ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart37d05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AB086416.1| Hordeum vulgare mRNA for O-methyltransferase, co... 381 e-102
2gb|AF033539.1|AF033539 Lolium perenne caffeic acid O-methyltrans... 297 2e-77
3gb|AF153825.1|AF153825 Festuca arundinacea comt1c caffeic acid O... 135 1e-28
4gb|BT009383.1| Triticum aestivum clone wlm96.pk033.c5:fis, full ... 121 2e-24
5gb|AY226581.1| Triticum aestivum caffeic acid O-methyltransferas... 119 9e-24
6gb|AF153823.1|AF153823 Festuca arundinacea comt1a caffeic acid O... 119 9e-24
7emb|AJ586105.1| Lolium multiflorum partial mRNA for putative caf... 107 3e-20
8gb|AF153824.1|AF153824 Festuca arundinacea comt1b caffeic acid O... 105 1e-19
9gb|AF033538.1|AF033538 Lolium perenne caffeic acid O-methyltrans... 103 5e-19
10gb|DQ223971.1| Triticum aestivum flavonoid O-methyltransferase m... 100 8e-18
11gb|AF502287.1| Triticum aestivum caffeic acid O-methyltransferas... 94 5e-16
12emb|AJ586106.1| Festuca arundinacea partial mRNA for putative ca... 94 5e-16
13emb|AJ231133.1|SOF231133 Saccharum officinarum mRNA for caffeic ... 88 3e-14
14gb|AF153826.1|AF153826 Festuca arundinacea comt3 caffeic acid O-... 88 3e-14
15gb|AF010291.1|AF010291 Lolium perenne bispecific caffeic acid/5-... 88 3e-14
16ref|XM_480185.1| Oryza sativa (japonica cultivar-group), mRNA 82 2e-12
17dbj|AK061859.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 2e-12
18dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
19gb|DQ288259.1| Oryza sativa (japonica cultivar-group) O-methyltr... 82 2e-12
20dbj|AP004460.2| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
21gb|AY365419.1| Saccharum hybrid cultivar caffeic acid 3-O-methyl... 80 8e-12
22gb|AY323305.1| Zea mays inbred line EP1 O-methyltransferase (com... 80 8e-12
23gb|AY323304.1| Zea mays inbred line Mo17 O-methyltransferase (co... 80 8e-12
24gb|AY323303.1| Zea mays inbred line W117 O-methyltransferase (co... 80 8e-12
25gb|AY323302.1| Zea mays inbred line Lan496 O-methyltransferase (... 80 8e-12
26gb|AY323301.1| Zea mays inbred line 212 O-methyltransferase (com... 80 8e-12
27gb|AY323300.1| Zea mays inbred line F7012 O-methyltransferase (c... 80 8e-12
28gb|AY323299.1| Zea mays inbred line F4 O-methyltransferase (comt... 80 8e-12
29gb|AY323298.1| Zea mays inbred line F324 O-methyltransferase (co... 80 8e-12
30gb|AY323297.1| Zea mays inbred line F288 O-methyltransferase (co... 80 8e-12
31gb|AY323296.1| Zea mays inbred line F2 O-methyltransferase (comt... 80 8e-12
32gb|AY323295.1| Zea mays inbred line B73 O-methyltransferase (com... 80 8e-12
33gb|AY323294.1| Zea mays inbred line B14 O-methyltransferase (com... 80 8e-12
34gb|AY323293.1| Zea mays Rottaler Silomais O-methyltransferase (c... 80 8e-12
35gb|AY323292.1| Zea mays inbred line DE811 O-methyltransferase (c... 80 8e-12
36gb|AY323291.1| Zea mays inbred line F1 O-methyltransferase (comt... 80 8e-12
37gb|AY323290.1| Zea mays inbred line F113 O-methyltransferase (co... 80 8e-12
38gb|AY323289.1| Zea mays inbred line F271 O-methyltransferase (co... 80 8e-12
39gb|AY323288.1| Zea mays inbred line F286 O-methyltransferase (co... 80 8e-12
40gb|AY323287.1| Zea mays inbred line F564 O-methyltransferase (co... 80 8e-12
41gb|AY323286.1| Zea mays inbred line F64 O-methyltransferase (com... 80 8e-12
42gb|AY323285.1| Zea mays inbred line F7 O-methyltransferase (comt... 80 8e-12
43gb|AY323284.1| Zea mays inbred line 16 O-methyltransferase (comt... 80 8e-12
44gb|AY323283.1| Zea mays inbred line W64A O-methyltransferase (co... 80 8e-12
45gb|AY323282.1| Zea mays inbred line Wis93-3520 O-methyltransfera... 80 8e-12
46gb|AY323281.1| Zea mays inbred line Wis94-443 O-methyltransferas... 80 8e-12
47gb|AY323280.1| Zea mays Noordlander O-methyltransferase (comt) g... 80 8e-12
48gb|AY323279.1| Zea mays Rainbow Flint O-methyltransferase (comt)... 80 8e-12
49gb|AY323278.1| Zea mays Sibiriaka O-methyltransferase (comt) gen... 80 8e-12
50gb|AY323277.1| Zea mays Polar Dent O-methyltransferase (comt) ge... 80 8e-12
51gb|AY323276.1| Zea mays inbred line Quebec28 O-methyltransferase... 80 8e-12
52gb|AY323275.1| Zea mays inbred line F66 O-methyltransferase (com... 80 8e-12
53gb|AY323274.1| Zea mays inbred line F7025 O-methyltransferase (c... 80 8e-12
54gb|AY323273.1| Zea mays inbred line Du101 O-methyltransferase (c... 80 8e-12
55gb|AY323272.1| Zea mays inbred line MBS847 O-methyltransferase (... 80 8e-12
56gb|M73235.1|MZEOMTH Zea mays O-methyltransferase (OMT) gene, com... 80 8e-12
57gb|AF033540.1|AF033540 Lolium perenne caffeic acid O-methyltrans... 78 3e-11
58gb|AY217766.1| Sorghum bicolor caffeic acid O-methyltransferase ... 74 5e-10
59gb|AF387790.1|AF387790 Sorghum bicolor O-methyltransferase mRNA,... 74 5e-10
60dbj|AB122056.1| Oryza sativa (japonica cultivar-group) COMT mRNA... 74 5e-10
61dbj|AK064768.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 5e-10
62gb|DQ001169.1| Acacia mangium x Acacia auriculiformis caffeic ac... 56 1e-04
63gb|AC079258.4| Homo sapiens BAC clone RP11-410J22 from 2, comple... 46 0.11
64gb|AC163277.4| Mus musculus BAC clone RP24-471O20 from chromosom... 42 1.7
65gb|AC138084.4| Mus musculus BAC clone RP23-353F23 from chromosom... 42 1.7
66ref|XM_742823.1| Aspergillus fumigatus Af293 AMP-binding protein... 42 1.7
67emb|BX037446.1|CNS09122 Single read from an extremity of a full-... 42 1.7
68gb|AC099022.1| Drosophila melanogaster, chromosome 2L, region 23... 42 1.7
69gb|AC008321.7| Drosophila melanogaster, chromosome 2L, region 23... 42 1.7
70gb|AE003580.3| Drosophila melanogaster chromosome 2L, section 11... 42 1.7
71gb|L09204.1|DROTRS7A Drosophila melanogaster transfer RNA (tRNA-... 42 1.7
72gb|AC116850.10| Mus musculus chromosome 8, clone RP24-396C10, co... 40 6.5
73gb|AF139593.2| Xanthobacter autotrophicus outer membrane recepto... 40 6.5
74gb|CP000352.1| Ralstonia metallidurans CH34, complete genome 40 6.5
75gb|BT009359.1| Triticum aestivum clone wlm96.pk025.c3:fis, full ... 40 6.5
76gb|BC035017.2| Homo sapiens sodium channel, voltage-gated, type ... 40 6.5
77gb|AC007268.5| Arabidopsis thaliana chromosome 2 clone T27D6 map... 40 6.5
78gb|AF410153.1| Swinepox virus isolate 17077-99, complete genome 40 6.5
79ref|XM_693754.1| PREDICTED: Danio rerio similar to gamma filamin... 40 6.5
80dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.5
81dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.5
82dbj|AP004754.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.5
83dbj|AP005826.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.5
84dbj|AP005797.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.5
85dbj|AK110984.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.5
86emb|BX890617.13| Zebrafish DNA sequence from clone DKEYP-84F11 i... 40 6.5
87emb|BX470230.5| Zebrafish DNA sequence from clone CH211-284B12 i... 40 6.5
88dbj|AK113726.1| Ciona intestinalis cDNA, clone:cicl006j12, full ... 40 6.5
89emb|AL954190.5| Zebrafish DNA sequence from clone DKEY-30O6 in l... 40 6.5
90emb|AL772211.7| Mouse DNA sequence from clone RP23-473B24 on chr... 40 6.5 
>dbj|AB086416.1| Hordeum vulgare mRNA for O-methyltransferase, complete cds
          Length = 1372

