ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart37c05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_463908.1| Oryza sativa (japonica cultivar-group), mRNA 178 1e-41
2dbj|AK120237.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 1e-41
3dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 147 4e-32
4dbj|AP004078.3| Oryza sativa (japonica cultivar-group) genomic D... 147 4e-32
5dbj|AP005851.2| Oryza sativa (japonica cultivar-group) genomic D... 147 4e-32
6gb|AY736121.1| Triticum aestivum ubiquitin-conjugating enzyme mR... 109 8e-21
7gb|AY104017.1| Zea mays PCO119482 mRNA sequence 100 8e-18
8gb|AY109411.1| Zea mays CL25406_3 mRNA sequence 96 1e-16
9gb|BT016331.1| Zea mays clone Contig164 mRNA sequence 94 5e-16
10gb|AF034946.1|AF034946 Zea mays ubiquitin conjugating enzyme (UB... 94 5e-16
11ref|XM_954840.1| Neurospora crassa OR74A hypothetical protein ( ... 80 7e-12
12ref|XM_331064.1| Neurospora crassa OR74A hypothetical protein ( ... 80 7e-12
13ref|XM_474269.1| Oryza sativa (japonica cultivar-group), predic... 78 3e-11
14gb|AY086109.1| Arabidopsis thaliana clone 21455 mRNA, complete s... 78 3e-11
15dbj|AK119682.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
16ref|NM_124997.2| Arabidopsis thaliana ubiquitin conjugating enzy... 74 4e-10
17ref|NM_180867.1| Arabidopsis thaliana ubiquitin conjugating enzy... 74 4e-10
18gb|CP000081.1| Leishmania major chromosome 35, complete sequence 74 4e-10
19ref|XM_838144.1| Leishmania major strain Friedlin ubiquitin-conj... 74 4e-10
20emb|AL445678.2|LMFL7845 Leishmania major Friedlin chromosome 35 ... 74 4e-10
21gb|AY081511.1| Arabidopsis thaliana ubiquitin-conjugating enzyme... 74 4e-10
22gb|AY059806.1| Arabidopsis thaliana ubiquitin-conjugating enzyme... 74 4e-10
23gb|AY084220.1| Arabidopsis thaliana clone 10022 mRNA, complete s... 74 4e-10
24gb|DQ027043.1| Arabidopsis thaliana ubiquitinating enzyme (At5g5... 74 4e-10
25dbj|D17786.1|RICKN6922 Oryza sativa KN69 mRNA for ubiquitin-conj... 70 7e-09
26gb|AY082005.1| Gossypium hirsutum ubiquitin-conjugating enzyme E... 68 3e-08
27gb|AY082004.1| Gossypium hirsutum ubiquitin-conjugating enzyme E... 68 3e-08
28ref|NM_111704.1| Arabidopsis thaliana ubiquitin conjugating enzy... 66 1e-07
29gb|BT009605.1| Triticum aestivum clone wre1n.pk0086.d1:fis, full... 66 1e-07
30gb|BT024821.1| Arabidopsis thaliana At3g08700 gene, complete cds 66 1e-07
31dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
32emb|BX833149.1|CNS09Z3U Arabidopsis thaliana Full-length cDNA Co... 66 1e-07
33dbj|AP003618.3| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
34dbj|AP004743.2| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
35dbj|AK066232.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
36gb|DQ027026.1| Arabidopsis thaliana ubiquitinating enzyme (At3g0... 66 1e-07
37ref|NM_111703.2| Arabidopsis thaliana ubiquitin conjugating enzy... 64 4e-07
38gb|AY220735.1| Hordeum vulgare ubiquitin-conjugating enzyme (UBC... 64 4e-07
39emb|Z14992.1|ATUBC11 A.thaliana UBC11 mRNA for ubiquitin conjuga... 64 4e-07
40gb|AY091223.1| Arabidopsis thaliana putative ubiquitin conjugati... 64 4e-07
41gb|AY063869.1| Arabidopsis thaliana putative E2, ubiquitin-conju... 64 4e-07
42emb|AL606619.3|OSJN00032 Oryza sativa genomic DNA, chromosome 4,... 64 4e-07
43dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
44dbj|AK104783.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 4e-07
45dbj|AK060954.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 4e-07
46emb|AL732340.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 64 4e-07
47gb|DQ027025.1| Arabidopsis thaliana ubiquitinating enzyme (At3g0... 64 4e-07
48gb|L00641.1|ATHUBCD Arabidopsis thaliana ubiquitin conjugating e... 64 4e-07
49ref|NM_191104.1| Oryza sativa (japonica cultivar-group), predic... 62 2e-06
50gb|AY389716.1| Hyacinthus orientalis ubiquitin-conjugating enzym... 62 2e-06
51gb|AC012562.5|AC012562 Arabidopsis thaliana chromosome 3 BAC F17... 62 2e-06
52gb|U17250.1|BCSC1 Brassica oleracea ubiquitine conjugating enzym... 62 2e-06
53gb|AF424641.1| Phytophthora infestans clone MY-03-C-08 ubiquitin... 60 7e-06
54ref|NM_191107.1| Oryza sativa (japonica cultivar-group), predic... 58 3e-05
55dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
56dbj|AP003446.3| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
57dbj|AK058360.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
58gb|U15971.1|OSU15971 Oryza sativa ubiquitin conjugating enzyme (... 58 3e-05
59gb|AY083611.1| Oryza sativa elicitor and UV light related transc... 56 1e-04
60gb|AF030296.1|AF030296 Glomerella cingulata ubiquitin conjugatin... 56 1e-04
61ref|NM_180784.1| Arabidopsis thaliana UBC8 (UBIQUITIN CONJUGATIN... 54 4e-04
62ref|NM_123535.2| Arabidopsis thaliana UBC8 (UBIQUITIN CONJUGATIN... 54 4e-04
63ref|NM_180783.1| Arabidopsis thaliana UBC8 (UBIQUITIN CONJUGATIN... 54 4e-04
64gb|DQ222513.1| Solanum tuberosum clone 117E03 ubiquitin conjugat... 54 4e-04
65ref|XM_749910.1| Aspergillus fumigatus Af293 ubiquitin conjugati... 54 4e-04
66emb|X73419.1|LEUBC L.esculentum mRNA for ubiquitin conjugating e... 54 4e-04
67gb|AY063074.1| Arabidopsis thaliana putative ubiquitin-conjugati... 54 4e-04
68gb|AF370257.1| Arabidopsis thaliana putative E2, ubiquitin-conju... 54 4e-04
69gb|AY072514.1| Arabidopsis thaliana ubiquitin-conjugating enzyme... 54 4e-04
70gb|AY057631.1| Arabidopsis thaliana AT5g41700/MBK23_24 mRNA, com... 54 4e-04
71gb|AY054595.1| Arabidopsis thaliana ubiquitin-conjugating enzyme... 54 4e-04
72gb|AF325009.2|AF325009 Arabidopsis thaliana AT5g41700 (AT5g41700... 54 4e-04
73emb|BX832305.1|CNS0A1WR Arabidopsis thaliana Full-length cDNA Co... 54 4e-04
74gb|AY085670.1| Arabidopsis thaliana clone 16865 mRNA, complete s... 54 4e-04
75dbj|AK117378.1| Arabidopsis thaliana At5g41080 mRNA for unknown ... 54 4e-04
76gb|AY105836.1| Zea mays PCO130472 mRNA sequence 54 4e-04
77gb|DQ027022.1| Arabidopsis thaliana ubiquitinating enzyme (At5g4... 54 4e-04
78ref|XM_310998.2| Anopheles gambiae str. PEST ENSANGP00000019908 ... 52 0.002
79gb|BT013767.1| Lycopersicon esculentum clone 132651R, mRNA sequence 50 0.006
80gb|AF154650.1| Nicotiana tabacum clone PR35 mRNA sequence 50 0.006
81dbj|AB011476.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 50 0.006
82gb|DQ284472.1| Solanum tuberosum clone 116D11 ubiquitin-conjugat... 50 0.006
83gb|L23762.1|TOM1KUC Lycopersicon esculentum ubiquitin carrier pr... 50 0.006
84gb|AY491500.1| Capsicum annuum ubiquitin-conjugating enzyme E2 m... 48 0.025
85emb|CR646344.2|CNS0EXOU Tetraodon nigroviridis full-length cDNA 48 0.025
86emb|BX629356.1|CNS09SBW Tetraodon nigroviridis BAC sequence 48 0.025
87dbj|AP004929.1| Lotus japonicus genomic DNA, chromosome 3, clone... 48 0.025
88ref|XM_655273.1| Aspergillus nidulans FGSC A4 ubiquitin-conjugat... 46 0.10
89gb|AC182754.1| Gasterosteus aculeatus clone VMRC28-42C14, comple... 46 0.10
90ref|XM_471009.1| Oryza sativa (japonica cultivar-group), predic... 44 0.40
91gb|AY489135.1| Capsicum annuum ubiquitin-conjugating enzyme 8 mR... 44 0.40
92emb|CR733525.2|CNS0GSRO Tetraodon nigroviridis full-length cDNA 44 0.40
93emb|CR732722.2|CNS0GSBA Tetraodon nigroviridis full-length cDNA 44 0.40
94emb|CR731170.1|CNS0GR47 Tetraodon nigroviridis full-length cDNA 44 0.40
95emb|CR728345.2|CNS0GOXR Tetraodon nigroviridis full-length cDNA 44 0.40
96emb|CR724467.2|CNS0GLY1 Tetraodon nigroviridis full-length cDNA 44 0.40
97emb|CR708686.2|CNS0G9RU Tetraodon nigroviridis full-length cDNA 44 0.40
98emb|CR673935.2|CNS0FIZ9 Tetraodon nigroviridis full-length cDNA 44 0.40
99emb|CR661341.2|CNS0F99F Tetraodon nigroviridis full-length cDNA 44 0.40
100emb|CR648302.2|CNS0EZ78 Tetraodon nigroviridis full-length cDNA 44 0.40
101emb|CR647212.2|CNS0EYCY Tetraodon nigroviridis full-length cDNA 44 0.40
102emb|Z14991.1|ATUBC10 A.thaliana UBC10 mRNA for ubiquitin conjuga... 44 0.40
103gb|AY113937.1| Arabidopsis thaliana putative E2, ubiquitin-conju... 44 0.40
104emb|AL606642.3|OSJN00073 Oryza sativa genomic DNA, chromosome 4,... 44 0.40
105gb|AY129488.1| Arabidopsis thaliana AT5g53300/K19E1_10 mRNA, com... 44 0.40
106gb|AY083170.1| Malus x domestica ubiquitin conjugating-like enzy... 44 0.40
107emb|BX833981.1|CNS0A0DI Arabidopsis thaliana Full-length cDNA Co... 44 0.40
108dbj|AK103144.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.40
109dbj|AK073722.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.40
110emb|AL442118.2| Oryza sativa genomic DNA, chromosome 4, BAC clon... 44 0.40
111gb|DQ027024.1| Arabidopsis thaliana ubiquitinating enzyme (At5g5... 44 0.40
112gb|DQ249816.1| Capsicum annuum ubiquitin-conjugating enzyme E2 m... 44 0.40
113gb|L00640.1|ATHUBCC Arabidopsis thaliana ubiquitin conjugating e... 44 0.40
114ref|NM_180785.1| Arabidopsis thaliana UBC8 (UBIQUITIN CONJUGATIN... 42 1.6
115ref|NM_200959.2| Danio rerio zgc:55886 (zgc:55886), mRNA 42 1.6
116emb|CR650501.2|CNS0F0WB Tetraodon nigroviridis full-length cDNA 42 1.6
117emb|Z14989.1|ATUBC8 A.thaliana UBC8 gene for ubiquitin conjugati... 42 1.6
118gb|AY952317.1| Triticum aestivum cultivar 7269-10 immature spike... 42 1.6
119gb|BC065678.1| Danio rerio zgc:55886, mRNA (cDNA clone MGC:77149... 42 1.6
120gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 42 1.6
121dbj|AB005233.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 42 1.6
122ref|NM_210385.1| Eremothecium gossypii AER173Cp (AER173C), mRNA 42 1.6
123gb|L00638.1|ATHUBCA Arabidopsis thaliana ubiquitin conjugating e... 42 1.6
124ref|NM_001036151.1| Arabidopsis thaliana ubiquitin conjugating e... 40 6.2
125ref|NM_105097.3| Arabidopsis thaliana ubiquitin conjugating enzy... 40 6.2
126gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence 40 6.2
127gb|AY682844.1| Human coxsackievirus B5 isolate B 92746 polyprote... 40 6.2
128gb|AC159432.1| Trypanosoma brucei chromosome 5 clone RPCI93-28F8... 40 6.2
129gb|BC076483.1| Danio rerio zgc:92467, mRNA (cDNA clone MGC:92467... 40 6.2
130ref|XM_819286.1| Trypanosoma brucei TREU927 clone RPCI93-28F8 ub... 40 6.2
131emb|CR652711.2|CNS0F2LP Tetraodon nigroviridis full-length cDNA 40 6.2
132emb|AL445230.11| Human DNA sequence from clone RP11-517F10 on ch... 40 6.2
133emb|AL035669.43|HS885L7 Human DNA sequence from clone RP5-885L7 ... 40 6.2
134emb|CR555306.1| Azoarcus sp. EbN1 complete genome 40 6.2
135ref|NM_001003494.1| Danio rerio zgc:92467 (zgc:92467), mRNA 40 6.2
136gb|AY133670.1| Arabidopsis thaliana At1g64230/F22C12_17 mRNA, co... 40 6.2
137gb|AC100835.2| Homo sapiens chromosome 15, clone CTD-3154N5, com... 40 6.2
138gb|AC068727.8| Homo sapiens chromosome 15 clone RP11-90M11 map 1... 40 6.2
139gb|AF480945.1| Arabidopsis thaliana ubiquitin conjugating enzyme... 40 6.2
140gb|AF385718.1|AF385718 Arabidopsis thaliana At1g64230/F22C12_17 ... 40 6.2
141emb|BX815683.1|CNS0ABHQ Arabidopsis thaliana Full-length cDNA Co... 40 6.2
142emb|BX815644.1|CNS0ABEX Arabidopsis thaliana Full-length cDNA Co... 40 6.2
143emb|BX816916.1|CNS0ABT7 Arabidopsis thaliana Full-length cDNA Co... 40 6.2
144emb|BX816699.1|CNS0ABXP Arabidopsis thaliana Full-length cDNA Co... 40 6.2
145gb|AC154434.2| Mus musculus BAC clone RP24-185H5 from chromosome... 40 6.2
146emb|BX681417.10| Zebrafish DNA sequence from clone DKEY-161L11 i... 40 6.2
147gb|AF026802.1|HSCOL9A3S2 Homo sapiens alpha-3 type IX collagen (... 40 6.2
148gb|DQ027041.1| Arabidopsis thaliana ubiquitinating enzyme (At1g6... 40 6.2
149dbj|AB242223.1| Eptatretus burgeri IgSF3 mRNA for immunoglobulin... 40 6.2

