ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart37c03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC166992.2| Mus musculus BAC clone RP24-144F18 from chromosom... 42 0.49
2gb|AC161371.4| Mus musculus BAC clone RP23-402N3 from chromosome... 42 0.49
3emb|AL356573.18| Human DNA sequence from clone RP5-968A20 on chr... 42 0.49
4gb|AC132126.3| Mus musculus BAC clone RP23-400E10 from 8, comple... 42 0.49
5ref|XM_953474.1| Neurospora crassa OR74A hypothetical protein (N... 40 2.0
6ref|XM_331454.1| Neurospora crassa OR74A hypothetical protein (N... 40 2.0
7gb|BC070116.1| Homo sapiens hypothetical gene supported by AK128... 40 2.0
8emb|BX511137.14| Zebrafish DNA sequence from clone DKEY-192A11 i... 40 2.0
9gb|BC057385.1| Homo sapiens hypothetical gene supported by AK128... 40 2.0
10gb|AC129507.9| Homo sapiens chromosome 17, clone RP11-1260E13, c... 40 2.0
11dbj|AK128660.1| Homo sapiens cDNA FLJ46819 fis, clone TSTOM2000235 40 2.0
12ref|XM_936799.1| PREDICTED: Homo sapiens hypothetical gene suppo... 40 2.0
13gb|AC090791.6| Homo sapiens chromosome 11, clone RP11-466I1, com... 40 2.0
14emb|CR383656.1| Human chromosome 14 DNA sequence BAC R-536C10 of... 40 2.0
15gb|AC141424.3| Homo sapiens chromosome 17, clone RP13-803G22, co... 40 2.0
16ref|NG_002375.1| Homo sapiens oligophrenin 1 pseudogene 1 (OPHN1... 40 2.0
17ref|NM_001013672.2| Homo sapiens hypothetical gene supported by ... 40 2.0
18emb|BX072550.6| Zebrafish DNA sequence from clone DKEY-24P1 in l... 40 2.0
19emb|AL512310.4|CNS07EF1 Human chromosome 14 DNA sequence BAC R-5... 40 2.0
20emb|AL929600.3|CNS08CCF Human chromosome 14 DNA sequence BAC R-2... 40 2.0
21dbj|AP000534.1| Homo sapiens genomic DNA, chromosome 22q11.2, Ca... 40 2.0
22gb|AC150424.3| Branchiostoma floridae clone CH302-7J16, complete... 38 7.7
23gb|AC119214.6| Mus musculus chromosome 8, clone RP24-199K4, comp... 38 7.7
24gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 38 7.7
25gb|AY751823.1| Staphylococcus haemolyticus strain 6-13 OrfX (orf... 38 7.7
26gb|AY751820.1| Staphylococcus aureus strain 9-07 OrfX (orfX) gen... 38 7.7
27gb|AE009060.1| Agrobacterium tumefaciens str. C58 circular chrom... 38 7.7
28gb|DQ106887.1| Staphylococcus aureus strain M03-68 type-IVg SCCm... 38 7.7
29gb|AY267374.1| Staphylococcus aureus strain ATCC BAA-40 orfX gen... 38 7.7
30gb|AC144401.2| Didelphis virginiana clone LBNL3-270H19, complete... 38 7.7
31gb|AC098738.2| Mus musculus BAC clone RP23-122F7 from 8, complet... 38 7.7
32emb|AL590405.19| Human DNA sequence from clone RP11-124M24 on ch... 38 7.7
33gb|CP000316.1| Polaromonas sp. JS666, complete genome 38 7.7
34emb|AL157396.9| Human DNA sequence from clone RP11-437J2 on chro... 38 7.7
35gb|AF422696.1| Staphylococcus aureus strain HU25 SCCmec type III... 38 7.7
36emb|AL133283.9| Human DNA sequence from clone RP11-31M2 on chrom... 38 7.7
37emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 38 7.7
38dbj|D86934.2| Staphylococcus aureus DNA, resistance island Type-... 38 7.7
39dbj|AB047239.1| Staphylococcus aureus DNA, complete structure of... 38 7.7
40dbj|AB037671.1| Staphylococcus aureus DNA, type III staphylococc... 38 7.7
41gb|AC091563.9| Homo sapiens chromosome 8, clone RP11-760H22, com... 38 7.7
42gb|U10927.2| Staphylococcus aureus M type 1 capsular polysacchar... 38 7.7
43dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, co... 38 7.7
44gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome 38 7.7
45gb|AF411934.1| Staphylococcus aureus strain HDG2 genomic sequenc... 38 7.7
46gb|AC158352.5| Mus musculus chromosome 8, clone RP24-325B16, com... 38 7.7
47emb|BX511021.9| Zebrafish DNA sequence from clone DKEY-16P21 in ... 38 7.7
48gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 38 7.7
49dbj|AB047089.2| Staphylococcus aureus DNA, right extremity of Ty... 38 7.7
50gb|AC138024.2| Homo sapiens chromosome 1 clone RP5-1099E6, compl... 38 7.7
51dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic... 38 7.7
52emb|AJ339291.1|HSA339291 Homo sapiens genomic sequence surroundi... 38 7.7
53emb|BX571856.1| Staphylococcus aureus subsp. aureus strain MRSA2... 38 7.7
54dbj|AB096217.1| Staphylococcus aureus DNA, typeIVc staphylococca... 38 7.7
55dbj|AP005624.3| Homo sapiens genomic DNA, chromosome 8q23, clone... 38 7.7
56gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 38 7.7
57dbj|AB038513.1| Staphylococcus aureus DNA, SRImec-III and SCCmec... 38 7.7
58dbj|AP005717.3| Homo sapiens genomic DNA, chromosome 8q23, clone... 38 7.7

