Clone Name | rbart37f10 |
---|---|
Clone Library Name | barley_pub |
>gb|AC122442.4| Mus musculus BAC clone RP24-230D14 from chromosome 19, complete sequence Length = 180516 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 201 cccataatctccatggctctct 222 |||||||||||||||||||||| Sbjct: 54311 cccataatctccatggctctct 54290
>gb|AC161865.4| Mus musculus chromosome 19, clone RP23-218F7, complete sequence Length = 206019 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 201 cccataatctccatggctctct 222 |||||||||||||||||||||| Sbjct: 75079 cccataatctccatggctctct 75100
>gb|DQ157469.1| Pseudomonas putida strain KL47 cym gene cluster, complete sequence; cmt gene cluster, complete sequence; enoyl CoA hydratase (ech) gene, complete cds; tod gene cluster, complete sequence; and sep gene cluster, partial sequence Length = 42505 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 417 cccttgagcttggcggcaaat 437 ||||||||||||||||||||| Sbjct: 2926 cccttgagcttggcggcaaat 2946
>emb|Z99105.2|BSUB0002 Bacillus subtilis complete genome (section 2 of 21): from 213031 to 415798 Length = 202768 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 416 gcccttgagcttggcggcaaa 436 ||||||||||||||||||||| Sbjct: 119863 gcccttgagcttggcggcaaa 119843
>gb|AY111134.1| Zea mays CL31484_1 mRNA sequence Length = 533 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Plus Query: 332 cacgttctgatagtactgcttgtccaggacgtc 364 |||||||| |||||||| |||||||||||||| Sbjct: 382 cacgttcttgtagtactggttgtccaggacgtc 414
>gb|U24215.1|PPU24215 Pseudomonas putida p-cymene catabolism (cym) and p-cumate catabolism (cmt) operons and enol-coenzyme A hydratase gene, complete cds Length = 24937 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 417 cccttgagcttggcggcaaat 437 ||||||||||||||||||||| Sbjct: 4892 cccttgagcttggcggcaaat 4912
>dbj|D50453.1| Bacillus subtilis DNA for 25-36 degree region containing the amyE-srfA region, complete cds Length = 146191 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 416 gcccttgagcttggcggcaaa 436 ||||||||||||||||||||| Sbjct: 12548 gcccttgagcttggcggcaaa 12528
>dbj|D50098.1| Bacillus subtilis DNA for multidrug transporter, complete cds Length = 1700 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 416 gcccttgagcttggcggcaaa 436 ||||||||||||||||||||| Sbjct: 763 gcccttgagcttggcggcaaa 783
>ref|NM_123623.2| Arabidopsis thaliana CYP71A16; heme binding / iron ion binding / monooxygenase/ oxygen binding AT5G42590 (CYP71A16) mRNA, complete cds Length = 1620 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 179 tatggtcttgacctcgattgtgcc 202 |||||||||||| ||||||||||| Sbjct: 668 tatggtcttgacatcgattgtgcc 645
>gb|AC113325.7| Mus musculus chromosome 1, clone RP23-453H23, complete sequence Length = 191225 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 25 atgagaaagccaacaatgac 44 |||||||||||||||||||| Sbjct: 33201 atgagaaagccaacaatgac 33182
>gb|AE007299.1| Sinorhizobium meliloti 1021 plasmid pSymA section 105 of 121 of the complete plasmid sequence Length = 14409 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 416 gcccttgagcttggcggcaa 435 |||||||||||||||||||| Sbjct: 12055 gcccttgagcttggcggcaa 12074
>ref|XM_675514.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN7337.2), mRNA Length = 3213 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 386 cacgttggtgttgtcgttgc 405 |||||||||||||||||||| Sbjct: 2932 cacgttggtgttgtcgttgc 2913
>emb|BX569692.1| Synechococcus sp. WH8102 complete genome; segment 4/7 Length = 345997 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 401 gttgccgttgcactggccct 420 |||||||||||||||||||| Sbjct: 304804 gttgccgttgcactggccct 304785