>ref|XM_463908.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 815

 Score =  178 bits (90), Expect = 1e-41
 Identities = 150/170 (88%)
 Strand = Plus / Minus

                                                                       
Query: 292 cccatggcgtacttgtgcgtccagcccctggccgtggactcgtacctggtccggtcggcc 351
           |||||||||||||| ||||||||||| || || ||||| ||||| |||   || || | |
Sbjct: 530 cccatggcgtacttctgcgtccagcctcttgcggtggattcgtatctgaggcgatcagtc 471

                                                                       
Query: 352 ttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagc 411
           |||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 470 ttgcacatatgagcgatctccggcaccagcggatcgtccgggttcgggtccgtcagcagc 411

                                                             
Query: 412 gagcatatcgacagcagaaccttggatatggtgagggcggggctccactg 461
           ||||| |||||||| ||||||||||| |||||||| || |||||||||||
Sbjct: 410 gagcagatcgacagaagaaccttggagatggtgagagctgggctccactg 361



to top

>dbj|AK120237.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013043N18, full
           insert sequence
          Length = 815

 Score =  178 bits (90), Expect = 1e-41
 Identities = 150/170 (88%)
 Strand = Plus / Minus

                                                                       
Query: 292 cccatggcgtacttgtgcgtccagcccctggccgtggactcgtacctggtccggtcggcc 351
           |||||||||||||| ||||||||||| || || ||||| ||||| |||   || || | |
Sbjct: 530 cccatggcgtacttctgcgtccagcctcttgcggtggattcgtatctgaggcgatcagtc 471

                                                                       
Query: 352 ttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagc 411
           |||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 470 ttgcacatatgagcgatctccggcaccagcggatcgtccgggttcgggtccgtcagcagc 411

                                                             
Query: 412 gagcatatcgacagcagaaccttggatatggtgagggcggggctccactg 461
           ||||| |||||||| ||||||||||| |||||||| || |||||||||||
Sbjct: 410 gagcagatcgacagaagaaccttggagatggtgagagctgggctccactg 361



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score =  147 bits (74), Expect = 4e-32
 Identities = 125/142 (88%)
 Strand = Plus / Minus

                                                                           
Query: 292     cccatggcgtacttgtgcgtccagcccctggccgtggactcgtacctggtccggtcggcc 351
               |||||||||||||| ||||||||||| || || ||||| ||||| |||   || || | |
Sbjct: 1079367 cccatggcgtacttctgcgtccagcctcttgcggtggattcgtatctgaggcgatcagtc 1079308

                                                                           
Query: 352     ttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagc 411
               |||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 1079307 ttgcacatatgagcgatctccggcaccagcggatcgtccgggttcgggtccgtcagcagc 1079248

                                     
Query: 412     gagcatatcgacagcagaacct 433
               ||||| |||||||| |||||||
Sbjct: 1079247 gagcagatcgacagaagaacct 1079226



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 430     accttggatatggtgagggcggggctccactg 461
               |||||||| |||||||| || |||||||||||
Sbjct: 1079122 accttggagatggtgagagctgggctccactg 1079091



to top

>dbj|AP004078.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1020_C02
          Length = 124578

 Score =  147 bits (74), Expect = 4e-32
 Identities = 125/142 (88%)
 Strand = Plus / Minus

                                                                         
Query: 292   cccatggcgtacttgtgcgtccagcccctggccgtggactcgtacctggtccggtcggcc 351
             |||||||||||||| ||||||||||| || || ||||| ||||| |||   || || | |
Sbjct: 31891 cccatggcgtacttctgcgtccagcctcttgcggtggattcgtatctgaggcgatcagtc 31832

                                                                         
Query: 352   ttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagc 411
             |||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 31831 ttgcacatatgagcgatctccggcaccagcggatcgtccgggttcgggtccgtcagcagc 31772

                                   
Query: 412   gagcatatcgacagcagaacct 433
             ||||| |||||||| |||||||
Sbjct: 31771 gagcagatcgacagaagaacct 31750



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 430   accttggatatggtgagggcggggctccactg 461
             |||||||| |||||||| || |||||||||||
Sbjct: 31646 accttggagatggtgagagctgggctccactg 31615



to top

>dbj|AP005851.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBb0088N06
          Length = 123454

 Score =  147 bits (74), Expect = 4e-32
 Identities = 125/142 (88%)
 Strand = Plus / Minus

                                                                         
Query: 292   cccatggcgtacttgtgcgtccagcccctggccgtggactcgtacctggtccggtcggcc 351
             |||||||||||||| ||||||||||| || || ||||| ||||| |||   || || | |
Sbjct: 68075 cccatggcgtacttctgcgtccagcctcttgcggtggattcgtatctgaggcgatcagtc 68016

                                                                         
Query: 352   ttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagc 411
             |||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 68015 ttgcacatatgagcgatctccggcaccagcggatcgtccgggttcgggtccgtcagcagc 67956

                                   
Query: 412   gagcatatcgacagcagaacct 433
             ||||| |||||||| |||||||
Sbjct: 67955 gagcagatcgacagaagaacct 67934



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 430   accttggatatggtgagggcggggctccactg 461
             |||||||| |||||||| || |||||||||||
Sbjct: 67830 accttggagatggtgagagctgggctccactg 67799



to top

>gb|AY736121.1| Triticum aestivum ubiquitin-conjugating enzyme mRNA, complete cds
          Length = 460

 Score =  109 bits (55), Expect = 8e-21
 Identities = 145/175 (82%)
 Strand = Plus / Minus

                                                                       
Query: 287 tctaccccatggcgtacttgtgcgtccagcccctggccgtggactcgtacctggtccggt 346
           |||| |||||||||||||| || ||||||   |  ||||||||||||||| ||| ||| |
Sbjct: 458 tctagcccatggcgtacttctgtgtccaggagcgcgccgtggactcgtacttggcccgat 399

                                                                       
Query: 347 cggccttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtca 406
           | | |||| ||||||| |||||||| |||||||| || || || ||||||||||||||||
Sbjct: 398 cagtcttgtacatgtgagcgatctcgggcaccagaggatcatcggggttcgggtccgtca 339

                                                                  
Query: 407 gcagcgagcatatcgacagcagaaccttggatatggtgagggcggggctccactg 461
           ||| ||| || || |||||||| ||||| |||||||| |  || |||||||||||
Sbjct: 338 gcaacgaacagattgacagcaggacctttgatatggtcaaagccgggctccactg 284



to top

>gb|AY104017.1| Zea mays PCO119482 mRNA sequence
          Length = 885

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 140/170 (82%)
 Strand = Plus / Minus

                                                                       
Query: 292 cccatggcgtacttgtgcgtccagcccctggccgtggactcgtacctggtccggtcggcc 351
           ||||| |||||||| ||||||||||  | |||||| ||||||||| | | |||||| | |
Sbjct: 580 cccatcgcgtacttctgcgtccagctgcgggccgtcgactcgtacttcggccggtccgtc 521

                                                                       
Query: 352 ttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagc 411
           ||| ||||||| || |||||||| || || |||||||||||||| ||||| |||||||| 
Sbjct: 520 ttgtacatgtgggcaatctccgggacaagagggtcgtccgggttggggtcggtcagcagg 461

                                                             
Query: 412 gagcatatcgacagcagaaccttggatatggtgagggcggggctccactg 461
           ||||| || || ||||| ||||| || || || || || |||||||||||
Sbjct: 460 gagcagatggagagcaggaccttagaaattgtcagagcagggctccactg 411



to top

>gb|AY109411.1| Zea mays CL25406_3 mRNA sequence
          Length = 1037

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 111/132 (84%)
 Strand = Plus / Plus

                                                                       
Query: 330 ctcgtacctggtccggtcggccttgcacatgtgcgcgatctccggcaccagcgggtcgtc 389
           ||||||| || ||||||| | |||| |||||||||| ||||| || ||||| || |||||
Sbjct: 128 ctcgtacttgttccggtccgtcttgtacatgtgcgctatctcggggaccagaggatcgtc 187

                                                                       
Query: 390 cgggttcgggtccgtcagcagcgagcatatcgacagcagaaccttggatatggtgagggc 449
            |||||||| || |||||||| ||||| || |||||||| |||||||| ||||| || ||
Sbjct: 188 ggggttcggatcggtcagcagggagcagatggacagcagcaccttggagatggttagcgc 247

                       
Query: 450 ggggctccactg 461
            |||||||||||
Sbjct: 248 cgggctccactg 259



to top

>gb|BT016331.1| Zea mays clone Contig164 mRNA sequence
          Length = 860

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 119/143 (83%)
 Strand = Plus / Minus

                                                                       
Query: 292 cccatggcgtacttgtgcgtccagcccctggccgtggactcgtacctggtccggtcggcc 351
           ||||| |||||||| ||||||||||  | |||||| ||||||||| | | |||||| | |
Sbjct: 543 cccatcgcgtacttctgcgtccagctgcgggccgtcgactcgtacttcggccggtccgtc 484