>gb|AC166992.2| Mus musculus BAC clone RP24-144F18 from chromosome 9, complete
            sequence
          Length = 193799

 Score = 42.1 bits (21), Expect = 0.49
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 109  ctgacccctgcagcttgtcct 129
            |||||||||||||||||||||
Sbjct: 2291 ctgacccctgcagcttgtcct 2271



to top

>gb|AC161371.4| Mus musculus BAC clone RP23-402N3 from chromosome 9, complete sequence
          Length = 203708

 Score = 42.1 bits (21), Expect = 0.49
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 109   ctgacccctgcagcttgtcct 129
             |||||||||||||||||||||
Sbjct: 50072 ctgacccctgcagcttgtcct 50092



to top

>emb|AL356573.18| Human DNA sequence from clone RP5-968A20 on chromosome 1, complete
             sequence
          Length = 19945

 Score = 42.1 bits (21), Expect = 0.49
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 8     ccatatgctgattcattatta 28
             |||||||||||||||||||||
Sbjct: 14007 ccatatgctgattcattatta 13987



to top

>gb|AC132126.3| Mus musculus BAC clone RP23-400E10 from 8, complete sequence
          Length = 204800

 Score = 42.1 bits (21), Expect = 0.49
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 109   ctgacccctgcagcttgtcct 129
             |||||||||||||||||||||
Sbjct: 49862 ctgacccctgcagcttgtcct 49842



to top

>ref|XM_953474.1| Neurospora crassa OR74A hypothetical protein (NCU09063.1) partial
            mRNA
          Length = 4935

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 137  gcggtcgagcttgtccgcca 156
            ||||||||||||||||||||
Sbjct: 2403 gcggtcgagcttgtccgcca 2422



to top

>ref|XM_331454.1| Neurospora crassa OR74A hypothetical protein (NCU09063.1) partial
            mRNA
          Length = 4935

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 137  gcggtcgagcttgtccgcca 156
            ||||||||||||||||||||
Sbjct: 2403 gcggtcgagcttgtccgcca 2422



to top

>gb|BC070116.1| Homo sapiens hypothetical gene supported by AK128660, mRNA (cDNA
           clone IMAGE:5272336), partial cds
          Length = 1524