 Score =  381 bits (192), Expect = e-102
 Identities = 288/320 (90%)
 Strand = Plus / Minus

                                                                        
Query: 157  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 216
            |||||||||||||||||||||||||||||  ||  |||||||| ||||||||||||| ||
Sbjct: 1154 ctacttggtgtactccattgcccagaagttcgcaaagatgtagctggccttgacgcctgt 1095

                                                                        
Query: 217  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 276
            |||||| |||||| |||| |||||||||| |||||| |||| ||||||||||||||||||
Sbjct: 1094 aaaccctgcagccttggctagcttctcgaagtccctgaggttcctttccttgccgccggg 1035

                                                                        
Query: 277  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgttgtttgtggcgtc 336
            |||||||||||||| |||  ||||||| | |||||||||||||| ||||||||| |||||
Sbjct: 1034 gctgtacgccagcaagctggcgtccacacagattaacccctgcgcgttgtttgtcgcgtc 975

                                                                        
Query: 337  cgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 396
            ||||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 974  cgggttcactggcaggatacattccacgttgatcaccttaccatgcgcgggcagtgcgtc 915

                                                                        
Query: 397  gtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgaggatccactt 456
            ||||||||||||||| || |  ||||||||||||||||| ||||||  ||| ||||| ||
Sbjct: 914  gtagcagttcttgaggagtaccgcacactcgtcgtcgctgaagcaggggagaatccattt 855

                                
Query: 457  catgaggatggcgtctccgg 476
            |||| |||||||||||||||
Sbjct: 854  catggggatggcgtctccgg 835
to top
>gb|AF033539.1|AF033539 Lolium perenne caffeic acid O-methyltransferase (OMT2) mRNA, complete
            cds
          Length = 1436

 Score =  297 bits (150), Expect = 2e-77
 Identities = 282/326 (86%)
 Strand = Plus / Minus

                                                                        
Query: 157  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 216
            |||||| ||||||||||| ||||||||||||||| |||||||||||||| |||||| |||
Sbjct: 1130 ctacttagtgtactccatggcccagaagtcggcgaagatgtaggtggccgtgacgctggt 1071

                                                                        
Query: 217  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 276
            ||| |||||  || ||||||||||||| ||||||||  ||||||| ||||||||||| ||
Sbjct: 1070 aaagccggcgcccttggcgagcttctccaggtccctgtggtacctctccttgccgcccgg 1011

                                                                        
Query: 277  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgttgtttgtggcgtc 336
            ||||||| | ||||||||||  || |||  ||| ||| ||||||    ||| ||||||||
Sbjct: 1010 gctgtacacaagcaggctcaaatcgacggcgatcaacgcctgcgcaccgttggtggcgtc 951

                                                                        
Query: 337  cgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 396
            ||| |||||||||| ||| ||||| |||||||| || ||  |||| || ||||| |||||
Sbjct: 950  cggattcaccggcaagatgcactcgacgttgatgactttggcatgggcgggcagcgcgtc 891

                                                                        
Query: 397  gtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgaggatccactt 456
            ||||||||||||||||||| |||| |||||||||||||| ||||||||||||||||||||
Sbjct: 890  gtagcagttcttgagcagggtggcgcactcgtcgtcgctgaagcagttgaggatccactt 831

                                      
Query: 457  catgaggatggcgtctccggtgggca 482
            ||||||||||||||| |||| |||||
Sbjct: 830  catgaggatggcgtcgccggagggca 805
to top
>gb|AF153825.1|AF153825 Festuca arundinacea comt1c caffeic acid O-methyltransferase mRNA,
            complete cds
          Length = 1438

 Score =  135 bits (68), Expect = 1e-28
 Identities = 263/328 (80%)
 Strand = Plus / Minus

                                                                        
Query: 157  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 216
            |||||||||| |||| || |||||   || |||||||||||| |||| ||||||||||||
Sbjct: 1144 ctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacgccggt 1085

                                                                        
Query: 217  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 276
             || |||||  |||||||||||  |||||  |||||   |||||| ||| ||||||||||
Sbjct: 1084 gaagccggctcccctggcgagcgcctcgaactccctttcgtacctctccctgccgccggg 1025

                                                                        
Query: 277  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgttgtttgtggcgtc 336
            | ||| ||| |||| | ||| ||| |||  ||  | |||||||| | ||    |||| ||
Sbjct: 1024 gttgtgcgcgagcatgatcatgtcgacgtggaacaccccctgcgagctgggcttggcctc 965

                                                                        
Query: 337  cgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 396
            |||||||||||||||||| ||||| |||   | |||||| || ||||||||||| |||||
Sbjct: 964  cgggttcaccggcaggatgcactcgacgagcaccaccttgccgtgcgccggcagcgcgtc 905

                                                                        
Query: 397  gtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgaggatccactt 456
            ||||||||||||||||||  |||| || |  | ||||||  ||  || ||||||||||||
Sbjct: 904  gtagcagttcttgagcagcgtggcgcagtgctggtcgctccagtcgtggaggatccactt 845

                                        
Query: 457  catgaggatggcgtctccggtgggcacc 484
            ||||||||||||||| || | |||||||
Sbjct: 844  catgaggatggcgtcgcccgagggcacc 817
to top
>gb|BT009383.1| Triticum aestivum clone wlm96.pk033.c5:fis, full insert mRNA
           sequence
          Length = 1314

 Score =  121 bits (61), Expect = 2e-24
 Identities = 187/229 (81%)
 Strand = Plus / Minus

                                                                       
Query: 256 gtacctttccttgccgccggggctgtacgccagcaggctcacgtccacgctgattaaccc 315
           |||||| ||| ||||||||||| ||| ||| |||| | ||| ||| |||  || || |||
Sbjct: 977 gtacctctccctgccgccggggttgtgcgcgagcatgatcatgtcgacgtggaatacccc 918

                                                                       
Query: 316 ctgcgtgttgtttgtggcgtccgggttcaccggcaggatacactccacgttgatcacctt 375
           |||||  |||   ||||| |||||||||||||||||||| |||||||||   | ||||||
Sbjct: 917 ctgcgccttgggcgtggcctccgggttcaccggcaggatgcactccacgagcaccacctt 858