                                                                       
Query: 352 ttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagc 411
           ||| ||||||| || |||||||| || || |||||||||||||| ||||| |||||||| 
Sbjct: 483 ttgtacatgtgggcaatctccgggacaagagggtcgtccgggttggggtcggtcagcagg 424

                                  
Query: 412 gagcatatcgacagcagaacctt 434
           ||||| || || ||||| |||||
Sbjct: 423 gagcagatggagagcaggacctt 401



to top

>gb|AF034946.1|AF034946 Zea mays ubiquitin conjugating enzyme (UBC) mRNA, complete cds
          Length = 781

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 119/143 (83%)
 Strand = Plus / Minus

                                                                       
Query: 292 cccatggcgtacttgtgcgtccagcccctggccgtggactcgtacctggtccggtcggcc 351
           ||||| |||||||| ||||||||||  | |||||| ||||||||| | | |||||| | |
Sbjct: 483 cccatcgcgtacttctgcgtccagctgcgggccgtcgactcgtacttcggccggtccgtc 424

                                                                       
Query: 352 ttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagc 411
           ||| ||||||| || |||||||| || || |||||||||||||| ||||| |||||||| 
Sbjct: 423 ttgtacatgtgggcaatctccgggacaagagggtcgtccgggttggggtcggtcagcagg 364

                                  
Query: 412 gagcatatcgacagcagaacctt 434
           ||||| || || ||||| |||||
Sbjct: 363 gagcagatggagagcaggacctt 341



to top

>ref|XM_954840.1| Neurospora crassa OR74A hypothetical protein ( (XM_016084)
           hypothetical protein XP_016084 [Homo sapiens] )
           (NCU02289.1) partial mRNA
          Length = 444

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 91/108 (84%)
 Strand = Plus / Minus

                                                                       
Query: 330 ctcgtacctggtccggtcggccttgcacatgtgcgcgatctccggcaccagcgggtcgtc 389
           |||||||||||  ||||| | |||| ||| |||||| ||||| ||||| |||||||||||
Sbjct: 405 ctcgtacctggcgcggtctgtcttgtacacgtgcgcaatctcgggcacaagcgggtcgtc 346

                                                           
Query: 390 cgggttcgggtccgtcagcagcgagcatatcgacagcagaaccttgga 437
            ||||| || ||||||| || |||||| || || ||||||||||||||
Sbjct: 345 agggttgggatccgtcaacatcgagcagatggagagcagaaccttgga 298



to top

>ref|XM_331064.1| Neurospora crassa OR74A hypothetical protein ( (XM_016084)
           hypothetical protein XP_016084 [Homo sapiens] )
           (NCU02289.1) partial mRNA
          Length = 444

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 91/108 (84%)
 Strand = Plus / Minus

                                                                       
Query: 330 ctcgtacctggtccggtcggccttgcacatgtgcgcgatctccggcaccagcgggtcgtc 389
           |||||||||||  ||||| | |||| ||| |||||| ||||| ||||| |||||||||||
Sbjct: 405 ctcgtacctggcgcggtctgtcttgtacacgtgcgcaatctcgggcacaagcgggtcgtc 346

                                                           
Query: 390 cgggttcgggtccgtcagcagcgagcatatcgacagcagaaccttgga 437
            ||||| || ||||||| || |||||| || || ||||||||||||||
Sbjct: 345 agggttgggatccgtcaacatcgagcagatggagagcagaaccttgga 298



to top

>ref|XM_474269.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 447

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 93/111 (83%)
 Strand = Plus / Minus

                                                                       
Query: 351 cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
           |||| ||||||| || ||||||||||||| ||| || || ||||||||||||||||||||
Sbjct: 384 cttgtacatgtgagcaatctccggcaccaacggatcatcggggttcgggtccgtcagcag 325

                                                              
Query: 411 cgagcatatcgacagcagaaccttggatatggtgagggcggggctccactg 461
            || || || ||||| || ||||| |||||||| || || || ||||||||
Sbjct: 324 tgaacaaattgacaggaggacctttgatatggtaagtgcaggactccactg 274



to top

>gb|AY086109.1| Arabidopsis thaliana clone 21455 mRNA, complete sequence
          Length = 709

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 135/167 (80%)
 Strand = Plus / Minus

                                                                       
Query: 292 cccatggcgtacttgtgcgtccagcccctggccgtggactcgtacctggtccggtcggcc 351
           ||||| |||||||| || |||||||  || || || ||||||||| ||| ||  || | |
Sbjct: 546 cccattgcgtacttttgtgtccagcttctcgcagttgactcgtacttggacctatctgtc 487

                                                                       
Query: 352 ttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagc 411
           ||| ||||||| || ||||||||||| || || || || ||||| ||||| |||| ||||
Sbjct: 486 ttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtcaacagc 427

                                                          
Query: 412 gagcatatcgacagcagaaccttggatatggtgagggcggggctcca 458
           ||||| ||||||| |||||||||||| || || || || ||||||||
Sbjct: 426 gagcaaatcgacaacagaaccttggagatagtaagagcagggctcca 380



to top

>dbj|AK119682.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-A01, full
           insert sequence
          Length = 832

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 93/111 (83%)
 Strand = Plus / Minus

                                                                       
Query: 351 cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
           |||| ||||||| || ||||||||||||| ||| || || ||||||||||||||||||||
Sbjct: 539 cttgtacatgtgagcaatctccggcaccaacggatcatcggggttcgggtccgtcagcag 480

                                                              
Query: 411 cgagcatatcgacagcagaaccttggatatggtgagggcggggctccactg 461
            || || || ||||| || ||||| |||||||| || || || ||||||||
Sbjct: 479 tgaacaaattgacaggaggacctttgatatggtaagtgcaggactccactg 429



to top

>ref|NM_124997.2| Arabidopsis thaliana ubiquitin conjugating enzyme/ ubiquitin-like
           activating enzyme AT5G56150 transcript variant
           AT5G56150.2 mRNA, complete cds
          Length = 744

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                       
Query: 385 tcgtccgggttcgggtccgtcagcagcgagcatatcgacagcagaaccttggatatggtg 444
           ||||| ||||| || ||||||||||  |||||||||||||| ||||||||||||| ||| 
Sbjct: 428 tcgtcagggtttggatccgtcagcaatgagcatatcgacagaagaaccttggatacggta 369

                            
Query: 445 agggcggggctccactg 461
           || || |||||||||||
Sbjct: 368 agtgcagggctccactg 352



to top

>ref|NM_180867.1| Arabidopsis thaliana ubiquitin conjugating enzyme/ ubiquitin-like
           activating enzyme AT5G56150 transcript variant
           AT5G56150.1 mRNA, complete cds
          Length = 751

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                       
Query: 385 tcgtccgggttcgggtccgtcagcagcgagcatatcgacagcagaaccttggatatggtg 444
           ||||| ||||| || ||||||||||  |||||||||||||| ||||||||||||| ||| 
Sbjct: 435 tcgtcagggtttggatccgtcagcaatgagcatatcgacagaagaaccttggatacggta 376

                            
Query: 445 agggcggggctccactg 461
           || || |||||||||||
Sbjct: 375 agtgcagggctccactg 359



to top

>gb|CP000081.1| Leishmania major chromosome 35, complete sequence
          Length = 2090491

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                          
Query: 362    gcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagcgagcatatcg 421
              ||||||| |||||||||||||||||||| ||||| |||||||||| ||| ||||| |  |
Sbjct: 573323 gcgcgatatccggcaccagcgggtcgtcagggttggggtccgtcaacagagagcacacgg 573264

                           
Query: 422    acagcagaacctt 434
              |||||| ||||||
Sbjct: 573263 acagcaaaacctt 573251



to top

>ref|XM_838144.1| Leishmania major strain Friedlin ubiquitin-conjugating enzyme E2
           (LMJ_1061) partial mRNA
          Length = 447

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                       
Query: 362 gcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagcgagcatatcg 421
           ||||||| |||||||||||||||||||| ||||| |||||||||| ||| ||||| |  |
Sbjct: 376 gcgcgatatccggcaccagcgggtcgtcagggttggggtccgtcaacagagagcacacgg 317

                        
Query: 422 acagcagaacctt 434
           |||||| ||||||
Sbjct: 316 acagcaaaacctt 304



to top

>emb|AL445678.2|LMFL7845 Leishmania major Friedlin chromosome 35 cosmid L7845
          Length = 29811

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                         
Query: 362   gcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagcgagcatatcg 421
             ||||||| |||||||||||||||||||| ||||| |||||||||| ||| ||||| |  |
Sbjct: 17914 gcgcgatatccggcaccagcgggtcgtcagggttggggtccgtcaacagagagcacacgg 17973

                          
Query: 422   acagcagaacctt 434
             |||||| ||||||
Sbjct: 17974 acagcaaaacctt 17986



to top

>gb|AY081511.1| Arabidopsis thaliana ubiquitin-conjugating enzyme-like protein
           (MDA7.21) mRNA, complete cds
          Length = 479

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                       
Query: 385 tcgtccgggttcgggtccgtcagcagcgagcatatcgacagcagaaccttggatatggtg 444
           ||||| ||||| || ||||||||||  |||||||||||||| ||||||||||||| ||| 
Sbjct: 350 tcgtcagggtttggatccgtcagcaatgagcatatcgacagaagaaccttggatacggta 291

                            
Query: 445 agggcggggctccactg 461
           || || |||||||||||
Sbjct: 290 agtgcagggctccactg 274



to top

>gb|AY059806.1| Arabidopsis thaliana ubiquitin-conjugating enzyme-like protein
           (MDA7.21) mRNA, complete cds
          Length = 717

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                       
Query: 385 tcgtccgggttcgggtccgtcagcagcgagcatatcgacagcagaaccttggatatggtg 444
           ||||| ||||| || ||||||||||  |||||||||||||| ||||||||||||| ||| 
Sbjct: 429 tcgtcagggtttggatccgtcagcaatgagcatatcgacagaagaaccttggatacggta 370

                            
Query: 445 agggcggggctccactg 461
           || || |||||||||||
Sbjct: 369 agtgcagggctccactg 353



to top

>gb|AY084220.1| Arabidopsis thaliana clone 10022 mRNA, complete sequence
          Length = 750

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                       
Query: 385 tcgtccgggttcgggtccgtcagcagcgagcatatcgacagcagaaccttggatatggtg 444
           ||||| ||||| || ||||||||||  |||||||||||||| ||||||||||||| ||| 
Sbjct: 435 tcgtcagggtttggatccgtcagcaatgagcatatcgacagaagaaccttggatacggta 376

                            
Query: 445 agggcggggctccactg 461
           || || |||||||||||
Sbjct: 375 agtgcagggctccactg 359



to top

>gb|DQ027043.1| Arabidopsis thaliana ubiquitinating enzyme (At5g56150) mRNA,
           complete cds
          Length = 447

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                       
Query: 385 tcgtccgggttcgggtccgtcagcagcgagcatatcgacagcagaaccttggatatggtg 444
           ||||| ||||| || ||||||||||  |||||||||||||| ||||||||||||| ||| 
Sbjct: 350 tcgtcagggtttggatccgtcagcaatgagcatatcgacagaagaaccttggatacggta 291

                            
Query: 445 agggcggggctccactg 461
           || || |||||||||||
Sbjct: 290 agtgcagggctccactg 274



to top

>dbj|D17786.1|RICKN6922 Oryza sativa KN69 mRNA for ubiquitin-conjugating enzyme, partial
           CDS
          Length = 311

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 92/111 (82%)
 Strand = Plus / Minus

                                                                       
Query: 351 cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
           |||| ||||||| || ||||||||||||| ||| || ||   ||||||||||||||||||
Sbjct: 279 cttgtacatgtgagcaatctccggcaccaacggatcatcgccgttcgggtccgtcagcag 220