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 57  acagagcaaagtggaaaaga 76
           ||||||||||||||||||||
Sbjct: 347 acagagcaaagtggaaaaga 366



to top

>emb|BX511137.14| Zebrafish DNA sequence from clone DKEY-192A11 in linkage group 7,
             complete sequence
          Length = 214145

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 66    agtggaaaagaccacagata 85
             ||||||||||||||||||||
Sbjct: 28652 agtggaaaagaccacagata 28633



to top

>gb|BC057385.1| Homo sapiens hypothetical gene supported by AK128660, mRNA (cDNA
           clone IMAGE:4826627), partial cds
          Length = 2243

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 57  acagagcaaagtggaaaaga 76
           ||||||||||||||||||||
Sbjct: 372 acagagcaaagtggaaaaga 391



to top

>gb|AC129507.9| Homo sapiens chromosome 17, clone RP11-1260E13, complete sequence
          Length = 199102

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 57    acagagcaaagtggaaaaga 76
             ||||||||||||||||||||
Sbjct: 26420 acagagcaaagtggaaaaga 26401



to top

>dbj|AK128660.1| Homo sapiens cDNA FLJ46819 fis, clone TSTOM2000235
          Length = 1839

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 57  acagagcaaagtggaaaaga 76
           ||||||||||||||||||||
Sbjct: 421 acagagcaaagtggaaaaga 440



to top

>ref|XM_936799.1| PREDICTED: Homo sapiens hypothetical gene supported by AK128660
           (LOC400566), mRNA
          Length = 1863

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 57  acagagcaaagtggaaaaga 76
           ||||||||||||||||||||
Sbjct: 516 acagagcaaagtggaaaaga 535



to top

>gb|AC090791.6| Homo sapiens chromosome 11, clone RP11-466I1, complete sequence
          Length = 172865

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 32     ttcccaaaattaaaccacaa 51
              ||||||||||||||||||||
Sbjct: 166640 ttcccaaaattaaaccacaa 166659



to top

>emb|CR383656.1| Human chromosome 14 DNA sequence BAC R-536C10 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 184906

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 1     gatgaggccatatgctgatt 20
             ||||||||||||||||||||
Sbjct: 86703 gatgaggccatatgctgatt 86722



to top

>gb|AC141424.3| Homo sapiens chromosome 17, clone RP13-803G22, complete sequence
          Length = 140126

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 57     acagagcaaagtggaaaaga 76
              ||||||||||||||||||||
Sbjct: 106539 acagagcaaagtggaaaaga 106558



to top

>ref|NG_002375.1| Homo sapiens oligophrenin 1 pseudogene 1 (OPHN1P1) on chromosome 22
          Length = 20254

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 1     gatgaggccatatgctgatt 20
             ||||||||||||||||||||
Sbjct: 12451 gatgaggccatatgctgatt 12432



to top

>ref|NM_001013672.2| Homo sapiens hypothetical gene supported by AK128660 (LOC400566),
           mRNA
          Length = 1839

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 57  acagagcaaagtggaaaaga 76
           ||||||||||||||||||||
Sbjct: 421 acagagcaaagtggaaaaga 440



to top

>emb|BX072550.6| Zebrafish DNA sequence from clone DKEY-24P1 in linkage group 15, complete
              sequence
          Length = 229061

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 100    acagcaggcctgacccctgc 119
              ||||||||||||||||||||
Sbjct: 199942 acagcaggcctgacccctgc 199923



to top

>emb|AL512310.4|CNS07EF1 Human chromosome 14 DNA sequence BAC R-597A11 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 185605

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 1     gatgaggccatatgctgatt 20
             ||||||||||||||||||||
Sbjct: 96722 gatgaggccatatgctgatt 96741



to top

>emb|AL929600.3|CNS08CCF Human chromosome 14 DNA sequence BAC R-254P21 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 148065

