>ref|NM_017404.2| Mus musculus mitochondrial ribosomal protein L39 (Mrpl39), mRNA
          Length = 1773

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 31   tgcttaacacactggcacat 50
            ||||||||||||||||||||
Sbjct: 1279 tgcttaacacactggcacat 1260

>gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 9, complete
              sequence
          Length = 1178688

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 43     tggcacatccatccatctga 62
              ||||||||||||||||||||
Sbjct: 940990 tggcacatccatccatctga 941009

>ref|XM_572880.1| Cryptococcus neoformans var. neoformans JEC21 Voltage-gated
          potassium channel beta-2 subunit (CNI03480) partial
          mRNA
          Length = 1351

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 43 tggcacatccatccatctga 62
          ||||||||||||||||||||
Sbjct: 47 tggcacatccatccatctga 66

>emb|AL021937.1|HS149A16 Human DNA sequence from clone RP1-149A16 on chromosome 22 Contains four
             novel genes (LOC339666, HSPC117), the RFPL3 gene for ret
             finger protein-like 3, a immunoglobulin lambda chain
             pseudogene, the RFPL3S gene for ret finger protein-like 3
             antisense, the BPIL2 gene for
             bactericidal/permeability-increasing protein-like 2, the
             5' end of the FBXO7 gene for F-box protein 7 and three CpG
             islands, complete sequence
          Length = 173354

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 45    gcacatccatccatctgaag 64
             ||||||||||||||||||||
Sbjct: 20894 gcacatccatccatctgaag 20875

>gb|AC164162.2| Mus musculus BAC clone RP23-253E17 from chromosome 16, complete sequence
          Length = 174250

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 31     tgcttaacacactggcacat 50
              ||||||||||||||||||||
Sbjct: 155812 tgcttaacacactggcacat 155793

>dbj|AK031942.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length
            enriched library, clone:6330504K13 product:mitochondrial
            ribosomal protein L39, full insert sequence
          Length = 1773

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 31   tgcttaacacactggcacat 50
            ||||||||||||||||||||
Sbjct: 1279 tgcttaacacactggcacat 1260

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 72       cagatccagatggggcttgacagt 95
                ||||||||||||||||||| ||||
Sbjct: 18845248 cagatccagatggggcttggcagt 18845225

>dbj|AP003684.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0485D10
          Length = 147464

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 72    cagatccagatggggcttgacagt 95
             ||||||||||||||||||| ||||
Sbjct: 10813 cagatccagatggggcttggcagt 10790

>dbj|AP005492.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0077L03
          Length = 171177

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 72     cagatccagatggggcttgacagt 95
              ||||||||||||||||||| ||||
Sbjct: 170999 cagatccagatggggcttggcagt 170976

>emb|CT027693.11| Mouse DNA sequence from clone RP24-120H1 on chromosome 16, complete
              sequence
          Length = 186376

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 31     tgcttaacacactggcacat 50
              ||||||||||||||||||||
Sbjct: 113832 tgcttaacacactggcacat 113851

>gb|AC114666.31| Mus musculus chromosome 5, clone RP24-175N6, complete sequence
          Length = 193158

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 41     actggcacatccatccatc 59
              |||||||||||||||||||
Sbjct: 187275 actggcacatccatccatc 187293

>gb|AC112633.6| Rattus norvegicus 11 BAC CH230-200K21 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 230130

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 75    atccagatggggcttgaca 93
             |||||||||||||||||||
Sbjct: 46360 atccagatggggcttgaca 46378

>gb|AC097117.12| Rattus norvegicus 1 BAC CH230-36C10 (Children's Hospital Oakland
            Research Institute) complete sequence
          Length = 197926

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 38   cacactggcacatccatcc 56
            |||||||||||||||||||
Sbjct: 7378 cacactggcacatccatcc 7360

>gb|AY661658.1| Sorghum bicolor clone BAC 796all, complete sequence
          Length = 103167

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 52    catccatctgaagttctgaacag 74
             |||| ||||||||||||||||||
Sbjct: 26606 catcgatctgaagttctgaacag 26628

>gb|AY661657.1| Sorghum bicolor clone BAC 60H10, complete sequence
          Length = 125927

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 52    catccatctgaagttctgaacag 74
             |||| ||||||||||||||||||
Sbjct: 93334 catcgatctgaagttctgaacag 93356



 Score = 38.2 bits (19), Expect = 7.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 52    catccatctgaagttctgaacag 74
             |||| ||||||||||||||||||
Sbjct: 93251 catcgatctgaagttctgaacag 93273

>gb|AC140460.3| Mus musculus BAC clone RP24-151D4 from chromosome 9, complete sequence
          Length = 196545

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 36     aacacactggcacatccat 54
              |||||||||||||||||||
Sbjct: 115824 aacacactggcacatccat 115842

>gb|AC110236.8| Mus musculus chromosome 15, clone RP23-104L4, complete sequence
          Length = 233499

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 70     aacagatccagatggggcttgac 92
              ||||||| |||||||||||||||
Sbjct: 121057 aacagatgcagatggggcttgac 121079

>emb|AL359915.14| Human DNA sequence from clone RP11-418J17 on chromosome 1 Contains the
             3' end of a novel gene, a ribosomal protein L6 (RPL6)
             pseudogene and the 5' end of a novel gene, complete
             sequence
          Length = 159158

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 84    gggcttgacagtacttact 102
             |||||||||||||||||||
Sbjct: 78407 gggcttgacagtacttact 78425

>gb|AC166328.4| Mus musculus BAC clone RP23-31H5 from chromosome 5, complete sequence
          Length = 215189

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 41    actggcacatccatccatc 59
             |||||||||||||||||||
Sbjct: 54735 actggcacatccatccatc 54753


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,210,533
Number of Sequences: 3902068
Number of extensions: 1210533
Number of successful extensions: 86242
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 86176
Number of HSP's gapped (non-prelim): 66
length of query: 146
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 125
effective length of database: 17,151,101,840
effective search space: 2143887730000
effective search space used: 2143887730000
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)