                                                                       
Query: 376 accatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgct 435
            || ||||||||||| |||||||||||||||||||||||  | || || |  ||||||||
Sbjct: 857 gccgtgcgccggcagcgcgtcgtagcagttcttgagcagcgtcgcgcagtgctcgtcgct 798

                                                            
Query: 436 aaagcagttgaggatccacttcatgaggatggcgtctccggtgggcacc 484
             ||  || ||||||||||||||||||||||||||| || | |||||||
Sbjct: 797 ccagtcgtggaggatccacttcatgaggatggcgtcgcccgagggcacc 749
to top
>gb|AY226581.1| Triticum aestivum caffeic acid O-methyltransferase (COMT1) mRNA,
           complete cds
          Length = 1371

 Score =  119 bits (60), Expect = 9e-24
 Identities = 132/156 (84%)
 Strand = Plus / Minus

                                                                       
Query: 329 gtggcgtccgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggc 388
           ||||| |||||||||||||||||||| |||||||||   | |||||| || |||||||||
Sbjct: 984 gtggcctccgggttcaccggcaggatgcactccacgagcaccaccttgccgtgcgccggc 925

                                                                       
Query: 389 agtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgagg 448
           || |||||||||||||||||||||||  | || || |  ||||||||  ||  || ||||
Sbjct: 924 agcgcgtcgtagcagttcttgagcagcgtcgcgcagtgctcgtcgctccagtcgtggagg 865

                                               
Query: 449 atccacttcatgaggatggcgtctccggtgggcacc 484
           ||||||||||||||||||||||| || | |||||||
Sbjct: 864 atccacttcatgaggatggcgtcgcccgagggcacc 829
to top
>gb|AF153823.1|AF153823 Festuca arundinacea comt1a caffeic acid O-methyltransferase mRNA,
            complete cds
          Length = 1446

 Score =  119 bits (60), Expect = 9e-24
 Identities = 261/328 (79%)
 Strand = Plus / Minus

                                                                        
Query: 157  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 216
            |||||||||| |||| || |||||   || |||||||||||| |||| ||||||||||||
Sbjct: 1127 ctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacgccggt 1068

                                                                        
Query: 217  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 276
             || |||||  ||||||||||   || ||  ||||||  |||||| ||| ||||||||||
Sbjct: 1067 gaatccggctcccctggcgagagcctggaactccctctcgtacctctccctgccgccggg 1008

                                                                        
Query: 277  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgttgtttgtggcgtc 336
            | ||| ||| |||| | ||| ||| |||  ||  | |||||||| | ||    |||| ||
Sbjct: 1007 gttgtgcgcgagcatgatcatgtcgacgtggaagaccccctgcgagctgggattggcctc 948

                                                                        
Query: 337  cgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 396
            |||||| ||||||||||| ||||| |||   |  ||||| || ||||||||||| |||||
Sbjct: 947  cgggttgaccggcaggatgcactcgacgagcacgaccttgccgtgcgccggcagcgcgtc 888

                                                                        
Query: 397  gtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgaggatccactt 456
            ||||||||||||||||||  |||| || |  | ||||||  ||  || ||||||||||||
Sbjct: 887  gtagcagttcttgagcagcgtggcgcagtgctggtcgctccagtcgtggaggatccactt 828

                                        
Query: 457  catgaggatggcgtctccggtgggcacc 484
            |||||||||||||||||| | |||||||
Sbjct: 827  catgaggatggcgtctcccgagggcacc 800
to top
>emb|AJ586105.1| Lolium multiflorum partial mRNA for putative caffeate
           o-methyltransferase (comt gene)
          Length = 878

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Minus

                                                                       
Query: 330 tggcgtccgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggca 389
           |||| |||||||||||||||||||| ||||| |||   | |||||| || ||||||||||
Sbjct: 804 tggcctccgggttcaccggcaggatgcactcgacgagcaccaccttgccgtgcgccggca 745

                                                                       
Query: 390 gtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgagga 449
           | |||||||||||||||||||||||  |||| || |  | ||||||  ||  || |||||
Sbjct: 744 gcgcgtcgtagcagttcttgagcagcgtggcgcagtgctggtcgctccagtcgtggagga 685

                                 
Query: 450 tccacttcatgaggatggcgtc 471
           ||||||||||||||||||||||
Sbjct: 684 tccacttcatgaggatggcgtc 663
to top
>gb|AF153824.1|AF153824 Festuca arundinacea comt1b caffeic acid O-methyltransferase mRNA,
            complete cds
          Length = 1440

 Score =  105 bits (53), Expect = 1e-19
 Identities = 236/297 (79%)
 Strand = Plus / Minus

                                                                        
Query: 188  gcgtagatgtaggtggccttgacgccggtaaacccggcagccctggcgagcttctcgagg 247
            ||||||||||| |||| |||||||||||| ||||| ||  ||||||| ||   |||||  
Sbjct: 1122 gcgtagatgtacgtggacttgacgccggtgaacccagctcccctggccagggcctcgaac 1063

                                                                        
Query: 248  tccctcaggtacctttccttgccgccggggctgtacgccagcaggctcacgtccacgctg 307
            ||||||  |||||| ||| ||||||||||| ||| ||| |||| | ||| ||| |||  |
Sbjct: 1062 tccctctcgtacctctccctgccgccggggttgtgcgcgagcatgatcatgtcgacgtgg 1003

                                                                        
Query: 308  attaacccctgcgtgttgtttgtggcgtccgggttcaccggcaggatacactccacgttg 367
            |  | |||||||| | ||    |||| |||||||| ||||||||||| ||||| |||   
Sbjct: 1002 aagaccccctgcgagctgggcttggcctccgggttgaccggcaggatgcactcgacgagc 943

                                                                        
Query: 368  atcaccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcg 427
            |  ||||| || ||||||||||| |||||||||||||||||||||||  |||| || |  
Sbjct: 942  acgaccttgccgtgcgccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgc 883

                                                                     
Query: 428  tcgtcgctaaagcagttgaggatccacttcatgaggatggcgtctccggtgggcacc 484
            | ||||||  ||  || ||||||||||||||||||||||||||| || | |||||||
Sbjct: 882  tggtcgctccagtcgtggaggatccacttcatgaggatggcgtcgcccgagggcacc 826
to top
>gb|AF033538.1|AF033538 Lolium perenne caffeic acid O-methyltransferase (OMT1) mRNA, complete
            cds
          Length = 1455

 Score =  103 bits (52), Expect = 5e-19
 Identities = 259/328 (78%)
 Strand = Plus / Minus

                                                                        
Query: 157  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 216
            |||||||||| |||| || |||||   || |||||||||||| |||| ||||||||||||
Sbjct: 1134 ctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacgccggt 1075

                                                                        
Query: 217  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 276
             || |||||  ||||||||||   || ||  ||||||  |||||| ||| ||||||||||
Sbjct: 1074 gaatccggctcccctggcgagagcctggaactccctctcgtacctctccctgccgccggg 1015

                                                                        
Query: 277  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgttgtttgtggcgtc 336
            | ||| ||| |||| | ||| ||| |||  ||  | |||||||| | ||    |||| ||
Sbjct: 1014 gttgtgcgcgagcatgatcatgtcgacgtggaagaccccctgcgagctgggattggcctc 955

                                                                        
Query: 337  cgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 396
            |||||| ||||||||||| ||||  |||   |  ||||| || ||||||||||| |||||
Sbjct: 954  cgggttgaccggcaggatgcactggacgagcacgaccttgccgtgcgccggcagcgcgtc 895

                                                                        
Query: 397  gtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgaggatccactt 456
            ||||||||||||||||||  |||| || |  | ||||||  ||  || ||||||||||||
Sbjct: 894  gtagcagttcttgagcagcgtggcgcagtgctggtcgctccagtcgtggaggatccactt 835