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 1     gatgaggccatatgctgatt 20
             ||||||||||||||||||||
Sbjct: 81532 gatgaggccatatgctgatt 81513



to top

>dbj|AP000534.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye Syndrome region,
             clone:c23H5
          Length = 37769

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 1     gatgaggccatatgctgatt 20
             ||||||||||||||||||||
Sbjct: 20232 gatgaggccatatgctgatt 20213



to top

>gb|AC150424.3| Branchiostoma floridae clone CH302-7J16, complete sequence
          Length = 154657

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 49   caatcaacacagagcaaag 67
            |||||||||||||||||||
Sbjct: 4277 caatcaacacagagcaaag 4295



to top

>gb|AC119214.6| Mus musculus chromosome 8, clone RP24-199K4, complete sequence
          Length = 156548

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 33    tcccaaaattaaaccacaa 51
             |||||||||||||||||||
Sbjct: 55306 tcccaaaattaaaccacaa 55324



to top

>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 117     tgcagcttgtcctggacga 135
               |||||||||||||||||||
Sbjct: 1801400 tgcagcttgtcctggacga 1801418



to top

>gb|AY751823.1| Staphylococcus haemolyticus strain 6-13 OrfX (orfX) gene, partial
           cds
          Length = 315

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 35  ccaaaattaaaccacaatc 53
           |||||||||||||||||||
Sbjct: 257 ccaaaattaaaccacaatc 239



to top

>gb|AY751820.1| Staphylococcus aureus strain 9-07 OrfX (orfX) gene, partial cds
          Length = 315

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 35  ccaaaattaaaccacaatcaaca 57
           ||||||| |||||||||||||||
Sbjct: 257 ccaaaatcaaaccacaatcaaca 235



to top

>gb|AE009060.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 86 of
            256 of the complete sequence
          Length = 10483

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 133  cgatgcggtcgagcttgtc 151
            |||||||||||||||||||
Sbjct: 5809 cgatgcggtcgagcttgtc 5791



to top

>gb|DQ106887.1| Staphylococcus aureus strain M03-68 type-IVg SCCmec element, complete
             sequence
          Length = 23157

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 35    ccaaaattaaaccacaatc 53
             |||||||||||||||||||
Sbjct: 22998 ccaaaattaaaccacaatc 22980



to top

>gb|AY267374.1| Staphylococcus aureus strain ATCC BAA-40 orfX gene, partial cds;
           and SCCmec element, partial sequence
          Length = 2122

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 35  ccaaaattaaaccacaatcaaca 57
           ||||||| |||||||||||||||
Sbjct: 169 ccaaaatcaaaccacaatcaaca 191



to top

>gb|AC144401.2| Didelphis virginiana clone LBNL3-270H19, complete sequence
          Length = 180378

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 33    tcccaaaattaaaccacaa 51
             |||||||||||||||||||
Sbjct: 55839 tcccaaaattaaaccacaa 55857



to top

>gb|AC098738.2| Mus musculus BAC clone RP23-122F7 from 8, complete sequence
          Length = 216974

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 37     aaaattaaaccacaatcaa 55
              |||||||||||||||||||
Sbjct: 104280 aaaattaaaccacaatcaa 104262



to top

>emb|AL590405.19| Human DNA sequence from clone RP11-124M24 on chromosome 1 Contains part
             of a novel gene (KIAA1573), complete sequence
          Length = 133791

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 47    cacaatcaacacagagcaaagtg 69
             ||||||||||||||||| |||||
Sbjct: 23229 cacaatcaacacagagccaagtg 23207



to top

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                          
Query: 127     cctggacgatgcggtcgagcttgtccg 153
               ||||| |||||||| ||||||||||||
Sbjct: 3086228 cctgggcgatgcgggcgagcttgtccg 3086202



to top

>emb|AL157396.9| Human DNA sequence from clone RP11-437J2 on chromosome 10 Contains the 3'
              end of the PDE6C gene for phosphodiesterase 6C,
              cGMP-specific, cone, alpha prime (PDEA2), the C10orf4 gene
              for chromosome 10 open reading frame 4 and the 5' end of
              the LGI1 gene for leucine-rich glioma inactivated 1,
              complete sequence
          Length = 128796