                                                              
Query: 411 cgagcatatcgacagcagaaccttggatatggtgagggcggggctccactg 461
            || || || |||||||| ||||| |||||||| || || || ||||||||
Sbjct: 219 tgaacaaattgacagcaggacctttgatatggtaagtgcaggactccactg 169



to top

>gb|AY082005.1| Gossypium hirsutum ubiquitin-conjugating enzyme E2 (UBC2) mRNA,
           complete cds
          Length = 850

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 88/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 356 acatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagcgagc 415
           |||||||||| |||||| | || || ||||| || ||||| || || |||| || |||||
Sbjct: 547 acatgtgcgcaatctccagaacaagtgggtcatcagggtttggatcagtcaacaacgagc 488

                                                         
Query: 416 atatcgacagcagaaccttggatatggtgagggcggggctccactg 461
           | ||||| |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 487 agatcgagagcagaaccttggaaatggttagggctggactccactg 442



to top

>gb|AY082004.1| Gossypium hirsutum ubiquitin-conjugating enzyme E2 (UBC1) mRNA,
           complete cds
          Length = 773

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 88/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 356 acatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagcgagc 415
           ||||||| || |||||||| || || ||||| || ||||| || || |||| || |||||
Sbjct: 568 acatgtgtgcaatctccggaacaagtgggtcatcagggtttggatcagtcaacaacgagc 509

                                                         
Query: 416 atatcgacagcagaaccttggatatggtgagggcggggctccactg 461
           | ||||| |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 508 agatcgagagcagaaccttggaaatggttagggctggactccactg 463



to top

>ref|NM_111704.1| Arabidopsis thaliana ubiquitin conjugating enzyme/ ubiquitin-like
           activating enzyme AT3G08700 mRNA, complete cds
          Length = 450

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 391 gggttcgggtccgtcagcagcgagcatatcgacagcagaaccttggatatggt 443
           ||||||||||| |||||||||||||| ||||||| || |||||||||| ||||
Sbjct: 347 gggttcgggtcagtcagcagcgagcaaatcgacaacaaaaccttggatgtggt 295



to top

>gb|BT009605.1| Triticum aestivum clone wre1n.pk0086.d1:fis, full insert mRNA
           sequence
          Length = 832

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 84/101 (83%)
 Strand = Plus / Minus

                                                                       
Query: 361 tgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagcgagcatatc 420
           |||||||||||||| || || |||||||| ||||| ||||| || ||||| ||||  || 
Sbjct: 464 tgcgcgatctccgggacaagggggtcgtcggggttggggtcggtgagcagggagctgatg 405

                                                    
Query: 421 gacagcagaaccttggatatggtgagggcggggctccactg 461
           || || || |||||||||||||| || || |||||||||||
Sbjct: 404 gagagtaggaccttggatatggttagcgccgggctccactg 364



to top

>gb|BT024821.1| Arabidopsis thaliana At3g08700 gene, complete cds
          Length = 450

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 391 gggttcgggtccgtcagcagcgagcatatcgacagcagaaccttggatatggt 443
           ||||||||||| |||||||||||||| ||||||| || |||||||||| ||||
Sbjct: 347 gggttcgggtcagtcagcagcgagcaaatcgacaacaaaaccttggatgtggt 295



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                         
Query: 351      cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcag 407
                |||| |||||||||| |||||||| || ||||||||||| ||||| |||||||||||
Sbjct: 17797637 cttgtacatgtgcgcaatctccggaactagcgggtcgtctgggtttgggtccgtcag 17797693



to top

>emb|BX833149.1|CNS09Z3U Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL36ZD09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 707

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 385 tcgtccgggttcgggtccgtcagcagcgagcatatcgacagcagaaccttggatatggtg 444
           ||||| ||||| || ||||||||||  |||||||| ||||| ||||||||||||| ||| 
Sbjct: 418 tcgtcagggtttggatccgtcagcaatgagcatatggacagaagaaccttggatacggta 359

                            
Query: 445 agggcggggctccactg 461
           || || |||||||||||
Sbjct: 358 agtgcagggctccactg 342



to top

>dbj|AP003618.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
            clone:P0561B08
          Length = 161083

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                     
Query: 351  cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcag 407
            |||| |||||||||| |||||||| || ||||||||||| ||||| |||||||||||
Sbjct: 2826 cttgtacatgtgcgcaatctccggaactagcgggtcgtctgggtttgggtccgtcag 2882



to top

>dbj|AP004743.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBb0026G06
          Length = 123129

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                      
Query: 351   cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcag 407
             |||| |||||||||| |||||||| || ||||||||||| ||||| |||||||||||
Sbjct: 68059 cttgtacatgtgcgcaatctccggaactagcgggtcgtctgggtttgggtccgtcag 68115



to top

>dbj|AK066232.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013057M05, full
            insert sequence
          Length = 2141

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                     
Query: 351  cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcag 407
            |||| |||||||||| |||||||| || ||||||||||| ||||| |||||||||||
Sbjct: 1916 cttgtacatgtgcgcaatctccggaactagcgggtcgtctgggtttgggtccgtcag 1860



to top

>gb|DQ027026.1| Arabidopsis thaliana ubiquitinating enzyme (At3g08700) mRNA,
           complete cds
          Length = 450

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 391 gggttcgggtccgtcagcagcgagcatatcgacagcagaaccttggatatggt 443
           ||||||||||| |||||||||||||| ||||||| || |||||||||| ||||
Sbjct: 347 gggttcgggtcagtcagcagcgagcaaatcgacaacaaaaccttggatgtggt 295



to top

>ref|NM_111703.2| Arabidopsis thaliana ubiquitin conjugating enzyme/ ubiquitin-like
           activating enzyme AT3G08690 mRNA, complete cds
          Length = 724

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                       
Query: 351 cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
           |||| ||||||| || ||||||||||| || || || || ||||| ||||| |||| |||
Sbjct: 487 cttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtcaacag 428

                                   
Query: 411 cgagcatatcgacagcagaacctt 434
           |||||| ||||||| |||||||||
Sbjct: 427 cgagcaaatcgacaacagaacctt 404



to top

>gb|AY220735.1| Hordeum vulgare ubiquitin-conjugating enzyme (UBC) mRNA, complete
           cds
          Length = 758

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                       
Query: 351 cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
           |||| ||||||| || ||||| || || || |||||||||||||| ||||| || |||||
Sbjct: 486 cttgtacatgtgggcaatctcagggacgagagggtcgtccgggttagggtcggtaagcag 427

                                   
Query: 411 cgagcatatcgacagcagaacctt 434
           |||||| || || |||||||||||
Sbjct: 426 cgagcagattgaaagcagaacctt 403



to top

>emb|Z14992.1|ATUBC11 A.thaliana UBC11 mRNA for ubiquitin conjugating enzyme homolog
          Length = 543

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                       
Query: 351 cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
           |||| ||||||| || ||||||||||| || || || || ||||| ||||| |||| |||
Sbjct: 294 cttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtcaacag 235

                                   
Query: 411 cgagcatatcgacagcagaacctt 434
           |||||| ||||||| |||||||||
Sbjct: 234 cgagcaaatcgacaacagaacctt 211



to top

>gb|AY091223.1| Arabidopsis thaliana putative ubiquitin conjugating enzyme 11
           (UBC11) (At3g08690) mRNA, complete cds
          Length = 478

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                       
Query: 351 cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
           |||| ||||||| || ||||||||||| || || || || ||||| ||||| |||| |||
Sbjct: 384 cttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtcaacag 325

                                   
Query: 411 cgagcatatcgacagcagaacctt 434
           |||||| ||||||| |||||||||
Sbjct: 324 cgagcaaatcgacaacagaacctt 301



to top

>gb|AY063869.1| Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme
           UBC11 (At3g08690) mRNA, complete cds
          Length = 733

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                       
Query: 351 cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
           |||| ||||||| || ||||||||||| || || || || ||||| ||||| |||| |||
Sbjct: 480 cttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtcaacag 421

                                   
Query: 411 cgagcatatcgacagcagaacctt 434
           |||||| ||||||| |||||||||
Sbjct: 420 cgagcaaatcgacaacagaacctt 397



to top

>emb|AL606619.3|OSJN00032 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0043A12,
             complete sequence
          Length = 190432

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                         
Query: 351   cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
             |||| ||||||| || ||||||||||||| ||| || || ||||||||||||||||||||
Sbjct: 33650 cttgtacatgtgagcaatctccggcaccaacggatcatcggggttcgggtccgtcagcag 33709



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                            
Query: 351      cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
                |||| ||||||| || ||||||||||||| ||| || || ||||||||||||||||||||
Sbjct: 34122268 cttgtacatgtgagcaatctccggcaccaacggatcatcggggttcgggtccgtcagcag 34122327



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 248    ctttgagctcgatcgagctgca 269
              ||||||||||||||||||||||
Sbjct: 605185 ctttgagctcgatcgagctgca 605206



to top

>dbj|AK104783.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D03, full
           insert sequence
          Length = 1071

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 351 cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
           |||| ||||||| || ||||||||||||| ||| || || ||||||||||||||||||||
Sbjct: 778 cttgtacatgtgagcaatctccggcaccaacggatcatcggggttcgggtccgtcagcag 719



to top

>dbj|AK060954.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-201-G05, full
           insert sequence
          Length = 1071

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 351 cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
           |||| ||||||| || ||||||||||||| ||| || || ||||||||||||||||||||
Sbjct: 778 cttgtacatgtgagcaatctccggcaccaacggatcatcggggttcgggtccgtcagcag 719



to top

>emb|AL732340.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: B0811B10, complete
             sequence
          Length = 99356

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                         
Query: 351   cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
             |||| ||||||| || ||||||||||||| ||| || || ||||||||||||||||||||
Sbjct: 39358 cttgtacatgtgagcaatctccggcaccaacggatcatcggggttcgggtccgtcagcag 39417



to top

>gb|DQ027025.1| Arabidopsis thaliana ubiquitinating enzyme (At3g08690) mRNA,
           complete cds
          Length = 447

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                       
Query: 351 cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
           |||| ||||||| || ||||||||||| || || || || ||||| ||||| |||| |||
Sbjct: 384 cttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtcaacag 325

                                   
Query: 411 cgagcatatcgacagcagaacctt 434
           |||||| ||||||| |||||||||
Sbjct: 324 cgagcaaatcgacaacagaacctt 301



to top

>gb|L00641.1|ATHUBCD Arabidopsis thaliana ubiquitin conjugating enzyme mRNA, 3' end
          Length = 543

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                       
Query: 351 cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
           |||| ||||||| || ||||||||||| || || || || ||||| ||||| |||| |||
Sbjct: 294 cttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtcaacag 235

                                   
Query: 411 cgagcatatcgacagcagaacctt 434
           |||||| ||||||| |||||||||
Sbjct: 234 cgagcaaatcgacaacagaacctt 211



to top

>ref|NM_191104.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 447

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 351 cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
           |||| ||||||| || ||||| || || || |||||||||||||| ||||| || |||||
Sbjct: 384 cttgtacatgtgggcaatctcagggacaagagggtcgtccgggttggggtcagtgagcag 325

                                                              
Query: 411 cgagcatatcgacagcagaaccttggatatggtgagggcggggctccactg 461
           |||||| ||||| ||||  ||||| ||||| || |  || |||||||||||
Sbjct: 324 cgagcagatcgaaagcaagaccttagatattgtcaaagcagggctccactg 274



to top

>gb|AY389716.1| Hyacinthus orientalis ubiquitin-conjugating enzyme 9 mRNA, partial
           cds
          Length = 650

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 351 cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
           |||| ||||||||||||| || || |||| ||| || || ||||| |||||||||| |||
Sbjct: 361 cttgtacatgtgcgcgatttctggaaccaacggatcatctgggtttgggtccgtcaacag 302

                                                              
Query: 411 cgagcatatcgacagcagaaccttggatatggtgagggcggggctccactg 461
            || ||||| || |||| ||||||||| ||||| | ||| || ||||||||
Sbjct: 301 agaacatatagagagcaaaaccttggaaatggttaaggcaggactccactg 251



to top

>gb|AC012562.5|AC012562 Arabidopsis thaliana chromosome 3 BAC F17O14 genomic sequence, complete
             sequence
          Length = 90721