                                        
Query: 457  catgaggatggcgtctccggtgggcacc 484
            ||||||||||| |||||| | |||||||
Sbjct: 834  catgaggatggtgtctcccgagggcacc 807
to top
>gb|DQ223971.1| Triticum aestivum flavonoid O-methyltransferase mRNA, complete cds
          Length = 1233

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 125/150 (83%)
 Strand = Plus / Minus

                                                                       
Query: 335 tccgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcg 394
           ||||||||||| |||||||| |||||||||   | |||||| || ||||||||||  |||
Sbjct: 967 tccgggttcacaggcaggatgcactccacgagcaccaccttgccgtgcgccggcaacgcg 908

                                                                       
Query: 395 tcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgaggatccac 454
           ||||||||||||||||||||  | || || |  ||||||||  ||  || ||||||||||
Sbjct: 907 tcgtagcagttcttgagcagcgtcgcgcagtgctcgtcgctccagtcgtggaggatccac 848

                                         
Query: 455 ttcatgaggatggcgtctccggtgggcacc 484
           ||||||||||||||||| || | |||||||
Sbjct: 847 ttcatgaggatggcgtcgcccgagggcacc 818
to top
>gb|AF502287.1| Triticum aestivum caffeic acid O-methyltransferase mRNA, partial
           cds
          Length = 604

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 116/139 (83%)
 Strand = Plus / Minus

                                                                       
Query: 329 gtggcgtccgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggc 388
           ||||| |||||||||||||||| ||| |||||||||   || ||||| || |||| ||||
Sbjct: 536 gtggcttccgggttcaccggcaagatgcactccacgagcattaccttgccgtgcgtcggc 477

                                                                       
Query: 389 agtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgagg 448
           || ||||||||||||||||| |||||  | ||||| |  ||||||||  ||  || ||||
Sbjct: 476 agcgcgtcgtagcagttcttaagcagcgttgcacagtgctcgtcgctccagtcgtggagg 417

                              
Query: 449 atccacttcatgaggatgg 467
           |||||||||||||||||||
Sbjct: 416 atccacttcatgaggatgg 398
to top
>emb|AJ586106.1| Festuca arundinacea partial mRNA for putative caffeate
           o-methyltransferase (comt gene)
          Length = 878

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 128/155 (82%)
 Strand = Plus / Minus

                                                                       
Query: 330 tggcgtccgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggca 389
           |||| |||||||| ||||||||||| ||||  |||   |  ||||| || ||||||||||
Sbjct: 804 tggcctccgggttgaccggcaggatgcacttgacgagcacgaccttgccgtgcgccggca 745

                                                                       
Query: 390 gtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgagga 449
           | |||||||||||||||||||||||  |||| || |  | ||||||  ||  || |||||
Sbjct: 744 gcgcgtcgtagcagttcttgagcagcgtggcgcagtgctggtcgctccagtcgtggagga 685

                                              
Query: 450 tccacttcatgaggatggcgtctccggtgggcacc 484
           ||||||||||||||||||||||||| | |||||||
Sbjct: 684 tccacttcatgaggatggcgtctcccgagggcacc 650
to top
>emb|AJ231133.1|SOF231133 Saccharum officinarum mRNA for caffeic acid 3-O-methyltransferase
          Length = 1486

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 110/132 (83%)
 Strand = Plus / Minus

                                                                        
Query: 340  gttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcgtcgta 399
            |||||||||||| |  ||||| ||| |||||||||| || | | ||||||| ||||||||
Sbjct: 1010 gttcaccggcagcacgcactcgacgatgatcaccttgccgttctccggcagcgcgtcgta 951

                                                                        
Query: 400  gcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgaggatccacttcat 459
            |||||||||||||||  |||| || |   |||||||  ||  || |||||||||||||||
Sbjct: 950  gcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatccacttcat 891

                        
Query: 460  gaggatggcgtc 471
            ||||||||||||
Sbjct: 890  gaggatggcgtc 879



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 158  tacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttga 209
            |||||| || |||| || ||||||  || |||||||||||||||||||||||
Sbjct: 1192 tacttgatgaactcgatggcccaggcgttggcgtagatgtaggtggccttga 1141
to top
>gb|AF153826.1|AF153826 Festuca arundinacea comt3 caffeic acid O-methyltransferase mRNA,
            complete cds
          Length = 1430

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 257/328 (78%)
 Strand = Plus / Minus

                                                                        
Query: 157  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 216
            |||||||||| |||| || ||||||  || |||||||||||| |||| ||||| ||||| 
Sbjct: 1160 ctacttggtgaactcgatggcccaggcgttggcgtagatgtatgtggacttgaagccggc 1101

                                                                        
Query: 217  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 276
             || || ||  || ||||||||  |||||  ||||||  |||||| ||| |||| |||||
Sbjct: 1100 gaagccagctcccttggcgagcgcctcgaactccctctcgtacctctccctgccaccggg 1041

                                                                        
Query: 277  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgttgtttgtggcgtc 336
            | ||| ||| |||| | ||| ||| |||  ||  | |||||||| | ||    |||| ||
Sbjct: 1040 gttgtgcgcgagcatgatcatgtcgacgtggaacaccccctgcgagctgggcttggcctc 981

                                                                        
Query: 337  cgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 396
            ||||| |||||||||||| ||||||||    | |||||| || ||||| ||||| |||||
Sbjct: 980  cgggtgcaccggcaggatgcactccaccagtaccaccttgccgtgcgctggcagcgcgtc 921

                                                                        
Query: 397  gtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgaggatccactt 456
            ||||||||||||||||||  |||| || |  | ||||||  ||  || ||||||||||||
Sbjct: 920  gtagcagttcttgagcagcgtggcgcaatgctggtcgctccagtcgtggaggatccactt 861

                                        
Query: 457  catgaggatggcgtctccggtgggcacc 484
            ||| ||||||||||| || | |||||||
Sbjct: 860  catcaggatggcgtcgcccgagggcacc 833
to top
>gb|AF010291.1|AF010291 Lolium perenne bispecific caffeic acid/5-hydroxyferulic acid
            O-methyltransferase mRNA, complete cds
          Length = 1475

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 257/328 (78%)
 Strand = Plus / Minus

                                                                        
Query: 157  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 216
            |||||||||| |||| || |||||   || |||||||||||| |||| |||||| |||||
Sbjct: 1153 ctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacaccggt 1094

                                                                        
Query: 217  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 276
             || |||||  ||||||||||   || ||  ||||||  |||||| ||| |||| |||||
Sbjct: 1093 gaatccggctcccctggcgagagcctggaactccctctcgtacctctccctgcccccggg 1034

                                                                        
Query: 277  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgttgtttgtggcgtc 336
            | ||| ||| |||| | ||| ||| |||  ||  | |||||||| | ||    |||| ||
Sbjct: 1033 gttgtgcgcgagcatgatcatgtcgacgtggaagaccccctgcgagctgggattggcctc 974

                                                                        
Query: 337  cgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 396
            |||||| ||||||||||| ||||| |||   |  ||||| || | ||||||||| |||||
Sbjct: 973  cgggttgaccggcaggatgcactcgacgagcacgaccttgccgttcgccggcagcgcgtc 914

                                                                        
Query: 397  gtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgaggatccactt 456
            ||||||||||||||||||  |||| || |  | ||||||  ||  || ||||||||||||
Sbjct: 913  gtagcagttcttgagcagcgtggcgcagtgctggtcgctccagtcgtggaggatccactt 854