>emb|AL807371.1|NC5F3 Neurospora crassa DNA linkage group V cosmid contig 5F3 Length = 83192 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 388 cgttggtgttgtcgttgccgttgc 411 ||||| |||||||||||||||||| Sbjct: 11750 cgttgctgttgtcgttgccgttgc 11773
>gb|AE012021.1| Xanthomonas axonopodis pv. citri str. 306, section 399 of 469 of the complete genome Length = 10869 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 416 gcccttgagcttggcggcaa 435 |||||||||||||||||||| Sbjct: 1837 gcccttgagcttggcggcaa 1818
>dbj|D84263.2| Hepatitis C virus (isolate VN235) genomic RNA, complete genome Length = 9615 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 377 gtcctggtccacgttggtgt 396 |||||||||||||||||||| Sbjct: 3653 gtcctggtccacgttggtgt 3634
>dbj|AK221497.1| Arabidopsis thaliana mRNA for cytochrome P450, complete cds, clone: RAFL07-52-L15 Length = 1686 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 179 tatggtcttgacctcgattgtgcc 202 |||||||||||| ||||||||||| Sbjct: 698 tatggtcttgacatcgattgtgcc 675
>gb|AF356827.1|AF356827 Hepatitis C virus isolate HCV-S1, complete genome Length = 9609 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 377 gtcctggtccacgttggtgt 396 |||||||||||||||||||| Sbjct: 3662 gtcctggtccacgttggtgt 3643
>emb|AL116780.1|CNS01DG4 Botrytis cinerea strain T4 cDNA library Length = 720 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 tggtgttgtcgttgccgttg 410 |||||||||||||||||||| Sbjct: 299 tggtgttgtcgttgccgttg 318
>emb|AL115374.1|CNS01CD2 Botrytis cinerea strain T4 cDNA library Length = 636 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 tggtgttgtcgttgccgttg 410 |||||||||||||||||||| Sbjct: 146 tggtgttgtcgttgccgttg 165
>gb|AC093755.2| Homo sapiens BAC clone RP11-55C6 from 4, complete sequence Length = 146673 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 261 tctttcacctcctttattgtttct 284 |||||||||||||||||| ||||| Sbjct: 55035 tctttcacctcctttattttttct 55012
>gb|AF207769.1|AF207769 Hepatitis C virus strain MD28 complete genome Length = 9379 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 377 gtcctggtccacgttggtgt 396 |||||||||||||||||||| Sbjct: 3650 gtcctggtccacgttggtgt 3631
>dbj|AB022210.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K16E1 Length = 33963 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 179 tatggtcttgacctcgattgtgcc 202 |||||||||||| ||||||||||| Sbjct: 25263 tatggtcttgacatcgattgtgcc 25286
>ref|XM_319593.2| Anopheles gambiae str. PEST ENSANGP00000016669 (ENSANGG00000014180), partial mRNA Length = 3090 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 323 gttgtcgatcacgttctgatagtactgcttgt 354 ||||||||||||| || ||| ||||||||||| Sbjct: 222 gttgtcgatcacgatcagatcgtactgcttgt 191
>ref|XM_552715.1| Anopheles gambiae str. PEST ENSANGP00000029511 (ENSANGG00000014180), partial mRNA Length = 2769 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 323 gttgtcgatcacgttctgatagtactgcttgt 354 ||||||||||||| || ||| ||||||||||| Sbjct: 231 gttgtcgatcacgatcagatcgtactgcttgt 200
>gb|M32030.1|RABHFMO Rabbit hepatic flavin-containing monooxygenase (hepatic FMO) mRNA, complete cds Length = 2046 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 258 ttttctttcacctcctttat 277 |||||||||||||||||||| Sbjct: 974 ttttctttcacctcctttat 955 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,271,478 Number of Sequences: 3902068 Number of extensions: 3271478 Number of successful extensions: 80828 Number of sequences better than 10.0: 26 Number of HSP's better than 10.0 without gapping: 26 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 80790 Number of HSP's gapped (non-prelim): 38 length of query: 458 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 436 effective length of database: 17,147,199,772 effective search space: 7476179100592 effective search space used: 7476179100592 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)