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                         
Query: 351   cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
             |||| ||||||| || ||||||||||| || || || || ||||| ||||| |||| |||
Sbjct: 53349 cttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtcaacag 53290

                                    
Query: 411   cgagcatatcgacagcagaacct 433
             |||||| ||||||| ||||||||
Sbjct: 53289 cgagcaaatcgacaacagaacct 53267



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                        
Query: 391   gggttcgggtccgtcagcagcgagcatatcgacagcagaacct 433
             ||||||||||| |||||||||||||| ||||||| || |||||
Sbjct: 55365 gggttcgggtcagtcagcagcgagcaaatcgacaacaaaacct 55323



to top

>gb|U17250.1|BCSC1 Brassica oleracea ubiquitine conjugating enzyme mRNA, partial cds
          Length = 607

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 403 gtcagcagcgagcatatcgacagcagaaccttggatatggtgagggcggggctccactg 461
           |||||||| ||||||||||| || || |||||||||||||| || || |||||||||||
Sbjct: 275 gtcagcagtgagcatatcgaaagaaggaccttggatatggtaagcgcagggctccactg 217



to top

>gb|AF424641.1| Phytophthora infestans clone MY-03-C-08 ubiquitin-conjugating
           enzyme mRNA, complete cds
          Length = 691

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 361 tgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagcgagcatatc 420
           |||||||| || ||||| |||||||| || ||||| | |||||| ||||| ||||| |||
Sbjct: 418 tgcgcgatttcgggcacgagcgggtcatctgggttggcgtccgtgagcagtgagcagatc 359

                         
Query: 421 gacagcagaacctt 434
           |||||||| |||||
Sbjct: 358 gacagcagcacctt 345



to top

>ref|NM_191107.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 447

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 351 cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
           |||| ||||||| || ||||| || || || |||||||||||||| ||||| || |||||
Sbjct: 384 cttgtacatgtgggcaatctcagggacaagagggtcgtccgggttggggtcagtgagcag 325

                            
Query: 411 cgagcatatcgacagca 427
           |||||| ||||| ||||
Sbjct: 324 cgagcagatcgaaagca 308



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                            
Query: 351      cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
                |||| ||||||| || ||||| || || || |||||||||||||| ||||| || |||||
Sbjct: 34934788 cttgtacatgtgggcaatctcagggacaagagggtcgtccgggttggggtcagtgagcag 34934729

                                 
Query: 411      cgagcatatcgacagca 427
                |||||| ||||| ||||
Sbjct: 34934728 cgagcagatcgaaagca 34934712



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                            
Query: 351      cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
                |||| ||||||| || ||||| || || || |||||||||||||| ||||| || |||||
Sbjct: 34912605 cttgtacatgtgggcaatctcagggacaagagggtcgtccgggttggggtcagtgagcag 34912546

                                 
Query: 411      cgagcatatcgacagca 427
                |||||| ||||| ||||
Sbjct: 34912545 cgagcagatcgaaagca 34912529



to top

>dbj|AP003446.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OJ1529_G03
          Length = 100635

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                         
Query: 351   cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
             |||| ||||||| || ||||| || || || |||||||||||||| ||||| || |||||
Sbjct: 64152 cttgtacatgtgggcaatctcagggacaagagggtcgtccgggttggggtcagtgagcag 64093

                              
Query: 411   cgagcatatcgacagca 427
             |||||| ||||| ||||
Sbjct: 64092 cgagcagatcgaaagca 64076



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                         
Query: 351   cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
             |||| ||||||| || ||||| || || || |||||||||||||| ||||| || |||||
Sbjct: 41969 cttgtacatgtgggcaatctcagggacaagagggtcgtccgggttggggtcagtgagcag 41910

                              
Query: 411   cgagcatatcgacagca 427
             |||||| ||||| ||||
Sbjct: 41909 cgagcagatcgaaagca 41893



to top

>dbj|AK058360.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-F04, full
           insert sequence
          Length = 355

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 351 cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
           |||| ||||||| || ||||| || || || |||||||||||||| ||||| || |||||
Sbjct: 84  cttgtacatgtgggcaatctcagggacaagagggtcgtccgggttggggtcagtgagcag 25

                            
Query: 411 cgagcatatcgacagca 427
           |||||| ||||| ||||
Sbjct: 24  cgagcagatcgaaagca 8



to top

>gb|U15971.1|OSU15971 Oryza sativa ubiquitin conjugating enzyme (UBC) gene, complete cds
          Length = 2088

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 351  cttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcag 407
            |||| |||||||||| |||||||| || ||||||||||| ||||| ||| |||||||
Sbjct: 1911 cttgtacatgtgcgccatctccggaactagcgggtcgtctgggtttgggaccgtcag 1855



to top

>gb|AY083611.1| Oryza sativa elicitor and UV light related transcription factor
           (Elr) mRNA, complete cds
          Length = 576

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 367 atctccggcaccagcgggtcgtccgggttcgggtccgtcagcag 410
           ||||||||||||| ||| || || ||||||||||||||||||||
Sbjct: 491 atctccggcaccaacggatcatcggggttcgggtccgtcagcag 448



to top

>gb|AF030296.1|AF030296 Glomerella cingulata ubiquitin conjugating enzyme UBC1 (UBC1) mRNA,
           complete cds
          Length = 961

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 364 gcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagcgagcatatcgac 423
           |||||||| || || ||||| ||||| ||||| ||||||||||||| |||||| || || 
Sbjct: 576 gcgatctcggggacgagcggttcgtcggggttggggtccgtcagcatcgagcagatggag 517

                               
Query: 424 agcagaaccttggatatggt 443
           ||||| ||||| || |||||
Sbjct: 516 agcaggaccttagagatggt 497



to top

>ref|NM_180784.1| Arabidopsis thaliana UBC8 (UBIQUITIN CONJUGATING ENZYME 8);
           ubiquitin conjugating enzyme AT5G41700 (UBC8) transcript
           variant AT5G41700.2 mRNA, complete cds
          Length = 909

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 408 cagcgagcatatcgacagcagaaccttggatatggtgagggcggggctcca 458
           |||||| |||||||| ||||  |||||||| ||||||||||| ||||||||
Sbjct: 503 cagcgaacatatcgagagcaacaccttggaaatggtgagggcagggctcca 453



to top

>ref|NM_123535.2| Arabidopsis thaliana UBC8 (UBIQUITIN CONJUGATING ENZYME 8);
           ubiquitin conjugating enzyme AT5G41700 (UBC8) transcript
           variant AT5G41700.4 mRNA, complete cds
          Length = 803

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 408 cagcgagcatatcgacagcagaaccttggatatggtgagggcggggctcca 458
           |||||| |||||||| ||||  |||||||| ||||||||||| ||||||||
Sbjct: 397 cagcgaacatatcgagagcaacaccttggaaatggtgagggcagggctcca 347



to top

>ref|NM_180783.1| Arabidopsis thaliana UBC8 (UBIQUITIN CONJUGATING ENZYME 8);
           ubiquitin conjugating enzyme AT5G41700 (UBC8) transcript
           variant AT5G41700.1 mRNA, complete cds
          Length = 864

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 408 cagcgagcatatcgacagcagaaccttggatatggtgagggcggggctcca 458
           |||||| |||||||| ||||  |||||||| ||||||||||| ||||||||
Sbjct: 458 cagcgaacatatcgagagcaacaccttggaaatggtgagggcagggctcca 408



to top

>gb|DQ222513.1| Solanum tuberosum clone 117E03 ubiquitin conjugating enzyme E2-like
           mRNA, complete cds
          Length = 835

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 78/95 (82%)
 Strand = Plus / Minus

                                                                       
Query: 367 atctccggcaccagcgggtcgtccgggttcgggtccgtcagcagcgagcatatcgacagc 426
           |||||||||||||  ||||| || || || ||||| |||||||| || || || || |||
Sbjct: 413 atctccggcaccaaagggtcatcaggattagggtctgtcagcagagaacagatagagagc 354

                                              
Query: 427 agaaccttggatatggtgagggcggggctccactg 461
           || |||||||| ||||| || || |||||||||||
Sbjct: 353 agtaccttggagatggtaagtgcagggctccactg 319



to top

>ref|XM_749910.1| Aspergillus fumigatus Af293 ubiquitin conjugating enzyme UbcD
           (Afu3g06030) partial mRNA
          Length = 444

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 96/119 (80%)
 Strand = Plus / Minus

                                                                       
Query: 343 cggtcggccttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtcc 402
           ||||||| |||| | | ||| |||||||| || |||| ||||||||||||||| ||||| 
Sbjct: 392 cggtcggtcttgtagacgtgagcgatctcaggtaccaacgggtcgtccgggttagggtct 333

                                                                      
Query: 403 gtcagcagcgagcatatcgacagcagaaccttggatatggtgagggcggggctccactg 461
           || ||||  ||||| ||||| ||||| || || || || || || || |||||||||||
Sbjct: 332 gtgagcattgagcagatcgaaagcagcactttagagattgtaagagcagggctccactg 274



to top

>emb|X73419.1|LEUBC L.esculentum mRNA for ubiquitin conjugating enzyme E2
          Length = 686

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 78/95 (82%)
 Strand = Plus / Minus

                                                                       
Query: 367 atctccggcaccagcgggtcgtccgggttcgggtccgtcagcagcgagcatatcgacagc 426
           |||||||||||||  ||||| || || || ||||| |||||||| || || || || |||
Sbjct: 380 atctccggcaccaaagggtcatcgggattagggtctgtcagcagagaacagatagagagc 321

                                              
Query: 427 agaaccttggatatggtgagggcggggctccactg 461
           || |||||||| ||||| || || |||||||||||
Sbjct: 320 agtaccttggagatggtaagtgcagggctccactg 286



to top

>gb|AY063074.1| Arabidopsis thaliana putative ubiquitin-conjugating enzyme 8
           (At5g41700) mRNA, complete cds
          Length = 478

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 408 cagcgagcatatcgacagcagaaccttggatatggtgagggcggggctcca 458
           |||||| |||||||| ||||  |||||||| ||||||||||| ||||||||
Sbjct: 327 cagcgaacatatcgagagcaacaccttggaaatggtgagggcagggctcca 277



to top

>gb|AF370257.1| Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme UBC8
           (At5g41700) mRNA, complete cds
          Length = 810

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 408 cagcgagcatatcgacagcagaaccttggatatggtgagggcggggctcca 458
           |||||| |||||||| ||||  |||||||| ||||||||||| ||||||||
Sbjct: 452 cagcgaacatatcgagagcaacaccttggaaatggtgagggcagggctcca 402



to top

>gb|AY072514.1| Arabidopsis thaliana ubiquitin-conjugating enzyme E2-17 kD 8
           (MBK23.24) mRNA, complete cds
          Length = 476

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 408 cagcgagcatatcgacagcagaaccttggatatggtgagggcggggctcca 458
           |||||| |||||||| ||||  |||||||| ||||||||||| ||||||||
Sbjct: 327 cagcgaacatatcgagagcaacaccttggaaatggtgagggcagggctcca 277



to top

>gb|AY057631.1| Arabidopsis thaliana AT5g41700/MBK23_24 mRNA, complete cds
          Length = 653

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 408 cagcgagcatatcgacagcagaaccttggatatggtgagggcggggctcca 458
           |||||| |||||||| ||||  |||||||| ||||||||||| ||||||||
Sbjct: 393 cagcgaacatatcgagagcaacaccttggaaatggtgagggcagggctcca 343



to top

>gb|AY054595.1| Arabidopsis thaliana ubiquitin-conjugating enzyme E2-17 kD 8
           (ubiquitin-protein ligase 8) (ubiquitin carrier protein
           8) (MBK23.24) mRNA, complete cds
          Length = 755

