237
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 75006
Number of HSP's gapped (non-prelim): 666
length of query: 512
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 489
effective length of database: 17,143,297,704
effective search space: 8383072577256
effective search space used: 8383072577256
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top