>emb|AL117199.1|CEY43F11A Caenorhabditis elegans YAC Y43F11A, complete sequence
          Length = 24686

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 24    tttagttcaaatccatata 42
             |||||||||||||||||||
Sbjct: 24023 tttagttcaaatccatata 24005



 Score = 38.2 bits (19), Expect = 1.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 24    tttagttcaaatccatata 42
             |||||||||||||||||||
Sbjct: 23296 tttagttcaaatccatata 23314

>gb|AC068775.52| Homo sapiens 12 BAC RP11-291B21 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 161001

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 24     tttagttcaaatccatata 42
              |||||||||||||||||||
Sbjct: 105660 tttagttcaaatccatata 105678

>ref|NG_001019.4| Homo sapiens immunoglobulin heavy locus (IGH@) on chromosome 14
          Length = 1279711

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 13     caaatacacggtttagttcaaat 35
              |||||||||||||| ||||||||
Sbjct: 768008 caaatacacggtttggttcaaat 767986

>dbj|AB019440.1| Homo sapiens DNA for immunoglobulin heavy-chain variable region, complete
              sequence, 4 of 5
          Length = 200000

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 13     caaatacacggtttagttcaaat 35
              |||||||||||||| ||||||||
Sbjct: 168008 caaatacacggtttggttcaaat 167986

>emb|Z99116.2|BSUB0013 Bacillus subtilis complete genome (section 13 of 21): from 2409151 to
             2613687
          Length = 204537

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    caaatacacggtttagtt 30
             ||||||||||||||||||
Sbjct: 30923 caaatacacggtttagtt 30940

>dbj|D84432.1|BACJH642 Bacillus subtilis DNA, 283 Kb region containing skin element
          Length = 282700

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 13     caaatacacggtttagtt 30
              ||||||||||||||||||
Sbjct: 278766 caaatacacggtttagtt 278749

>gb|AC108070.2| Homo sapiens BAC clone RP11-638P8 from 2, complete sequence
          Length = 92113

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 22    ggtttagttcaaatccat 39
             ||||||||||||||||||
Sbjct: 85833 ggtttagttcaaatccat 85850

>dbj|BA000026.2| Mycoplasma penetrans HF-2 DNA, complete genome
          Length = 1358633

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 26     tagttcaaatccatatac 43
              ||||||||||||||||||
Sbjct: 923834 tagttcaaatccatatac 923817

>gb|AC145930.4| Gallus gallus BAC clone CH261-31O19 from chromosome unknown, complete
            sequence
          Length = 158897

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 25   ttagttcaaatccatata 42
            ||||||||||||||||||
Sbjct: 6086 ttagttcaaatccatata 6069

>emb|AL935296.5| Zebrafish DNA sequence from clone CH211-281F5, complete sequence
          Length = 147042

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 17     tacacggtttagttcaaa 34
              ||||||||||||||||||
Sbjct: 145098 tacacggtttagttcaaa 145115

>gb|M15349.1|BACSPOVA B.subtilis spoVA gene cluster containing a polycistronic sporulation
            operon; partial cds
          Length = 3706

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 13   caaatacacggtttagtt 30
            ||||||||||||||||||
Sbjct: 2430 caaatacacggtttagtt 2413


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 312,965
Number of Sequences: 3902068
Number of extensions: 312965
Number of successful extensions: 56261
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56234
Number of HSP's gapped (non-prelim): 27
length of query: 47
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 27
effective length of database: 17,155,003,908
effective search space: 463185105516
effective search space used: 463185105516
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)