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 408 cagcgagcatatcgacagcagaaccttggatatggtgagggcggggctcca 458
           |||||| |||||||| ||||  |||||||| ||||||||||| ||||||||
Sbjct: 503 cagcgaacatatcgagagcaacaccttggaaatggtgagggcagggctcca 453



to top

>gb|AF325009.2|AF325009 Arabidopsis thaliana AT5g41700 (AT5g41700/MBK23_24) mRNA, complete
           cds
          Length = 667

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 408 cagcgagcatatcgacagcagaaccttggatatggtgagggcggggctcca 458
           |||||| |||||||| ||||  |||||||| ||||||||||| ||||||||
Sbjct: 398 cagcgaacatatcgagagcaacaccttggaaatggtgagggcagggctcca 348



to top

>emb|BX832305.1|CNS0A1WR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH64ZD08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 650

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 408 cagcgagcatatcgacagcagaaccttggatatggtgagggcggggctcca 458
           |||||| |||||||| ||||  |||||||| ||||||||||| ||||||||
Sbjct: 377 cagcgaacatatcgagagcaacaccttggaaatggtgagggcagggctcca 327



to top

>gb|AY085670.1| Arabidopsis thaliana clone 16865 mRNA, complete sequence
          Length = 747

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                       
Query: 356 acatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagcgagc 415
           ||||||| || ||||| ||||| | |||||| || || || || ||||| | |||||| |
Sbjct: 510 acatgtgtgcaatctctggcactaacgggtcatctggatttggatccgttaacagcgaac 451

                                                      
Query: 416 atatcgacagcagaaccttggatatggtgagggcggggctcca 458
           ||||||| ||||  ||||| || ||||||||||| ||||||||
Sbjct: 450 atatcgaaagcaacaccttcgaaatggtgagggcagggctcca 408



to top

>dbj|AK117378.1| Arabidopsis thaliana At5g41080 mRNA for unknown protein, complete
           cds, clone: RAFL16-95-M21
          Length = 2157

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 408 cagcgagcatatcgacagcagaaccttggatatggtgagggcggggctcca 458
           |||||| |||||||| ||||  |||||||| ||||||||||| ||||||||
Sbjct: 393 cagcgaacatatcgagagcaacaccttggaaatggtgagggcagggctcca 343



to top

>gb|AY105836.1| Zea mays PCO130472 mRNA sequence
          Length = 915

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                       
Query: 356 acatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagcgagc 415
           ||||||| |||||||| || || || |||||||||||||| ||||| || || |||||||
Sbjct: 591 acatgtgggcgatctcagggacaagggggtcgtccgggttggggtcggtgaggagcgagc 532

                                                      
Query: 416 atatcgacagcagaaccttggatatggtgagggcggggctcca 458
             || || || || ||||| |||||||| || || ||||||||
Sbjct: 531 tgatggagaggaggacctttgatatggtcagtgcagggctcca 489



to top

>gb|DQ027022.1| Arabidopsis thaliana ubiquitinating enzyme (At5g41700) mRNA,
           complete cds
          Length = 447

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 408 cagcgagcatatcgacagcagaaccttggatatggtgagggcggggctcca 458
           |||||| |||||||| ||||  |||||||| ||||||||||| ||||||||
Sbjct: 327 cagcgaacatatcgagagcaacaccttggaaatggtgagggcagggctcca 277



to top

>ref|XM_310998.2| Anopheles gambiae str. PEST ENSANGP00000019908
           (ENSANGG00000017419), mRNA
          Length = 707

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 71/86 (82%)
 Strand = Plus / Minus

                                                                       
Query: 367 atctccggcaccagcgggtcgtccgggttcgggtccgtcagcagcgagcatatcgacagc 426
           ||||||||||||||||||||||| ||||| || ||   || ||| ||||| || ||||||
Sbjct: 595 atctccggcaccagcgggtcgtcggggttgggatcacacaacagagagcagatggacagc 536

                                     
Query: 427 agaaccttggatatggtgagggcggg 452
           |  ||||| ||||| || ||||||||
Sbjct: 535 aacacctttgatattgtcagggcggg 510



to top

>gb|BT013767.1| Lycopersicon esculentum clone 132651R, mRNA sequence
          Length = 844

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 391 gggttcgggtccgtcagcagcgagcatatcgacagcagaaccttggatatggt 443
           ||||| ||||| |||| ||| ||||| || |||||||| ||||||||||||||
Sbjct: 506 gggtttgggtctgtcaacagagagcagatggacagcaggaccttggatatggt 454



to top

>gb|AF154650.1| Nicotiana tabacum clone PR35 mRNA sequence
          Length = 671

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 397 gggtccgtcagcagcgagcatatcgacagcagaaccttggatatggtgagggcggggctc 456
           |||||||| ||||| || || || ||||  || ||||||||||| ||||| |||||||||
Sbjct: 365 gggtccgttagcagagaacagatagacatgagcaccttggatattgtgagtgcggggctc 306

                
Query: 457 cactg 461
           |||||
Sbjct: 305 cactg 301



to top

>dbj|AB011476.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDA7
          Length = 82033

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                              
Query: 385   tcgtccgggttcgggtccgtcagcagcgagcatatcgacagcagaacct 433
             ||||| ||||| || ||||||||||  |||||||||||||| |||||||
Sbjct: 65187 tcgtcagggtttggatccgtcagcaatgagcatatcgacagaagaacct 65139



to top

>gb|DQ284472.1| Solanum tuberosum clone 116D11 ubiquitin-conjugating protein-like
           mRNA, complete cds
          Length = 531

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 391 gggttcgggtccgtcagcagcgagcatatcgacagcagaaccttggatatggt 443
           ||||| ||||| |||| ||| ||||| || |||||||| ||||||||||||||
Sbjct: 266 gggtttgggtctgtcaacagagagcagatggacagcaggaccttggatatggt 214



to top

>gb|L23762.1|TOM1KUC Lycopersicon esculentum ubiquitin carrier protein (Ubc) mRNA,
           complete cds
          Length = 825

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 391 gggttcgggtccgtcagcagcgagcatatcgacagcagaaccttggatatggt 443
           ||||| ||||| |||| ||| ||||| || |||||||| ||||||||||||||
Sbjct: 510 gggtttgggtctgtcaacagagagcagatggacagcaggaccttggatatggt 458



to top

>gb|AY491500.1| Capsicum annuum ubiquitin-conjugating enzyme E2 mRNA, complete cds
          Length = 779

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 367 atctccggcaccagcgggtcgtccgggttcgggtccgtcagcagcgagcatatcgacagc 426
           ||||| || ||||| ||||| || ||||| || |||||||  || ||||| || || |||
Sbjct: 413 atctcaggaaccagagggtcatcggggtttggatccgtcaagagtgagcagattgaaagc 354

                                           
Query: 427 agaaccttggatatggtgagggcggggctcca 458
           ||||||||||| || || | ||||||||||||
Sbjct: 353 agaaccttggaaatagtcaaggcggggctcca 322



to top

>emb|CR646344.2|CNS0EXOU Tetraodon nigroviridis full-length cDNA
          Length = 1178

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 403 gtcagcagcgagcatatcgacagcagaaccttggatatggtgagggcggggctcca 458
           |||||||| ||||| || ||||| || |||||||| ||||||||||| || |||||
Sbjct: 568 gtcagcagggagcagatggacaggaggaccttggagatggtgagggcaggactcca 513



to top

>emb|BX629356.1|CNS09SBW Tetraodon nigroviridis BAC sequence
          Length = 101385

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                     
Query: 403   gtcagcagcgagcatatcgacagcagaaccttggatatggtgagggcggggctcca 458
             |||||||| ||||| || ||||| || |||||||| ||||||||||| || |||||
Sbjct: 39583 gtcagcagggagcagatggacaggaggaccttggagatggtgagggcaggactcca 39528



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                     
Query: 403   gtcagcagcgagcatatcgacagcagaaccttggatatggtgagggcggggctcca 458
             |||||||| ||||| || ||||| || |||||||| ||||||||||| || |||||
Sbjct: 32314 gtcagcagggagcagatggacaggaggaccttggagatggtgagggcaggactcca 32259



to top

>dbj|AP004929.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT06J16, TM0083,
              complete sequence
          Length = 120016

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 430    accttggatatggtgagggcggggctccactg 461
              ||||||||||| |||||||| |||||||||||
Sbjct: 111466 accttggatattgtgagggccgggctccactg 111435



to top

>ref|XM_655273.1| Aspergillus nidulans FGSC A4 ubiquitin-conjugating enzyme E2-16 kDa
           (AN2761.2), mRNA
          Length = 444

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 367 atctccggcaccagcgggtcgtccgggttcgggtccgtcagcagcgagcatatcgacagc 426
           ||||| |||||||| ||||| |||||||| || || || ||||  ||||||||||| |||
Sbjct: 368 atctcaggcaccagagggtcatccgggttgggatctgtgagcatggagcatatcgagagc 309

                      
Query: 427 agaaccttgga 437
           || || |||||
Sbjct: 308 agcactttgga 298



to top

>gb|AC182754.1| Gasterosteus aculeatus clone VMRC28-42C14, complete sequence
          Length = 138028

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                
Query: 345   gtcggccttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggtt 395
             |||||||||| |  |||| |||||||| || ||||| ||||||||||||||
Sbjct: 11801 gtcggccttgtatgtgtgggcgatctctggtaccagtgggtcgtccgggtt 11851



to top

>ref|XM_471009.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1596

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 248  ctttgagctcgatcgagctgca 269
            ||||||||||||||||||||||
Sbjct: 1495 ctttgagctcgatcgagctgca 1474



to top

>gb|AY489135.1| Capsicum annuum ubiquitin-conjugating enzyme 8 mRNA, complete cds
          Length = 713

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 397 gggtccgtcagcagcgagcatatcgacagcagaaccttggatatggtgagggcggggctc 456
           ||||| || ||||| ||||| ||||||||||  |||||||| || || || |||||||||
Sbjct: 397 gggtctgttagcagagagcagatcgacagcaacaccttggaaatcgtaagtgcggggctc 338

             
Query: 457 ca 458
           ||
Sbjct: 337 ca 336



to top

>emb|CR733525.2|CNS0GSRO Tetraodon nigroviridis full-length cDNA
          Length = 1352

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 364 gcgatctccggcaccagcgggtcgtccgggttcgggtc 401
           |||||||| |||||||| ||||| || |||||||||||
Sbjct: 746 gcgatctctggcaccagtgggtcatcagggttcgggtc 709



to top

>emb|CR732722.2|CNS0GSBA Tetraodon nigroviridis full-length cDNA
          Length = 1355

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 364 gcgatctccggcaccagcgggtcgtccgggttcgggtc 401
           |||||||| |||||||| ||||| || |||||||||||
Sbjct: 748 gcgatctctggcaccagtgggtcatcagggttcgggtc 711



to top

>emb|CR731170.1|CNS0GR47 Tetraodon nigroviridis full-length cDNA
          Length = 1336

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 364 gcgatctccggcaccagcgggtcgtccgggttcgggtc 401
           |||||||| |||||||| ||||| || |||||||||||
Sbjct: 738 gcgatctctggcaccagtgggtcatcagggttcgggtc 701



to top

>emb|CR728345.2|CNS0GOXR Tetraodon nigroviridis full-length cDNA
          Length = 1345

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 364 gcgatctccggcaccagcgggtcgtccgggttcgggtc 401
           |||||||| |||||||| ||||| || |||||||||||
Sbjct: 746 gcgatctctggcaccagtgggtcatcagggttcgggtc 709



to top

>emb|CR724467.2|CNS0GLY1 Tetraodon nigroviridis full-length cDNA
          Length = 1349

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 364 gcgatctccggcaccagcgggtcgtccgggttcgggtc 401
           |||||||| |||||||| ||||| || |||||||||||
Sbjct: 746 gcgatctctggcaccagtgggtcatcagggttcgggtc 709



to top

>emb|CR708686.2|CNS0G9RU Tetraodon nigroviridis full-length cDNA
          Length = 654

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 364 gcgatctccggcaccagcgggtcgtccgggttcgggtc 401
           |||||||| |||||||| ||||| || |||||||||||
Sbjct: 54  gcgatctctggcaccagtgggtcatcagggttcgggtc 17



to top

>emb|CR673935.2|CNS0FIZ9 Tetraodon nigroviridis full-length cDNA
          Length = 1374