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 37     aaaattaaaccacaatcaacaca 59
              |||||||| ||||||||||||||
Sbjct: 114587 aaaattaatccacaatcaacaca 114609



to top

>gb|AF422696.1| Staphylococcus aureus strain HU25 SCCmec type III sequence between
            Tn554 and orfX
          Length = 9515

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 35   ccaaaattaaaccacaatcaaca 57
            ||||||| |||||||||||||||
Sbjct: 9380 ccaaaatcaaaccacaatcaaca 9358



to top

>emb|AL133283.9| Human DNA sequence from clone RP11-31M2 on chromosome 9p23-24.3
             Contains the 5' end of the gene for a novel GLI Kruppel
             family member zinc finger protein (FLJ90578) and two CpG
             islands, complete sequence
          Length = 158602

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 5     aggccatatgctgattcat 23
             |||||||||||||||||||
Sbjct: 24828 aggccatatgctgattcat 24810



to top

>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 117     tgcagcttgtcctggacga 135
               |||||||||||||||||||
Sbjct: 3135391 tgcagcttgtcctggacga 3135409



to top

>dbj|D86934.2| Staphylococcus aureus DNA, resistance island Type-II
             SCCmec(Staphylococcal cassette chromosome mec)
          Length = 58237

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 35    ccaaaattaaaccacaatc 53
             |||||||||||||||||||
Sbjct: 57922 ccaaaattaaaccacaatc 57904



to top

>dbj|AB047239.1| Staphylococcus aureus DNA, complete structure of cassette
            chromosome(SCC)-like element, strain:ATCC25923
          Length = 6987

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 35   ccaaaattaaaccacaatcaaca 57
            ||||||| |||||||||||||||
Sbjct: 6794 ccaaaatcaaaccacaatcaaca 6772



to top

>dbj|AB037671.1| Staphylococcus aureus DNA, type III staphylococcal cassette chromosome
             mec, strain 85/2082
          Length = 68256

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 35    ccaaaattaaaccacaatcaaca 57
             ||||||| |||||||||||||||
Sbjct: 68063 ccaaaatcaaaccacaatcaaca 68041



to top

>gb|AC091563.9| Homo sapiens chromosome 8, clone RP11-760H22, complete sequence
          Length = 204896

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 53    caacacagagcaaagtgga 71
             |||||||||||||||||||
Sbjct: 15943 caacacagagcaaagtgga 15925



to top

>gb|U10927.2| Staphylococcus aureus M type 1 capsular polysaccharide biosynthesis
           gene cluster, complete sequence and unknown genes
          Length = 46392

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 35  ccaaaattaaaccacaatcaaca 57
           ||||||| |||||||||||||||
Sbjct: 305 ccaaaatcaaaccacaatcaaca 327



to top

>dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, complete genome
          Length = 2878529

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 35    ccaaaattaaaccacaatc 53
             |||||||||||||||||||
Sbjct: 33886 ccaaaattaaaccacaatc 33904



to top

>gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome
          Length = 2841581

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 133    cgatgcggtcgagcttgtc 151
              |||||||||||||||||||
Sbjct: 946032 cgatgcggtcgagcttgtc 946014



to top

>gb|AF411934.1| Staphylococcus aureus strain HDG2 genomic sequence downstream of mecA
          Length = 1510

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 35   ccaaaattaaaccacaatcaaca 57
            ||||||| |||||||||||||||
Sbjct: 1375 ccaaaatcaaaccacaatcaaca 1353



to top

>gb|AC158352.5| Mus musculus chromosome 8, clone RP24-325B16, complete sequence
          Length = 166845

