ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbart37f04 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_468409.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1290 Score = 95.6 bits (48), Expect = 1e-16 Identities = 192/240 (80%) Strand = Plus / Minus Query: 151 gcttcatctgtacaactcgaggcgcttgggcttgctctggatgaccgcctcgatcttctc 210 |||||||||||| ||||| |||||| |||||||| |||| ||||| |||||||| || Sbjct: 1053 gcttcatctgtatgactcggtgcgcttcggcttgctttggaccaccgcttcgatcttgtc 994 Query: 211 caggacctccggagtcagcagcgggacgacctccagggccttcatgttctccacgatctg 270 | ||| || || || |||||||| | ||| || |||||||||||||| || || ||||| Sbjct: 993 gacgacttctggggttagcagcggaatgacatcgagggccttcatgttttcaacaatctg 934 Query: 271 gctttctttggtggccccggtgatcatggacaacacgttggggttagacgcgcaccacgc 330 | ||||||| ||||| || ||||||| || | ||||| ||||| || ||||||||||| Sbjct: 933 gttttcttttgtggctccagtgatcacagatgagacgtttgggttcgatgcgcaccacgc 874 Query: 331 gatacccagctgggccatcgagaccccgagctcggaagcgatcggtttgagcccgttcac 390 |||| | || ||||| | ||| || || ||||| ||||| || ||||| ||||| ||||| Sbjct: 873 gatagcaagttgggctaacgaaacaccaagctcagaagcaattggttttagcccattcac 814
>ref|XM_507048.1| PREDICTED Oryza sativa (japonica cultivar-group), P0643F09.35 mRNA Length = 1331 Score = 95.6 bits (48), Expect = 1e-16 Identities = 192/240 (80%) Strand = Plus / Minus Query: 151 gcttcatctgtacaactcgaggcgcttgggcttgctctggatgaccgcctcgatcttctc 210 |||||||||||| ||||| |||||| |||||||| |||| ||||| |||||||| || Sbjct: 1100 gcttcatctgtatgactcggtgcgcttcggcttgctttggaccaccgcttcgatcttgtc 1041 Query: 211 caggacctccggagtcagcagcgggacgacctccagggccttcatgttctccacgatctg 270 | ||| || || || |||||||| | ||| || |||||||||||||| || || ||||| Sbjct: 1040 gacgacttctggggttagcagcggaatgacatcgagggccttcatgttttcaacaatctg 981 Query: 271 gctttctttggtggccccggtgatcatggacaacacgttggggttagacgcgcaccacgc 330 | ||||||| ||||| || ||||||| || | ||||| ||||| || ||||||||||| Sbjct: 980 gttttcttttgtggctccagtgatcacagatgagacgtttgggttcgatgcgcaccacgc 921 Query: 331 gatacccagctgggccatcgagaccccgagctcggaagcgatcggtttgagcccgttcac 390 |||| | || ||||| | ||| || || ||||| ||||| || ||||| ||||| ||||| Sbjct: 920 gatagcaagttgggctaacgaaacaccaagctcagaagcaattggttttagcccattcac 861
>dbj|AK104135.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-204-E11, full insert sequence Length = 1290 Score = 95.6 bits (48), Expect = 1e-16 Identities = 192/240 (80%) Strand = Plus / Minus Query: 151 gcttcatctgtacaactcgaggcgcttgggcttgctctggatgaccgcctcgatcttctc 210 |||||||||||| ||||| |||||| |||||||| |||| ||||| |||||||| || Sbjct: 1053 gcttcatctgtatgactcggtgcgcttcggcttgctttggaccaccgcttcgatcttgtc 994 Query: 211 caggacctccggagtcagcagcgggacgacctccagggccttcatgttctccacgatctg 270 | ||| || || || |||||||| | ||| || |||||||||||||| || || ||||| Sbjct: 993 gacgacttctggggttagcagcggaatgacatcgagggccttcatgttttcaacaatctg 934 Query: 271 gctttctttggtggccccggtgatcatggacaacacgttggggttagacgcgcaccacgc 330 | ||||||| ||||| || ||||||| || | ||||| ||||| || ||||||||||| Sbjct: 933 gttttcttttgtggctccagtgatcacagatgagacgtttgggttcgatgcgcaccacgc 874 Query: 331 gatacccagctgggccatcgagaccccgagctcggaagcgatcggtttgagcccgttcac 390 |||| | || ||||| | ||| || || ||||| ||||| || ||||| ||||| ||||| Sbjct: 873 gatagcaagttgggctaacgaaacaccaagctcagaagcaattggttttagcccattcac 814