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 364 gcgatctccggcaccagcgggtcgtccgggttcgggtc 401
           |||||||| |||||||| ||||| || |||||||||||
Sbjct: 736 gcgatctctggcaccagtgggtcatcagggttcgggtc 699



to top

>emb|CR661341.2|CNS0F99F Tetraodon nigroviridis full-length cDNA
          Length = 1098

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 364 gcgatctccggcaccagcgggtcgtccgggttcgggtc 401
           |||||||| |||||||| ||||| || |||||||||||
Sbjct: 735 gcgatctctggcaccagtgggtcatcagggttcgggtc 698



to top

>emb|CR648302.2|CNS0EZ78 Tetraodon nigroviridis full-length cDNA
          Length = 1099

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 364 gcgatctccggcaccagcgggtcgtccgggttcgggtc 401
           |||||||| |||||||| ||||| || |||||||||||
Sbjct: 732 gcgatctctggcaccagtgggtcatcagggttcgggtc 695



to top

>emb|CR647212.2|CNS0EYCY Tetraodon nigroviridis full-length cDNA
          Length = 1080

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 364 gcgatctccggcaccagcgggtcgtccgggttcgggtc 401
           |||||||| |||||||| ||||| || |||||||||||
Sbjct: 714 gcgatctctggcaccagtgggtcatcagggttcgggtc 677



to top

>emb|Z14991.1|ATUBC10 A.thaliana UBC10 mRNA for ubiquitin conjugating enzyme homolog
          Length = 818

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 133/170 (78%)
 Strand = Plus / Minus

                                                                       
Query: 292 cccatggcgtacttgtgcgtccagcccctggccgtggactcgtacctggtccggtcggcc 351
           |||||||| ||||| || |||||||  |  || |||||||||||| || ||  ||| | |
Sbjct: 575 cccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtcagtc 516

                                                                       
Query: 352 ttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagc 411
           ||| ||||||| || ||||| |||||||  || || |||||||| || || || | ||  
Sbjct: 515 ttgtacatgtgagctatctcgggcaccaaaggatcatccgggtttggatcggttaacaaa 456

                                                             
Query: 412 gagcatatcgacagcagaaccttggatatggtgagggcggggctccactg 461
           || || ||||| ||||| |||||||| |||||||| || || ||||||||
Sbjct: 455 gaacagatcgatagcagcaccttggaaatggtgagcgcaggactccactg 406



to top

>gb|AY113937.1| Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme
           UBC10 (At5g53300) mRNA, complete cds
          Length = 478

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 133/170 (78%)
 Strand = Plus / Minus

                                                                       
Query: 292 cccatggcgtacttgtgcgtccagcccctggccgtggactcgtacctggtccggtcggcc 351
           |||||||| ||||| || |||||||  |  || |||||||||||| || ||  ||| | |
Sbjct: 443 cccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtcagtc 384

                                                                       
Query: 352 ttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagc 411
           ||| ||||||| || ||||| |||||||  || || |||||||| || || || | ||  
Sbjct: 383 ttgtacatgtgagctatctcgggcaccaaaggatcatccgggtttggatcggttaacaaa 324

                                                             
Query: 412 gagcatatcgacagcagaaccttggatatggtgagggcggggctccactg 461
           || || ||||| ||||| |||||||| |||||||| || || ||||||||
Sbjct: 323 gaacagatcgatagcagcaccttggaaatggtgagcgcaggactccactg 274



to top

>emb|AL606642.3|OSJN00073 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0027H06,
              complete sequence
          Length = 143730

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 248    ctttgagctcgatcgagctgca 269
              ||||||||||||||||||||||
Sbjct: 136152 ctttgagctcgatcgagctgca 136173



to top

>gb|AY129488.1| Arabidopsis thaliana AT5g53300/K19E1_10 mRNA, complete cds
          Length = 447

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 133/170 (78%)
 Strand = Plus / Minus

                                                                       
Query: 292 cccatggcgtacttgtgcgtccagcccctggccgtggactcgtacctggtccggtcggcc 351
           |||||||| ||||| || |||||||  |  || |||||||||||| || ||  ||| | |
Sbjct: 443 cccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtcagtc 384

                                                                       
Query: 352 ttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagc 411
           ||| ||||||| || ||||| |||||||  || || |||||||| || || || | ||  
Sbjct: 383 ttgtacatgtgagctatctcgggcaccaaaggatcatccgggtttggatcggttaacaaa 324

                                                             
Query: 412 gagcatatcgacagcagaaccttggatatggtgagggcggggctccactg 461
           || || ||||| ||||| |||||||| |||||||| || || ||||||||
Sbjct: 323 gaacagatcgatagcagcaccttggaaatggtgagcgcaggactccactg 274



to top

>gb|AY083170.1| Malus x domestica ubiquitin conjugating-like enzyme mRNA, partial
           cds
          Length = 174

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 356 acatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagca 409
           ||||||| |||||||||||||| || ||||| || || || ||||| |||||||
Sbjct: 63  acatgtgggcgatctccggcacgagagggtcatcaggatttgggtcagtcagca 10



to top

>emb|BX833981.1|CNS0A0DI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL88ZC07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 769

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 133/170 (78%)
 Strand = Plus / Minus

                                                                       
Query: 292 cccatggcgtacttgtgcgtccagcccctggccgtggactcgtacctggtccggtcggcc 351
           |||||||| ||||| || |||||||  |  || |||||||||||| || ||  ||| | |
Sbjct: 530 cccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtcagtc 471

                                                                       
Query: 352 ttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagc 411
           ||| ||||||| || ||||| |||||||  || || |||||||| || || || | ||  
Sbjct: 470 ttgtacatgtgagctatctcgggcaccaaaggatcatccgggtttggatcggttaacaaa 411

                                                             
Query: 412 gagcatatcgacagcagaaccttggatatggtgagggcggggctccactg 461
           || || ||||| ||||| |||||||| |||||||| || || ||||||||
Sbjct: 410 gaacagatcgatagcagcaccttggaaatggtgagcgcaggactccactg 361



to top

>dbj|AK103144.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033120H12, full
            insert sequence
          Length = 2559

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 248  ctttgagctcgatcgagctgca 269
            ||||||||||||||||||||||
Sbjct: 1705 ctttgagctcgatcgagctgca 1684



to top

>dbj|AK073722.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033060P16, full
            insert sequence
          Length = 2498

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 248  ctttgagctcgatcgagctgca 269
            ||||||||||||||||||||||
Sbjct: 1705 ctttgagctcgatcgagctgca 1684



to top

>emb|AL442118.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0201G08, complete
             sequence
          Length = 121821

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 248   ctttgagctcgatcgagctgca 269
             ||||||||||||||||||||||
Sbjct: 80156 ctttgagctcgatcgagctgca 80177



to top

>gb|DQ027024.1| Arabidopsis thaliana ubiquitinating enzyme (At5g53300) mRNA,
           complete cds
          Length = 447

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 133/170 (78%)
 Strand = Plus / Minus

                                                                       
Query: 292 cccatggcgtacttgtgcgtccagcccctggccgtggactcgtacctggtccggtcggcc 351
           |||||||| ||||| || |||||||  |  || |||||||||||| || ||  ||| | |
Sbjct: 443 cccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtcagtc 384

                                                                       
Query: 352 ttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagc 411
           ||| ||||||| || ||||| |||||||  || || |||||||| || || || | ||  
Sbjct: 383 ttgtacatgtgagctatctcgggcaccaaaggatcatccgggtttggatcggttaacaaa 324

                                                             
Query: 412 gagcatatcgacagcagaaccttggatatggtgagggcggggctccactg 461
           || || ||||| ||||| |||||||| |||||||| || || ||||||||
Sbjct: 323 gaacagatcgatagcagcaccttggaaatggtgagcgcaggactccactg 274



to top

>gb|DQ249816.1| Capsicum annuum ubiquitin-conjugating enzyme E2 mRNA, complete cds
          Length = 678

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 397 gggtccgtcagcagcgagcatatcgacagcagaaccttggatatggtgagggcggggctc 456
           ||||| || ||||| ||||| ||||||||||  |||||||| || || || |||||||||
Sbjct: 408 gggtctgttagcagagagcagatcgacagcaacaccttggaaatcgtaagtgcggggctc 349

             
Query: 457 ca 458
           ||
Sbjct: 348 ca 347



to top

>gb|L00640.1|ATHUBCC Arabidopsis thaliana ubiquitin conjugating enzyme mRNA, complete
           cds
          Length = 818

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 133/170 (78%)
 Strand = Plus / Minus

                                                                       
Query: 292 cccatggcgtacttgtgcgtccagcccctggccgtggactcgtacctggtccggtcggcc 351
           |||||||| ||||| || |||||||  |  || |||||||||||| || ||  ||| | |
Sbjct: 575 cccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtcagtc 516

                                                                       
Query: 352 ttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtccgtcagcagc 411
           ||| ||||||| || ||||| |||||||  || || |||||||| || || || | ||  
Sbjct: 515 ttgtacatgtgagctatctcgggcaccaaaggatcatccgggtttggatcggttaacaaa 456

                                                             
Query: 412 gagcatatcgacagcagaaccttggatatggtgagggcggggctccactg 461
           || || ||||| ||||| |||||||| |||||||| || || ||||||||
Sbjct: 455 gaacagatcgatagcagcaccttggaaatggtgagcgcaggactccactg 406



to top

>ref|NM_180785.1| Arabidopsis thaliana UBC8 (UBIQUITIN CONJUGATING ENZYME 8);
           ubiquitin conjugating enzyme AT5G41700 (UBC8) transcript
           variant AT5G41700.3 mRNA, complete cds
          Length = 1006

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 430 accttggatatggtgagggcggggctcca 458
           |||||||| ||||||||||| ||||||||
Sbjct: 385 accttggaaatggtgagggcagggctcca 357



to top

>ref|NM_200959.2| Danio rerio zgc:55886 (zgc:55886), mRNA
          Length = 1935

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 382 gggtcgtccgggttcgggtccgtcagcagcgagcatatcgacagcagaaccttggatatg 441
           ||||||||||| || |||||   |||||| ||||| || ||||| ||||| ||||| |||
Sbjct: 600 gggtcgtccggattagggtcacacagcagggagcagatggacaggagaactttggagatg 541

                
Query: 442 gtgag 446
           |||||
Sbjct: 540 gtgag 536



to top

>emb|CR650501.2|CNS0F0WB Tetraodon nigroviridis full-length cDNA
          Length = 974

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 349 gccttgcacatgtgcgcgatctccggcaccagcgggtcgtccgggttcgggtc 401
           |||||| || |||| ||||| || || ||||||||||||||||| || |||||
Sbjct: 298 gccttgtacgtgtgagcgatttctggtaccagcgggtcgtccggattagggtc 246



to top

>emb|Z14989.1|ATUBC8 A.thaliana UBC8 gene for ubiquitin conjugating enzyme homolog
          Length = 1447

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 430 accttggatatggtgagggcggggctcca 458
           |||||||| ||||||||||| ||||||||
Sbjct: 943 accttggaaatggtgagggcagggctcca 915



to top

>gb|AY952317.1| Triticum aestivum cultivar 7269-10 immature spike
           ubiquitin-conjugating enzyme 2 mRNA, complete cds
          Length = 853

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 292 cccatggcgtacttgtgcgtccagc 316
           |||||||||||||| ||||||||||
Sbjct: 583 cccatggcgtacttctgcgtccagc 559



to top

>gb|BC065678.1| Danio rerio zgc:55886, mRNA (cDNA clone MGC:77149 IMAGE:6961245),
           complete cds
          Length = 1935

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 382 gggtcgtccgggttcgggtccgtcagcagcgagcatatcgacagcagaaccttggatatg 441
           ||||||||||| || |||||   |||||| ||||| || ||||| ||||| ||||| |||
Sbjct: 600 gggtcgtccggattagggtcacacagcagggagcagatggacaggagaactttggagatg 541