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 33     tcccaaaattaaaccacaa 51
              |||||||||||||||||||
Sbjct: 147689 tcccaaaattaaaccacaa 147707



to top

>emb|BX511021.9| Zebrafish DNA sequence from clone DKEY-16P21 in linkage group 3,
             complete sequence
          Length = 235632

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 32    ttcccaaaattaaaccacaatca 54
             ||||||||||||| |||||||||
Sbjct: 10953 ttcccaaaattaatccacaatca 10931



to top

>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 117     tgcagcttgtcctggacga 135
               |||||||||||||||||||
Sbjct: 2287246 tgcagcttgtcctggacga 2287264



to top

>dbj|AB047089.2| Staphylococcus aureus DNA, right extremity of Type-III SCCmec
             (Staphylococcal cassette chromosome mec) and it's flanking
             chromosomal region, strain:85/3907
          Length = 30059

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 35    ccaaaattaaaccacaatcaaca 57
             ||||||| |||||||||||||||
Sbjct: 29863 ccaaaatcaaaccacaatcaaca 29841



to top

>gb|AC138024.2| Homo sapiens chromosome 1 clone RP5-1099E6, complete sequence
          Length = 163815

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 57     acagagcaaagtggaaaag 75
              |||||||||||||||||||
Sbjct: 104605 acagagcaaagtggaaaag 104623



to top

>dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic DNA, complete genome
          Length = 2814816

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 35    ccaaaattaaaccacaatc 53
             |||||||||||||||||||
Sbjct: 33885 ccaaaattaaaccacaatc 33903



to top

>emb|AJ339291.1|HSA339291 Homo sapiens genomic sequence surrounding NotI site, clone
           NL6-AH22R
          Length = 672

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 111 gacccctgcagcttgtcct 129
           |||||||||||||||||||
Sbjct: 447 gacccctgcagcttgtcct 465



to top

>emb|BX571856.1| Staphylococcus aureus subsp. aureus strain MRSA252, complete genome
          Length = 2902619

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 35    ccaaaattaaaccacaatcaaca 57
             ||||||| |||||||||||||||
Sbjct: 33853 ccaaaatcaaaccacaatcaaca 33875



to top

>dbj|AB096217.1| Staphylococcus aureus DNA, typeIVc staphylococcal cassette chromosome
             mec, strain MR108
          Length = 31263

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 35    ccaaaattaaaccacaatcaaca 57
             ||||||| |||||||||||||||
Sbjct: 30836 ccaaaatcaaaccacaatcaaca 30814



to top

>dbj|AP005624.3| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1367F12, complete
             sequence
          Length = 117520

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 53    caacacagagcaaagtgga 71
             |||||||||||||||||||
Sbjct: 40042 caacacagagcaaagtgga 40024



to top

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 117     tgcagcttgtcctggacga 135
               |||||||||||||||||||
Sbjct: 2877916 tgcagcttgtcctggacga 2877934



to top

>dbj|AB038513.1| Staphylococcus aureus DNA, SRImec-III and SCCmec-III region,
             strain:85/2082
          Length = 23752

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 35    ccaaaattaaaccacaatcaaca 57
             ||||||| |||||||||||||||
Sbjct: 23559 ccaaaatcaaaccacaatcaaca 23537



to top

>dbj|AP005717.3| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1471A8, complete
              sequence
          Length = 169835

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 53     caacacagagcaaagtgga 71
              |||||||||||||||||||
Sbjct: 158053 caacacagagcaaagtgga 158035


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,582,492
Number of Sequences: 3902068
Number of extensions: 1582492
Number of successful extensions: 113971
Number of sequences better than 10.0: 58
Number of HSP's better than 10.0 without gapping: 58
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 113666
Number of HSP's gapped (non-prelim): 305
length of query: 160
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 138
effective length of database: 17,147,199,772
effective search space: 2366313568536
effective search space used: 2366313568536
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top