>ref|XM_648008.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (94.t00028)
            partial mRNA
          Length = 1644

 Score = 46.1 bits (23), Expect = 0.011
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 3    caatatatggatcaatcattatttatg 29
            ||||||||| |||||||||||||||||
Sbjct: 1264 caatatatgaatcaatcattatttatg 1290

>gb|AC000107.2|AC000107 Genomic sequence for Arabidopsis thaliana BAC F17F8 from chromosome I,
             complete sequence
          Length = 102393

 Score = 40.1 bits (20), Expect = 0.65
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 6     tatatggatcaatcattatttatg 29
             ||||||||| ||||||||||||||
Sbjct: 27805 tatatggatgaatcattatttatg 27828

>emb|BX000440.10| Zebrafish DNA sequence from clone CH211-14L9 in linkage group 16,
             complete sequence
          Length = 162906

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 22    tatttatgggtcaatgaca 40
             |||||||||||||||||||
Sbjct: 17435 tatttatgggtcaatgaca 17453

>emb|BX640407.9| Zebrafish DNA sequence from clone DKEY-208B10 in linkage group 12,
            complete sequence
          Length = 89034

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 22   tatttatgggtcaatgaca 40
            |||||||||||||||||||
Sbjct: 6159 tatttatgggtcaatgaca 6141

>gb|AC000070.2| Homo sapiens Chromosome 22q11.2 Cosmid Clone 105a In DGCR Region,
             complete sequence
          Length = 38699

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 6     tatatggatcaatcattatttat 28
             ||||||||| |||||||||||||
Sbjct: 28256 tatatggatgaatcattatttat 28278

>gb|AC151971.3| Mus musculus BAC clone RP24-282C4 from 9, complete sequence
          Length = 179607

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 16     aatcattatttatgggtca 34
              |||||||||||||||||||
Sbjct: 138267 aatcattatttatgggtca 138249


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 631,791
Number of Sequences: 3902068
Number of extensions: 631791
Number of successful extensions: 41361
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41355
Number of HSP's gapped (non-prelim): 6
length of query: 67
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 46
effective length of database: 17,151,101,840
effective search space: 788950684640
effective search space used: 788950684640
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)