                
Query: 442 gtgag 446
           |||||
Sbjct: 540 gtgag 536



to top

>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V,
              complete sequence
          Length = 1519138

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                   
Query: 370    tccggcaccagcgggtcgtccgggttcgggtccgtca 406
              ||||| |||| ||||||||||||||| | ||||||||
Sbjct: 960499 tccggaaccaacgggtcgtccgggttggcgtccgtca 960535



to top

>dbj|AB005233.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23
          Length = 79837

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 430   accttggatatggtgagggcggggctcca 458
             |||||||| ||||||||||| ||||||||
Sbjct: 71843 accttggaaatggtgagggcagggctcca 71815



to top

>ref|NM_210385.1| Eremothecium gossypii AER173Cp (AER173C), mRNA
          Length = 444

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 370 tccggcaccagcgggtcgtccgggttcgggtccgtca 406
           ||||| |||| ||||||||||||||| | ||||||||
Sbjct: 365 tccggaaccaacgggtcgtccgggttggcgtccgtca 329



to top

>gb|L00638.1|ATHUBCA Arabidopsis thaliana ubiquitin conjugating enzyme exons 2-4
          Length = 1447

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 430 accttggatatggtgagggcggggctcca 458
           |||||||| ||||||||||| ||||||||
Sbjct: 943 accttggaaatggtgagggcagggctcca 915



to top

>ref|NM_001036151.1| Arabidopsis thaliana ubiquitin conjugating enzyme/ ubiquitin-like
           activating enzyme AT1G64230 transcript variant
           AT1G64230.2 mRNA, complete cds
          Length = 885

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 415 catatcgacagcagaaccttggatatggtgag 446
           |||||||| |||| |||||| |||||||||||
Sbjct: 442 catatcgaaagcaaaaccttcgatatggtgag 411



to top

>ref|NM_105097.3| Arabidopsis thaliana ubiquitin conjugating enzyme/ ubiquitin-like
           activating enzyme AT1G64230 transcript variant
           AT1G64230.1 mRNA, complete cds
          Length = 846

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 415 catatcgacagcagaaccttggatatggtgag 446
           |||||||| |||| |||||| |||||||||||
Sbjct: 454 catatcgaaagcaaaaccttcgatatggtgag 423



to top

>gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence
          Length = 1608198

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 56/68 (82%)
 Strand = Plus / Minus

                                                                          
Query: 385    tcgtccgggttcgggtccgtcagcagcgagcatatcgacagcagaaccttggatatggtg 444
              ||||| ||||| || || |||||||||||||| |  || ||||  ||||| || ||||||
Sbjct: 328603 tcgtcagggttgggatctgtcagcagcgagcagacggagagcaacaccttcgagatggtg 328544

                      
Query: 445    agggcggg 452
              ||||||||
Sbjct: 328543 agggcggg 328536



to top

>gb|AY682844.1| Human coxsackievirus B5 isolate B 92746 polyprotein gene, partial
           cds
          Length = 1375

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 345 gtcggccttgcacatgtgcgcgatctcc 372
           |||||| ||||| |||||||||||||||
Sbjct: 718 gtcggctttgcagatgtgcgcgatctcc 745



to top

>gb|AC159432.1| Trypanosoma brucei chromosome 5 clone RPCI93-28F8, complete sequence
          Length = 140539

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 56/68 (82%)
 Strand = Plus / Plus

                                                                         
Query: 385   tcgtccgggttcgggtccgtcagcagcgagcatatcgacagcagaaccttggatatggtg 444
             ||||| ||||| || || |||||||||||||| |  || ||||  ||||| || ||||||
Sbjct: 64923 tcgtcagggttgggatctgtcagcagcgagcagacggagagcaacaccttcgagatggtg 64982

                     
Query: 445   agggcggg 452
             ||||||||
Sbjct: 64983 agggcggg 64990



to top

>gb|BC076483.1| Danio rerio zgc:92467, mRNA (cDNA clone MGC:92467 IMAGE:7043653),
           complete cds
          Length = 1420

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 412 gagcatatcgacagcagaaccttggatatggt 443
           ||||| || |||||||| ||||||||||||||
Sbjct: 527 gagcagatggacagcagcaccttggatatggt 496



to top

>ref|XM_819286.1| Trypanosoma brucei TREU927 clone RPCI93-28F8 ubiquitin-conjugating
           enzyme E2 (Tb927.5.1000) partial mRNA
          Length = 447

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 56/68 (82%)
 Strand = Plus / Minus

                                                                       
Query: 385 tcgtccgggttcgggtccgtcagcagcgagcatatcgacagcagaaccttggatatggtg 444
           ||||| ||||| || || |||||||||||||| |  || ||||  ||||| || ||||||
Sbjct: 353 tcgtcagggttgggatctgtcagcagcgagcagacggagagcaacaccttcgagatggtg 294

                   
Query: 445 agggcggg 452
           ||||||||
Sbjct: 293 agggcggg 286



to top

>emb|CR652711.2|CNS0F2LP Tetraodon nigroviridis full-length cDNA
          Length = 910

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 349 gccttgcacatgtgcgcgatctccggcaccagcgggtcgtccgg 392
           |||||| || |||| ||||| || || |||||||||||||||||
Sbjct: 295 gccttgtacgtgtgagcgatttctggtaccagcgggtcgtccgg 252



to top

>emb|AL445230.11| Human DNA sequence from clone RP11-517F10 on chromosome 1 Contains the
             5' end of the COPA gene for coatomer protein complex
             subunit alpha, the gene for nicastrin (KIAA0253), the
             NHLH1 gene for nescient helix loop helix 1, the VANGL2
             gene for vang-like 2 (van gogh, Drosophila) and a CpG
             island, complete sequence
          Length = 102345

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 230   cataagcactttccacatct 249
             ||||||||||||||||||||
Sbjct: 55298 cataagcactttccacatct 55279



to top

>emb|AL035669.43|HS885L7 Human DNA sequence from clone RP5-885L7 on chromosome 20q13.2-13.33
             Contains the 3' end of the NTSR1 gene for high affinity
             neurotensin receptor 1, the C20orf20 gene, the OGFR gene
             for opioid growth factor receptor, the COL9A3 gene for
             collagen IX alpha 3, the C20orf143 gene, the TCFL5 gene
             for basic helix-loop-helix transcription factor-like 5,
             the ARF4P2 gene for ADP-ribosylation factor 4 pseudogene
             2, the 3' end of the DATF1 gene for death associated
             transcription factor 1, two novel genes and seven CpG
             islands, complete sequence
          Length = 160241

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 319   ctggccgtggactcgtacct 338
             ||||||||||||||||||||
Sbjct: 87956 ctggccgtggactcgtacct 87937



to top

>emb|CR555306.1| Azoarcus sp. EbN1 complete genome
          Length = 4296230

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 362     gcgcgatctccggcaccagc 381
               ||||||||||||||||||||
Sbjct: 1677132 gcgcgatctccggcaccagc 1677151



to top

>ref|NM_001003494.1| Danio rerio zgc:92467 (zgc:92467), mRNA
          Length = 1420

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 412 gagcatatcgacagcagaaccttggatatggt 443
           ||||| || |||||||| ||||||||||||||
Sbjct: 527 gagcagatggacagcagcaccttggatatggt 496



to top

>gb|AY133670.1| Arabidopsis thaliana At1g64230/F22C12_17 mRNA, complete cds
          Length = 447

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 415 catatcgacagcagaaccttggatatggtgag 446
           |||||||| |||| |||||| |||||||||||
Sbjct: 320 catatcgaaagcaaaaccttcgatatggtgag 289



to top

>gb|AC100835.2| Homo sapiens chromosome 15, clone CTD-3154N5, complete sequence
          Length = 165036

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 435   ggatatggtgagggcggggc 454
             ||||||||||||||||||||
Sbjct: 64323 ggatatggtgagggcggggc 64304



to top

>gb|AC068727.8| Homo sapiens chromosome 15 clone RP11-90M11 map 15q15, complete
             sequence
          Length = 175808

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 233   aagcactttccacatctttg 252
             ||||||||||||||||||||
Sbjct: 77284 aagcactttccacatctttg 77303



to top

>gb|AF480945.1| Arabidopsis thaliana ubiquitin conjugating enzyme UBC9A (UBC9A)
           mRNA, complete cds
          Length = 723

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 415 catatcgacagcagaaccttggatatggtgag 446
           |||||||| |||| |||||| |||||||||||
Sbjct: 407 catatcgaaagcaaaaccttcgatatggtgag 376



to top

>gb|AF385718.1|AF385718 Arabidopsis thaliana At1g64230/F22C12_17 mRNA, complete cds
          Length = 738

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 415 catatcgacagcagaaccttggatatggtgag 446
           |||||||| |||| |||||| |||||||||||
Sbjct: 446 catatcgaaagcaaaaccttcgatatggtgag 415



to top

>emb|BX815683.1|CNS0ABHQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS83ZF06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 776

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 415 catatcgacagcagaaccttggatatggtgag 446
           |||||||| |||| |||||| |||||||||||
Sbjct: 424 catatcgaaagcaaaaccttcgatatggtgag 393



to top

>emb|BX815644.1|CNS0ABEX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS7ZD08 of Adult vegetative tissue of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1496

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 415  catatcgacagcagaaccttggatatggtgag 446
            |||||||| |||| |||||| |||||||||||
Sbjct: 1224 catatcgaaagcaaaaccttcgatatggtgag 1193



to top

>emb|BX816916.1|CNS0ABT7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH76ZE04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 467

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 415 catatcgacagcagaaccttggatatggtgag 446
           |||||||| |||| |||||| |||||||||||
Sbjct: 154 catatcgaaagcaaaaccttcgatatggtgag 123



to top

>emb|BX816699.1|CNS0ABXP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH63ZG10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 782

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 415 catatcgacagcagaaccttggatatggtgag 446
           |||||||| |||| |||||| |||||||||||
Sbjct: 453 catatcgaaagcaaaaccttcgatatggtgag 422



to top

>gb|AC154434.2| Mus musculus BAC clone RP24-185H5 from chromosome 9, complete sequence
          Length = 192358

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 275   tatttagttatatctacccc 294
             ||||||||||||||||||||
Sbjct: 74447 tatttagttatatctacccc 74466



to top

>emb|BX681417.10| Zebrafish DNA sequence from clone DKEY-161L11 in linkage group 2,
              complete sequence
          Length = 233760

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 230    cataagcactttccacatct 249
              ||||||||||||||||||||
Sbjct: 175189 cataagcactttccacatct 175208



to top

>gb|AF026802.1|HSCOL9A3S2 Homo sapiens alpha-3 type IX collagen (COL9A3) gene, exons 27-32, and
            complete cds
          Length = 6246

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 319  ctggccgtggactcgtacct 338
            ||||||||||||||||||||
Sbjct: 3875 ctggccgtggactcgtacct 3856



to top

>gb|DQ027041.1| Arabidopsis thaliana ubiquitinating enzyme (At1g64230) mRNA,
           complete cds
          Length = 447

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 415 catatcgacagcagaaccttggatatggtgag 446
           |||||||| |||| |||||| |||||||||||
Sbjct: 320 catatcgaaagcaaaaccttcgatatggtgag 289



to top

>dbj|AB242223.1| Eptatretus burgeri IgSF3 mRNA for immunoglobulin superfamily 3,
           complete cds
          Length = 3876

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 425 gcagaaccttggatatggtgaggg 448
           |||||||||||||||| |||||||
Sbjct: 968 gcagaaccttggatatagtgaggg 945


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,845,912
Number of Sequences: 3902068
Number of extensions: 2845912
Number of successful extensions: 86856
Number of sequences better than 10.0: 149
Number of HSP's better than 10.0 without gapping: 144
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 86552
Number of HSP's gapped (non-prelim): 304
length of query: 461
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 439
effective length of database: 17,147,199,772
effective search space: 7527620699908
effective search space used: 7527620699908
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top