                                        
Query: 457  catgaggatggcgtctccggtgggcacc 484
            |||||||||||| ||||| | |||||||
Sbjct: 853  catgaggatggcatctcccgagggcacc 826
to top
>ref|XM_480185.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1425

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                        
Query: 157  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 216
            |||||||||| |||| || ||||||  || ||||||||||||||||||||||| ||||||
Sbjct: 1189 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 1130

                                                                        
Query: 217  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 276
             || ||||| || | |||||||| |  ||  ||||||  |||||| ||||||||||||||
Sbjct: 1129 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 1070

             
Query: 277  g 277
            |
Sbjct: 1069 g 1069



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Minus

                                                                       
Query: 370 caccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtc 429
           |||||| || ||| ||||||| |||||||||||||||||||||||    || || |  ||
Sbjct: 976 caccttcccgtgctccggcagcgcgtcgtagcagttcttgagcagccgcgcgcagtgctc 917

                                                     
Query: 430 gtcgctaaagcagttgaggatccacttcatgaggatggcgtc 471
           ||||||  ||  || ||||||||||||||| |||||||||||
Sbjct: 916 gtcgctccagtcgtggaggatccacttcatcaggatggcgtc 875
to top
>dbj|AK061859.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-G09, full
           insert sequence
          Length = 1227

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 157 ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 216
           |||||||||| |||| || ||||||  || ||||||||||||||||||||||| ||||||
Sbjct: 987 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 928

                                                                       
Query: 217 aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 276
            || ||||| || | |||||||| |  ||  ||||||  |||||| ||||||||||||||
Sbjct: 927 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 868

            
Query: 277 g 277
           |
Sbjct: 867 g 867



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Minus

                                                                       
Query: 370 caccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtc 429
           |||||| || ||| ||||||| |||||||||||||||||||||||    || || |  ||
Sbjct: 774 caccttcccgtgctccggcagcgcgtcgtagcagttcttgagcagccgcgcgcagtgctc 715

                                                     
Query: 430 gtcgctaaagcagttgaggatccacttcatgaggatggcgtc 471
           ||||||  ||  || ||||||||||||||| |||||||||||
Sbjct: 714 gtcgctccagtcgtggaggatccacttcatcaggatggcgtc 673
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                           
Query: 157     ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 216
               |||||||||| |||| || ||||||  || ||||||||||||||||||||||| ||||||
Sbjct: 3331696 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 3331755

                                                                           
Query: 217     aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 276
                || ||||| || | |||||||| |  ||  ||||||  |||||| ||||||||||||||
Sbjct: 3331756 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 3331815

                
Query: 277     g 277
               |
Sbjct: 3331816 g 3331816



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Plus

                                                                           
Query: 370     caccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtc 429
               |||||| || ||| ||||||| |||||||||||||||||||||||    || || |  ||
Sbjct: 3331909 caccttcccgtgctccggcagcgcgtcgtagcagttcttgagcagccgcgcgcagtgctc 3331968

                                                         
Query: 430     gtcgctaaagcagttgaggatccacttcatgaggatggcgtc 471
               ||||||  ||  || ||||||||||||||| |||||||||||
Sbjct: 3331969 gtcgctccagtcgtggaggatccacttcatcaggatggcgtc 3332010
to top
>gb|DQ288259.1| Oryza sativa (japonica cultivar-group) O-methyltransferase (ROMT-9)
            mRNA, complete cds
          Length = 1190

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                        
Query: 157  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 216
            |||||||||| |||| || ||||||  || ||||||||||||||||||||||| ||||||
Sbjct: 1121 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 1062

                                                                        
Query: 217  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 276
             || ||||| || | |||||||| |  ||  ||||||  |||||| ||||||||||||||
Sbjct: 1061 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 1002

             
Query: 277  g 277
            |
Sbjct: 1001 g 1001



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Minus

                                                                       
Query: 370 caccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtc 429
           |||||| || ||| ||||||| |||||||||||||||||||||||    || || |  ||
Sbjct: 908 caccttcccgtgctccggcagcgcgtcgtagcagttcttgagcagccgcgcgcagtgctc 849

                                                     
Query: 430 gtcgctaaagcagttgaggatccacttcatgaggatggcgtc 471
           ||||||  ||  || ||||||||||||||| |||||||||||
Sbjct: 848 gtcgctccagtcgtggaggatccacttcatcaggatggcgtc 807
to top
>dbj|AP004460.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0438H08
          Length = 148626

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                          
Query: 157    ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 216
              |||||||||| |||| || ||||||  || ||||||||||||||||||||||| ||||||
Sbjct: 109263 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 109322

                                                                          
Query: 217    aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 276
               || ||||| || | |||||||| |  ||  ||||||  |||||| ||||||||||||||
Sbjct: 109323 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 109382

               
Query: 277    g 277
              |
Sbjct: 109383 g 109383



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Plus

                                                                          
Query: 370    caccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtc 429
              |||||| || ||| ||||||| |||||||||||||||||||||||    || || |  ||
Sbjct: 109476 caccttcccgtgctccggcagcgcgtcgtagcagttcttgagcagccgcgcgcagtgctc 109535

                                                        
Query: 430    gtcgctaaagcagttgaggatccacttcatgaggatggcgtc 471
              ||||||  ||  || ||||||||||||||| |||||||||||
Sbjct: 109536 gtcgctccagtcgtggaggatccacttcatcaggatggcgtc 109577
to top
>gb|AY365419.1| Saccharum hybrid cultivar caffeic acid 3-O-methyltransferase (COMT)
            gene, complete cds
          Length = 2012

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 109/132 (82%)
 Strand = Plus / Minus

                                                                        
Query: 340  gttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcgtcgta 399
            |||||||||||| |  ||||| |||  ||||||||| || | | ||||||| ||||||||
Sbjct: 1829 gttcaccggcagcacgcactcgacgacgatcaccttgccgttctccggcagcgcgtcgta 1770

                                                                        
Query: 400  gcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgaggatccacttcat 459
            |||||||||||||||  |||| || |   |||||||  ||  || |||||||||||||||
Sbjct: 1769 gcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatccacttcat 1710

                        
Query: 460  gaggatggcgtc 471
            ||||||||||||
Sbjct: 1709 gaggatggcgtc 1698



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 158  tacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttga 209
            |||||| || |||| || ||||||  || |||||||||||||||||||||||
Sbjct: 2011 tacttgatgaactcgatggcccaggcgttggcgtagatgtaggtggccttga 1960
to top
>gb|AY323305.1| Zea mays inbred line EP1 O-methyltransferase (comt) gene, partial cds
          Length = 2782

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2576 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2517

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2516 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2477



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 2773 ggcgtagatgtaggtggccttga 2751
to top
>gb|AY323304.1| Zea mays inbred line Mo17 O-methyltransferase (comt) gene, complete
            cds
          Length = 2955

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2392 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2333

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2332 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2293



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 2589 ggcgtagatgtaggtggccttga 2567
to top
>gb|AY323303.1| Zea mays inbred line W117 O-methyltransferase (comt) gene, partial
            cds
          Length = 2925

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2719 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2660

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2659 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2620



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 2916 ggcgtagatgtaggtggccttga 2894
to top
>gb|AY323302.1| Zea mays inbred line Lan496 O-methyltransferase (comt) gene, complete
            cds
          Length = 3282

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2719 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2660

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2659 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2620



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 2916 ggcgtagatgtaggtggccttga 2894
to top
>gb|AY323301.1| Zea mays inbred line 212 O-methyltransferase (comt) gene, partial cds
          Length = 2757

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2551 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2492

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2491 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2452



