>emb|AL606467.5| Human DNA sequence from clone RP13-172P16 on chromosome Xp21.1-21.3
              Contains a High mobility group protein 1 (HMG-1)(LOC340573)
              pseudogene, a novel gene and the 5'end of a novel gene
              (LOC158730), complete sequence
          Length = 138093

 Score = 40.1 bits (20), Expect = 0.84
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 12     cacaacttttaactaaataa 31
              ||||||||||||||||||||
Sbjct: 110538 cacaacttttaactaaataa 110519

>dbj|AK136565.1| Mus musculus adult male cecum cDNA, RIKEN full-length enriched
           library, clone:9130225C03 product:Stonin 1 (Stoned
           B-like factor) homolog [Mus musculus], full insert
           sequence
          Length = 2676

 Score = 40.1 bits (20), Expect = 0.84
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 33  aagtaataatgggggaccca 52
           ||||||||||||||||||||
Sbjct: 587 aagtaataatgggggaccca 568

>dbj|AK077966.1| Mus musculus 13 days embryo male testis cDNA, RIKEN full-length
           enriched library, clone:6030478E24 product:similar to
           STONIN 1 [Homo sapiens], full insert sequence
          Length = 2451

 Score = 40.1 bits (20), Expect = 0.84
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 33  aagtaataatgggggaccca 52
           ||||||||||||||||||||
Sbjct: 458 aagtaataatgggggaccca 439

>dbj|AK014958.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4921524J06 product:similar to STONIN 1
           [Homo sapiens], full insert sequence
          Length = 2782

 Score = 40.1 bits (20), Expect = 0.84
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 33  aagtaataatgggggaccca 52
           ||||||||||||||||||||
Sbjct: 668 aagtaataatgggggaccca 649

>dbj|AK029959.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4932411D08 product:similar to STONIN 1
           [Homo sapiens], full insert sequence
          Length = 3268

 Score = 40.1 bits (20), Expect = 0.84
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 33  aagtaataatgggggaccca 52
           ||||||||||||||||||||
Sbjct: 713 aagtaataatgggggaccca 694

>dbj|AK029878.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4931420E09 product:similar to STONIN 1
           [Homo sapiens], full insert sequence
          Length = 3232

 Score = 40.1 bits (20), Expect = 0.84
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 33  aagtaataatgggggaccca 52
           ||||||||||||||||||||
Sbjct: 680 aagtaataatgggggaccca 661

>emb|CT485603.4| RP43-005L22, complete sequence
          Length = 204041

 Score = 40.1 bits (20), Expect = 0.84
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 12     cacaacttttaactaaataa 31
              ||||||||||||||||||||
Sbjct: 110774 cacaacttttaactaaataa 110755

>emb|BX000361.8| Zebrafish DNA sequence from clone DKEY-181F18 in linkage group 20,
              complete sequence
          Length = 124183

 Score = 40.1 bits (20), Expect = 0.84
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     taaataacaagtaataatgg 44
              ||||||||||||||||||||
Sbjct: 101630 taaataacaagtaataatgg 101649

>gb|AC133935.3| Mus musculus BAC clone RP24-387M21 from 3, complete sequence
          Length = 182101

 Score = 40.1 bits (20), Expect = 0.84
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 8     acaacacaacttttaactaa 27
             ||||||||||||||||||||
Sbjct: 76300 acaacacaacttttaactaa 76281

>gb|AC166350.4| Mus musculus BAC clone RP24-220P10 from chromosome 17, complete
             sequence
          Length = 156954

 Score = 40.1 bits (20), Expect = 0.84
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 33    aagtaataatgggggaccca 52
             ||||||||||||||||||||
Sbjct: 92050 aagtaataatgggggaccca 92031

>emb|AL049714.6|HSJ181J22 Human DNA sequence from clone RP1-181J22 on chromosome 11p13 Contains
            an RPL34 (60S Ribosomal protein L34) pseudogene, ESTs and
            GSSs, complete sequence
          Length = 55316

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 10   aacacaacttttaactaaa 28
            |||||||||||||||||||
Sbjct: 2613 aacacaacttttaactaaa 2595

>emb|CT030642.8| Mouse DNA sequence from clone RP24-68B16 on chromosome 17, complete
              sequence
          Length = 204364

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 61     ttgagcaactatgctcata 79
              |||||||||||||||||||
Sbjct: 190676 ttgagcaactatgctcata 190658

>gb|AC151288.3| Mus musculus BAC clone RP23-340K6 from chromosome 17, complete sequence
          Length = 227155

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 61    ttgagcaactatgctcata 79
             |||||||||||||||||||
Sbjct: 63926 ttgagcaactatgctcata 63908


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 666,727
Number of Sequences: 3902068
Number of extensions: 666727
Number of successful extensions: 50794
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50778
Number of HSP's gapped (non-prelim): 16
length of query: 80
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 59
effective length of database: 17,151,101,840
effective search space: 1011915008560
effective search space used: 1011915008560
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)