>dbj|AK072707.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023139I11, full insert sequence Length = 1329 Score = 95.6 bits (48), Expect = 1e-16 Identities = 192/240 (80%) Strand = Plus / Minus Query: 151 gcttcatctgtacaactcgaggcgcttgggcttgctctggatgaccgcctcgatcttctc 210 |||||||||||| ||||| |||||| |||||||| |||| ||||| |||||||| || Sbjct: 1098 gcttcatctgtatgactcggtgcgcttcggcttgctttggaccaccgcttcgatcttgtc 1039 Query: 211 caggacctccggagtcagcagcgggacgacctccagggccttcatgttctccacgatctg 270 | ||| || || || |||||||| | ||| || |||||||||||||| || || ||||| Sbjct: 1038 gacgacttctggggttagcagcggaatgacatcgagggccttcatgttttcaacaatctg 979 Query: 271 gctttctttggtggccccggtgatcatggacaacacgttggggttagacgcgcaccacgc 330 | ||||||| ||||| || ||||||| || | ||||| ||||| || ||||||||||| Sbjct: 978 gttttcttttgtggctccagtgatcacagatgagacgtttgggttcgatgcgcaccacgc 919 Query: 331 gatacccagctgggccatcgagaccccgagctcggaagcgatcggtttgagcccgttcac 390 |||| | || ||||| | ||| || || ||||| ||||| || ||||| ||||| ||||| Sbjct: 918 gatagcaagttgggctaacgaaacaccaagctcagaagcaattggttttagcccattcac 859
>gb|U46758.1|OSU46758 Oryza sativa potassium channel beta subunit protein (KOB1) mRNA, complete cds Length = 1293 Score = 95.6 bits (48), Expect = 1e-16 Identities = 192/240 (80%) Strand = Plus / Minus Query: 151 gcttcatctgtacaactcgaggcgcttgggcttgctctggatgaccgcctcgatcttctc 210 |||||||||||| ||||| |||||| |||||||| |||| ||||| |||||||| || Sbjct: 1047 gcttcatctgtatgactcggtgcgcttcggcttgctttggaccaccgcttcgatcttgtc 988 Query: 211 caggacctccggagtcagcagcgggacgacctccagggccttcatgttctccacgatctg 270 | ||| || || || |||||||| | ||| || |||||||||||||| || || ||||| Sbjct: 987 gacgacttctggggttagcagcggaatgacatcgagggccttcatgttttcaacaatctg 928 Query: 271 gctttctttggtggccccggtgatcatggacaacacgttggggttagacgcgcaccacgc 330 | ||||||| ||||| || ||||||| || | ||||| ||||| || ||||||||||| Sbjct: 927 gttttcttttgtggctccagtgatcacagatgagacgtttgggttcgatgcgcaccacgc 868 Query: 331 gatacccagctgggccatcgagaccccgagctcggaagcgatcggtttgagcccgttcac 390 |||| | || ||||| | ||| || || ||||| ||||| || ||||| ||||| ||||| Sbjct: 867 gatagcaagttgggctaacgaaacaccaagctcagaagcaattggttttagcccattcac 808
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 56.0 bits (28), Expect = 9e-05 Identities = 88/108 (81%) Strand = Plus / Minus Query: 151 gcttcatctgtacaactcgaggcgcttgggcttgctctggatgaccgcctcgatcttctc 210 |||||||||||| ||||| |||||| |||||||| |||| ||||| |||||||| || Sbjct: 35090838 gcttcatctgtatgactcggtgcgcttcggcttgctttggaccaccgcttcgatcttgtc 35090779 Query: 211 caggacctccggagtcagcagcgggacgacctccagggccttcatgtt 258 | ||| || || || |||||||| | ||| || |||||||||||||| Sbjct: 35090778 gacgacttctggggttagcagcggaatgacatcgagggccttcatgtt 35090731 Score = 46.1 bits (23), Expect = 0.088 Identities = 98/123 (79%) Strand = Plus / Minus Query: 268 ctggctttctttggtggccccggtgatcatggacaacacgttggggttagacgcgcacca 327 |||| ||||||| ||||| || ||||||| || | ||||| ||||| || |||||||| Sbjct: 35090600 ctggttttcttttgtggctccagtgatcacagatgagacgtttgggttcgatgcgcacca 35090541 Query: 328 cgcgatacccagctgggccatcgagaccccgagctcggaagcgatcggtttgagcccgtt 387 ||||||| | || ||||| | ||| || || ||||| ||||| || ||||| ||||| || Sbjct: 35090540 cgcgatagcaagttgggctaacgaaacaccaagctcagaagcaattggttttagcccatt 35090481 Query: 388 cac 390 ||| Sbjct: 35090480 cac 35090478
>dbj|AP005111.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0643F09 Length = 161001 Score = 56.0 bits (28), Expect = 9e-05 Identities = 88/108 (81%) Strand = Plus / Minus Query: 151 gcttcatctgtacaactcgaggcgcttgggcttgctctggatgaccgcctcgatcttctc 210 |||||||||||| ||||| |||||| |||||||| |||| ||||| |||||||| || Sbjct: 151179 gcttcatctgtatgactcggtgcgcttcggcttgctttggaccaccgcttcgatcttgtc 151120 Query: 211 caggacctccggagtcagcagcgggacgacctccagggccttcatgtt 258 | ||| || || || |||||||| | ||| || |||||||||||||| Sbjct: 151119 gacgacttctggggttagcagcggaatgacatcgagggccttcatgtt 151072 Score = 46.1 bits (23), Expect = 0.088 Identities = 98/123 (79%) Strand = Plus / Minus Query: 268 ctggctttctttggtggccccggtgatcatggacaacacgttggggttagacgcgcacca 327 |||| ||||||| ||||| || ||||||| || | ||||| ||||| || |||||||| Sbjct: 150941 ctggttttcttttgtggctccagtgatcacagatgagacgtttgggttcgatgcgcacca 150882 Query: 328 cgcgatacccagctgggccatcgagaccccgagctcggaagcgatcggtttgagcccgtt 387 ||||||| | || ||||| | ||| || || ||||| ||||| || ||||| ||||| || Sbjct: 150881 cgcgatagcaagttgggctaacgaaacaccaagctcagaagcaattggttttagcccatt 150822 Query: 388 cac 390 ||| Sbjct: 150821 cac 150819