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 2748 ggcgtagatgtaggtggccttga 2726
to top
>gb|AY323300.1| Zea mays inbred line F7012 O-methyltransferase (comt) gene, partial
            cds
          Length = 2850

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2644 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2585

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2584 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2545



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 2841 ggcgtagatgtaggtggccttga 2819
to top
>gb|AY323299.1| Zea mays inbred line F4 O-methyltransferase (comt) gene, partial cds
          Length = 2675

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2467 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2408

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2407 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2368



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 2664 ggcgtagatgtaggtggccttga 2642
to top
>gb|AY323298.1| Zea mays inbred line F324 O-methyltransferase (comt) gene, partial
            cds
          Length = 2782

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2576 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2517

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2516 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2477



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 2773 ggcgtagatgtaggtggccttga 2751
to top
>gb|AY323297.1| Zea mays inbred line F288 O-methyltransferase (comt) gene, partial
            cds
          Length = 2927

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2719 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2660

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2659 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2620



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 2916 ggcgtagatgtaggtggccttga 2894
to top
>gb|AY323296.1| Zea mays inbred line F2 O-methyltransferase (comt) gene, partial cds
          Length = 3206

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2997 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2938

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2937 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2898



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 3194 ggcgtagatgtaggtggccttga 3172
to top
>gb|AY323295.1| Zea mays inbred line B73 O-methyltransferase (comt) gene, complete
            cds
          Length = 2676

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2437 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2378

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2377 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2338



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 2634 ggcgtagatgtaggtggccttga 2612
to top
>gb|AY323294.1| Zea mays inbred line B14 O-methyltransferase (comt) gene, partial cds
          Length = 2643

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2437 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2378

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2377 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2338



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 2634 ggcgtagatgtaggtggccttga 2612
to top
>gb|AY323293.1| Zea mays Rottaler Silomais O-methyltransferase (comt) gene, partial
            cds
          Length = 3151

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2943 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2884

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2883 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2844



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 3140 ggcgtagatgtaggtggccttga 3118
to top
>gb|AY323292.1| Zea mays inbred line DE811 O-methyltransferase (comt) gene, partial
            cds
          Length = 2639

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2433 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2374

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2373 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2334



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 2630 ggcgtagatgtaggtggccttga 2608
to top
>gb|AY323291.1| Zea mays inbred line F1 O-methyltransferase (comt) gene, partial cds
          Length = 3102

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2896 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2837

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2836 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2797



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 3093 ggcgtagatgtaggtggccttga 3071
to top
>gb|AY323290.1| Zea mays inbred line F113 O-methyltransferase (comt) gene, partial
            cds
          Length = 3154

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2948 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2889

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2888 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2849



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 3145 ggcgtagatgtaggtggccttga 3123
to top
>gb|AY323289.1| Zea mays inbred line F271 O-methyltransferase (comt) gene, partial
            cds
          Length = 2892

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2686 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2627

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2626 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2587



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 2883 ggcgtagatgtaggtggccttga 2861
to top
>gb|AY323288.1| Zea mays inbred line F286 O-methyltransferase (comt) gene, partial
            cds
          Length = 2951

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2743 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2684

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2683 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2644



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 2940 ggcgtagatgtaggtggccttga 2918
to top
>gb|AY323287.1| Zea mays inbred line F564 O-methyltransferase (comt) gene, complete
            cds
          Length = 2982

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2743 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2684

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2683 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2644



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 2940 ggcgtagatgtaggtggccttga 2918
to top
>gb|AY323286.1| Zea mays inbred line F64 O-methyltransferase (comt) gene, partial cds
          Length = 2948

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2742 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2683

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2682 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2643



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 2939 ggcgtagatgtaggtggccttga 2917
to top
>gb|AY323285.1| Zea mays inbred line F7 O-methyltransferase (comt) gene, partial cds
          Length = 3131

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2925 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2866

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2865 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2826



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 3122 ggcgtagatgtaggtggccttga 3100
to top
>gb|AY323284.1| Zea mays inbred line 16 O-methyltransferase (comt) gene, complete cds
          Length = 3190

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2951 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2892

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2891 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2852



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 3148 ggcgtagatgtaggtggccttga 3126
to top
>gb|AY323283.1| Zea mays inbred line W64A O-methyltransferase (comt) gene, partial
            cds
          Length = 2748

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2542 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2483

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2482 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2443



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 2739 ggcgtagatgtaggtggccttga 2717
to top
>gb|AY323282.1| Zea mays inbred line Wis93-3520 O-methyltransferase (comt) gene,
            complete cds
          Length = 3088

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2849 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2790

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2789 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2750



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 3046 ggcgtagatgtaggtggccttga 3024
to top
>gb|AY323281.1| Zea mays inbred line Wis94-443 O-methyltransferase (comt) gene,
            complete cds
          Length = 3095

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2856 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2797

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2796 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2757



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 3053 ggcgtagatgtaggtggccttga 3031
to top
>gb|AY323280.1| Zea mays Noordlander O-methyltransferase (comt) gene, partial cds
          Length = 3105

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2899 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2840

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2839 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2800



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 3096 ggcgtagatgtaggtggccttga 3074
to top
>gb|AY323279.1| Zea mays Rainbow Flint O-methyltransferase (comt) gene, partial cds
          Length = 3111

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2903 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2844

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2843 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2804



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 3100 ggcgtagatgtaggtggccttga 3078
to top
>gb|AY323278.1| Zea mays Sibiriaka O-methyltransferase (comt) gene, partial cds
          Length = 3146

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2938 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2879

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2878 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2839



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 3135 ggcgtagatgtaggtggccttga 3113
to top
>gb|AY323277.1| Zea mays Polar Dent O-methyltransferase (comt) gene, partial cds
          Length = 3073

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2865 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2806

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2805 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2766



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 3062 ggcgtagatgtaggtggccttga 3040
to top
>gb|AY323276.1| Zea mays inbred line Quebec28 O-methyltransferase (comt) gene,
            complete cds
          Length = 3061

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2834 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2775

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2774 ggaggatccacttcatgaggatggcgtcgccggcgggcac 2735



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 3031 ggcgtagatgtaggtggccttga 3009
to top
>gb|AY323275.1| Zea mays inbred line F66 O-methyltransferase (comt) gene, complete
            cds
          Length = 2041

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 1814 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 1755

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 1754 ggaggatccacttcatgaggatggcgtcgccggcgggcac 1715



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 2011 ggcgtagatgtaggtggccttga 1989
to top
>gb|AY323274.1| Zea mays inbred line F7025 O-methyltransferase (comt) gene, complete
            cds
          Length = 2326

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 1763 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 1704

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 1703 ggaggatccacttcatgaggatggcgtcgccggcgggcac 1664



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 1960 ggcgtagatgtaggtggccttga 1938
to top
>gb|AY323273.1| Zea mays inbred line Du101 O-methyltransferase (comt) gene, complete
            cds
          Length = 2074

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 1835 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 1776

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 1775 ggaggatccacttcatgaggatggcgtcgccggcgggcac 1736



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 2032 ggcgtagatgtaggtggccttga 2010
to top
>gb|AY323272.1| Zea mays inbred line MBS847 O-methyltransferase (comt) gene, complete
            cds
          Length = 2326

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 1763 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 1704

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 1703 ggaggatccacttcatgaggatggcgtcgccggcgggcac 1664



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 1960 ggcgtagatgtaggtggccttga 1938
to top
>gb|M73235.1|MZEOMTH Zea mays O-methyltransferase (OMT) gene, complete cds
          Length = 2512

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 1914 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 1855

                                                    
Query: 444  tgaggatccacttcatgaggatggcgtctccggtgggcac 483
             ||||||||||||||||||||||||||| |||| ||||||
Sbjct: 1854 ggaggatccacttcatgaggatggcgtcgccggcgggcac 1815



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 187  ggcgtagatgtaggtggccttga 209
            |||||||||||||||||||||||
Sbjct: 2111 ggcgtagatgtaggtggccttga 2089
to top
>gb|AF033540.1|AF033540 Lolium perenne caffeic acid O-methyltransferase (OMT3) mRNA, complete
            cds
          Length = 1436

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 246/315 (78%)
 Strand = Plus / Minus

                                                                        
Query: 157  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 216
            |||||||||| |||| || ||||||  || |||||||||||| |||| ||||| ||||| 
Sbjct: 1171 ctacttggtgaactcgatggcccaggcgttggcgtagatgtatgtggacttgaagccggc 1112

                                                                        
Query: 217  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 276
             || || ||  |||||||||||  ||||   ||||||  |||||| ||| ||||||| ||
Sbjct: 1111 gaagccagctcccctggcgagcgcctcgtactccctctcgtacctctccctgccgcctgg 1052

                                                                        
Query: 277  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgttgtttgtggcgtc 336
            | ||| ||| |||| | ||| ||| |||  ||  | |||||||| | ||    |||| ||
Sbjct: 1051 gttgtgcgcgagcatgatcatgtcgacgtggaacaccccctgcgagctgggcttggcctc 992

                                                                        
Query: 337  cgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 396
            |||||||||||||||||| ||||||||    | ||||||||| |||   ||||| |||||
Sbjct: 991  cgggttcaccggcaggatgcactccaccagcaccaccttaccgtgcattggcagcgcgtc 932

                                                                        
Query: 397  gtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgaggatccactt 456
            ||||||||||||||||||  || |||| |  | ||| ||  ||  || ||||||||||||
Sbjct: 931  gtagcagttcttgagcagcgtgccacaatgctggtcactccagtcgtggaggatccactt 872

                           
Query: 457  catgaggatggcgtc 471
            ||| |||||||||||
Sbjct: 871  catcaggatggcgtc 857
to top
>gb|AY217766.1| Sorghum bicolor caffeic acid O-methyltransferase gene, complete cds
          Length = 3312

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 384  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2549 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2490

                                             
Query: 444  tgaggatccacttcatgaggatggcgtctccgg 476
             ||||||||||||||||||||||||||| ||||
Sbjct: 2489 ggaggatccacttcatgaggatggcgtcgccgg 2457



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 158  tacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttga 209
            |||||| || |||| || ||||||  || |||||||||||||||||||||||
Sbjct: 2778 tacttgatgaactcgatggcccaggcgttggcgtagatgtaggtggccttga 2727
to top
>gb|AF387790.1|AF387790 Sorghum bicolor O-methyltransferase mRNA, complete cds
          Length = 1458

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                       
Query: 384 ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 443
           ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 968 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 909

                                            
Query: 444 tgaggatccacttcatgaggatggcgtctccgg 476
            ||||||||||||||||||||||||||| ||||
Sbjct: 908 ggaggatccacttcatgaggatggcgtcgccgg 876



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 158  tacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttga 209
            |||||| || |||| || ||||||  || |||||||||||||||||||||||
Sbjct: 1197 tacttgatgaactcgatggcccaggcgttggcgtagatgtaggtggccttga 1146
to top
>dbj|AB122056.1| Oryza sativa (japonica cultivar-group) COMT mRNA for caffeic acid
           o-methyl transferase, partial cds
          Length = 1067

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 100/121 (82%)
 Strand = Plus / Minus

                                                                       
Query: 157 ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 216
           |||||| ||| |||| || ||||||  || ||||||||||||||||||||||| ||||||
Sbjct: 807 ctactttgtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 748

                                                                       
Query: 217 aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 276
            || ||||| || | |||||||| |  ||  ||||||  |||||| ||||||||||||||
Sbjct: 747 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 688

            
Query: 277 g 277
           |
Sbjct: 687 g 687



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Minus

                                                                       
Query: 370 caccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtc 429
           |||||| || ||| ||||||| |||||||||||||||||||||||    || || |  ||
Sbjct: 594 caccttcccgtgctccggcagcgcgtcgtagcagttcttgagcagccgcgcgcagtgctc 535

                                                     
Query: 430 gtcgctaaagcagttgaggatccacttcatgaggatggcgtc 471
           ||||||  ||  || ||||||||||||||| |||||||||||
Sbjct: 534 gtcgctccagtcgtggaggatccacttcatcaggatggcgtc 493
to top
>dbj|AK064768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000A05, full
            insert sequence
          Length = 1425

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 100/121 (82%)
 Strand = Plus / Minus

                                                                        
Query: 157  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 216
            |||||| ||| |||| || ||||||  || ||||||||||||||||||||||| ||||||
Sbjct: 1189 ctactttgtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 1130

                                                                        
Query: 217  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 276
             || ||||| || | |||||||| |  ||  ||||||  |||||| ||||||||||||||
Sbjct: 1129 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 1070

             
Query: 277  g 277
            |
Sbjct: 1069 g 1069



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Minus

                                                                       
Query: 370 caccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtc 429
           |||||| || ||| ||||||| |||||||||||||||||||||||    || || |  ||
Sbjct: 976 caccttcccgtgctccggcagcgcgtcgtagcagttcttgagcagccgcgcgcagtgctc 917

                                                     
Query: 430 gtcgctaaagcagttgaggatccacttcatgaggatggcgtc 471
           ||||||  ||  || ||||||||||||||| |||||||||||
Sbjct: 916 gtcgctccagtcgtggaggatccacttcatcaggatggcgtc 875
to top
>gb|DQ001169.1| Acacia mangium x Acacia auriculiformis caffeic acid
           O-methyltransferase mRNA, complete cds
          Length = 1408

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 384 ccggcagtgcgtcgtagcagttcttgag 411
           ||||||||||||||||||||||||||||
Sbjct: 936 ccggcagtgcgtcgtagcagttcttgag 909
to top
>gb|AC079258.4| Homo sapiens BAC clone RP11-410J22 from 2, complete sequence
          Length = 169408

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 119   caagaacacagcagcatgctata 141
             |||||||||||||||||||||||
Sbjct: 96328 caagaacacagcagcatgctata 96350
to top
>gb|AC163277.4| Mus musculus BAC clone RP24-471O20 from chromosome 18, complete
             sequence
          Length = 173704

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 438   agcagttgaggatccacttca 458
             |||||||||||||||||||||
Sbjct: 32332 agcagttgaggatccacttca 32312
to top
>gb|AC138084.4| Mus musculus BAC clone RP23-353F23 from chromosome 18, complete sequence
          Length = 186489

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 438    agcagttgaggatccacttca 458
              |||||||||||||||||||||
Sbjct: 133655 agcagttgaggatccacttca 133635
to top
>ref|XM_742823.1| Aspergillus fumigatus Af293 AMP-binding protein (Afu5g04270) partial
            mRNA
          Length = 2127

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 231  tggcgagcttctcgaggtccctcag 255
            |||||| ||||||||||||||||||
Sbjct: 1930 tggcgatcttctcgaggtccctcag 1906
to top
>emb|BX037446.1|CNS09122 Single read from an extremity of a full-length cDNA clone made
          from Anopheles gambiae total adult females. 3-PRIME end
          of clone FK0AAA9DF09 of strain 6-9 of Anopheles gambiae
          (African malaria mosquito)
          Length = 691

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 16 cttccttttattcgaacacaa 36
          |||||||||||||||||||||
Sbjct: 25 cttccttttattcgaacacaa 45
to top
>gb|AC099022.1| Drosophila melanogaster, chromosome 2L, region 23C-23D, BAC clone
             BACR48B06, complete sequence
          Length = 184554