>dbj|AP004028.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1136_C12 Length = 103973 Score = 56.0 bits (28), Expect = 9e-05 Identities = 88/108 (81%) Strand = Plus / Minus Query: 151 gcttcatctgtacaactcgaggcgcttgggcttgctctggatgaccgcctcgatcttctc 210 |||||||||||| ||||| |||||| |||||||| |||| ||||| |||||||| || Sbjct: 64001 gcttcatctgtatgactcggtgcgcttcggcttgctttggaccaccgcttcgatcttgtc 63942 Query: 211 caggacctccggagtcagcagcgggacgacctccagggccttcatgtt 258 | ||| || || || |||||||| | ||| || |||||||||||||| Sbjct: 63941 gacgacttctggggttagcagcggaatgacatcgagggccttcatgtt 63894 Score = 46.1 bits (23), Expect = 0.088 Identities = 98/123 (79%) Strand = Plus / Minus Query: 268 ctggctttctttggtggccccggtgatcatggacaacacgttggggttagacgcgcacca 327 |||| ||||||| ||||| || ||||||| || | ||||| ||||| || |||||||| Sbjct: 63763 ctggttttcttttgtggctccagtgatcacagatgagacgtttgggttcgatgcgcacca 63704 Query: 328 cgcgatacccagctgggccatcgagaccccgagctcggaagcgatcggtttgagcccgtt 387 ||||||| | || ||||| | ||| || || ||||| ||||| || ||||| ||||| || Sbjct: 63703 cgcgatagcaagttgggctaacgaaacaccaagctcagaagcaattggttttagcccatt 63644 Query: 388 cac 390 ||| Sbjct: 63643 cac 63641
>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome Length = 3566135 Score = 48.1 bits (24), Expect = 0.022 Identities = 30/32 (93%) Strand = Plus / Plus Query: 197 gcctcgatcttctccaggacctccggagtcag 228 |||||||||||||||||| ||||||| ||||| Sbjct: 2745672 gcctcgatcttctccaggtcctccggcgtcag 2745703
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 282 tggccccggtgatcatggacaa 303 |||||||||||||||||||||| Sbjct: 1104900 tggccccggtgatcatggacaa 1104879
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome Length = 4501104 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 230 agcgggacgacctccagggc 249 |||||||||||||||||||| Sbjct: 2108047 agcgggacgacctccagggc 2108028
>emb|CR543861.1| Acinetobacter sp. ADP1 complete genome Length = 3598621 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 cgcttgggcttgctctggat 192 |||||||||||||||||||| Sbjct: 1509558 cgcttgggcttgctctggat 1509577
>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome Length = 2932766 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 162 acaactcgaggcgcttgggc 181 |||||||||||||||||||| Sbjct: 58700 acaactcgaggcgcttgggc 58681
>emb|BX511268.5| Zebrafish DNA sequence from clone CH211-66B9 in linkage group 2, complete sequence Length = 167067 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 3 acaacaaaatgtttcacacg 22 |||||||||||||||||||| Sbjct: 109056 acaacaaaatgtttcacacg 109075
>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome Length = 1849742 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 243 ccagggccttcatgttctcc 262 |||||||||||||||||||| Sbjct: 1068533 ccagggccttcatgttctcc 1068552
>gb|AE017221.1| Thermus thermophilus HB27, complete genome Length = 1894877 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 243 ccagggccttcatgttctcc 262 |||||||||||||||||||| Sbjct: 741511 ccagggccttcatgttctcc 741530 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,966,373 Number of Sequences: 3902068 Number of extensions: 2966373 Number of successful extensions: 54364 Number of sequences better than 10.0: 16 Number of HSP's better than 10.0 without gapping: 16 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 54088 Number of HSP's gapped (non-prelim): 271 length of query: 404 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 382 effective length of database: 17,147,199,772 effective search space: 6550230312904 effective search space used: 6550230312904 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