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 12    cttgcttccttttattcgaacacaa 36
             |||||||||||||||||||| ||||
Sbjct: 29824 cttgcttccttttattcgaatacaa 29800
to top
>gb|AC008321.7| Drosophila melanogaster, chromosome 2L, region 23D-23F, BAC clone
             BACR11E09, complete sequence
          Length = 169931

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 12    cttgcttccttttattcgaacacaa 36
             |||||||||||||||||||| ||||
Sbjct: 88188 cttgcttccttttattcgaatacaa 88164
to top
>gb|AE003580.3| Drosophila melanogaster chromosome 2L, section 11 of 83 of the complete
             sequence
          Length = 286920

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 12    cttgcttccttttattcgaacacaa 36
             |||||||||||||||||||| ||||
Sbjct: 28588 cttgcttccttttattcgaatacaa 28612
to top
>gb|L09204.1|DROTRS7A Drosophila melanogaster transfer RNA (tRNA-Ser7) gene
          Length = 3485

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 12  cttgcttccttttattcgaacacaa 36
           |||||||||||||||||||| ||||
Sbjct: 239 cttgcttccttttattcgaatacaa 215
to top
>gb|AC116850.10| Mus musculus chromosome 8, clone RP24-396C10, complete sequence
          Length = 147264

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 436   aaagcagttgaggatccact 455
             ||||||||||||||||||||
Sbjct: 81080 aaagcagttgaggatccact 81099
to top
>gb|AF139593.2| Xanthobacter autotrophicus outer membrane receptor-like protein
           gene, partial cds; and methylene tetrahydromethanopterin
           dehydrogenase (mtdB), methenyl tetrahydromethanopterin
           cyclohydrolase (mch), putative tetrahydromethanopterin
           biosynthesis protein, conserved hypothetical protein,
           putative tetrahydromethanopterin biosynthesis protein,
           putative cytochrome C protein,
           formyltransferase/cyclohydrolase complex subunit C
           (fhcC), formyltransferase/cyclohydrolase complex subunit
           D (fhcD), formyltransferase/cyclohydrolase complex
           subunit A (fhcA), formyltransferase/cyclohydrolase
           complex subunit B (fhcB), conserved hypothetical
           protein, and putative protein genes, complete cds
          Length = 13310

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 329 gtggcgtccgggttcaccggcagg 352
           ||||||||| ||||||||||||||
Sbjct: 586 gtggcgtccaggttcaccggcagg 563
to top
>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome
          Length = 3928089

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 275     gggctgtacgccagcaggct 294
               ||||||||||||||||||||
Sbjct: 1331511 gggctgtacgccagcaggct 1331530
to top
>gb|BT009359.1| Triticum aestivum clone wlm96.pk025.c3:fis, full insert mRNA
           sequence
          Length = 1308

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 341 ttcaccggcaggatacactccacgttgatcaccttaccat 380
           |||||||||||||| | ||||||| ||| |||||| ||||
Sbjct: 997 ttcaccggcaggatgccctccacgatgaccaccttgccat 958



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 445 gaggatccacttcatgaggatggcgtctccggtgggcacc 484
           |||||||||||||| |||||| || || |||| |||||||
Sbjct: 893 gaggatccacttcaggaggatagcatcgccggagggcacc 854
to top
>gb|BC035017.2| Homo sapiens sodium channel, voltage-gated, type IV, beta, mRNA
           (cDNA clone MGC:33513 IMAGE:4817294), complete cds
          Length = 4577

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 188 gcgtagatgtaggtggcctt 207
           ||||||||||||||||||||
Sbjct: 271 gcgtagatgtaggtggcctt 252
to top
>gb|AC007268.5| Arabidopsis thaliana chromosome 2 clone T27D6 map PR1, complete
            sequence
          Length = 89685

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   ttccttttattcgaacacaaaata 40
            ||||||| ||||||||||||||||
Sbjct: 1413 ttcctttaattcgaacacaaaata 1390
to top
>gb|AF410153.1| Swinepox virus isolate 17077-99, complete genome
          Length = 146454

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 81    tacggtcgattaagatttattagaaatt 108
             |||||| ||| |||||||||||||||||
Sbjct: 80246 tacggttgatgaagatttattagaaatt 80219
to top
>ref|XM_693754.1| PREDICTED: Danio rerio similar to gamma filamin (LOC570288), mRNA
          Length = 7913

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   caaaatacaaaatgaaacga 53
            ||||||||||||||||||||
Sbjct: 7345 caaaatacaaaatgaaacga 7326
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 268     gccgccggggctgtacgcca 287
               ||||||||||||||||||||
Sbjct: 5399480 gccgccggggctgtacgcca 5399499
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 351     ggatacactccacgttgatc 370
               ||||||||||||||||||||
Sbjct: 6810538 ggatacactccacgttgatc 6810557
to top
>dbj|AP004754.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0529B09
          Length = 138188

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 268   gccgccggggctgtacgcca 287
             ||||||||||||||||||||
Sbjct: 30414 gccgccggggctgtacgcca 30433
to top
>dbj|AP005826.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0758B01
          Length = 159206

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 351   ggatacactccacgttgatc 370
             ||||||||||||||||||||
Sbjct: 28264 ggatacactccacgttgatc 28283
to top
>dbj|AP005797.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:B1131G07
          Length = 133992

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 351    ggatacactccacgttgatc 370
              ||||||||||||||||||||
Sbjct: 131591 ggatacactccacgttgatc 131610
to top
>dbj|AK110984.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-174-C12, full
           insert sequence
          Length = 2189

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 351 ggatacactccacgttgatc 370
           ||||||||||||||||||||
Sbjct: 791 ggatacactccacgttgatc 810
to top
>emb|BX890617.13| Zebrafish DNA sequence from clone DKEYP-84F11 in linkage group 19,
             complete sequence
          Length = 182182

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 31    acacaaaatacaaaatgaaa 50
             ||||||||||||||||||||
Sbjct: 13106 acacaaaatacaaaatgaaa 13125
to top
>emb|BX470230.5| Zebrafish DNA sequence from clone CH211-284B12 in linkage group 4,
             complete sequence
          Length = 173564

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    caaaatacaaaatgaaacga 53
             ||||||||||||||||||||
Sbjct: 65724 caaaatacaaaatgaaacga 65705
to top
>dbj|AK113726.1| Ciona intestinalis cDNA, clone:cicl006j12, full insert sequence
          Length = 1703

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 37   aatacaaaatgaaacgattg 56
            ||||||||||||||||||||
Sbjct: 1599 aatacaaaatgaaacgattg 1580
to top
>emb|AL954190.5| Zebrafish DNA sequence from clone DKEY-30O6 in linkage group 4,
             complete sequence
          Length = 144062

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    caaaatacaaaatgaaacga 53
             ||||||||||||||||||||
Sbjct: 28373 caaaatacaaaatgaaacga 28354
to top
>emb|AL772211.7| Mouse DNA sequence from clone RP23-473B24 on chromosome 4, complete
             sequence
          Length = 189040

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 121   agaacacagcagcatgctat 140
             ||||||||||||||||||||
Sbjct: 51136 agaacacagcagcatgctat 51155


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,301,609
Number of Sequences: 3902068
Number of extensions: 4301609
Number of successful extensions: 73069
Number of sequences better than 10.0: 90
Number of HSP's better than 10.0 without gapping: 90
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 72718
Number of HSP's gapped (non-prelim): 335
length of query: 484
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 462
effective length of database: 17,147,199,772
effective search space: 7922006294664
effective search space used: 7922006294664
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top