Clone Name	rbart37b10
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrins...	726	0.0
2	gb|BT016583.1| Zea mays clone Contig416 mRNA sequence	335	8e-89
3	gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds	327	2e-86
4	gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein...	319	5e-84
5	gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein...	311	1e-81
6	gb|AY109332.1| Zea mays CL502_5 mRNA sequence	311	1e-81
7	gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, comp...	281	1e-72
8	ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA	274	3e-70
9	ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group...	274	3e-70
10	ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group...	274	3e-70
11	dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clon...	274	3e-70
12	dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clon...	274	3e-70
13	dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clon...	274	3e-70
14	dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clon...	274	3e-70
15	dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clon...	266	6e-68
16	dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA ...	226	5e-56
17	gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein...	224	2e-55
18	gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein...	224	2e-55
19	ref|XM_466869.1| Oryza sativa (japonica cultivar-group), mRNA	212	8e-52
20	dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clon...	212	8e-52
21	gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrins...	196	5e-47
22	gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence	192	8e-46
23	ref|NM_187081.2| Oryza sativa (japonica cultivar-group), mRNA	186	5e-44
24	dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clon...	186	5e-44
25	ref|NM_187084.1| Oryza sativa (japonica cultivar-group), mRNA	178	1e-41
26	ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group...	178	1e-41
27	dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clon...	178	1e-41
28	dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin ...	176	4e-41
29	gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds	172	7e-40
30	gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protei...	172	7e-40
31	emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein	167	4e-38
32	dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin,...	167	4e-38
33	dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd	167	4e-38
34	ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predic...	157	4e-35
35	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	153	6e-34
36	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	153	6e-34
37	dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D...	153	6e-34
38	dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic D...	153	6e-34
39	gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence	151	3e-33
40	gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-...	151	3e-33
41	dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic D...	149	1e-32
42	dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds	149	1e-32
43	gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putat...	145	2e-31
44	gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrin...	145	2e-31
45	ref|XM_475029.1| Oryza sativa (japonica cultivar-group), predic...	143	6e-31
46	dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clon...	143	6e-31
47	dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clon...	143	6e-31
48	dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clon...	143	6e-31
49	dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clon...	143	6e-31
50	gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein...	139	1e-29
51	emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet...	137	4e-29
52	dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon...	137	4e-29
53	dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon...	137	4e-29
54	dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon...	137	4e-29
55	gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ...	137	4e-29
56	dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ...	137	4e-29
57	ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic...	135	2e-28
58	emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for p...	135	2e-28
59	gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putat...	135	2e-28
60	dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon...	135	2e-28
61	dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon...	135	2e-28
62	dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon...	135	2e-28
63	dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon...	135	2e-28
64	gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein...	131	2e-27
65	gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein...	131	2e-27
66	gb|AY103580.1| Zea mays PCO072544 mRNA sequence	131	2e-27
67	gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds	129	9e-27
68	gb|AY107589.1| Zea mays PCO085320 mRNA sequence	129	9e-27
69	emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein	127	4e-26
70	emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4,...	127	4e-26
71	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	127	4e-26
72	gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1)...	127	4e-26
73	dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds	127	4e-26
74	ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative...	125	1e-25
75	dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clon...	125	1e-25
76	gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein...	121	2e-24
77	dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D...	117	4e-23
78	dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic D...	117	4e-23
79	gb|AY170841.1| Axonopus compressus plasma membrane MIP protein m...	115	1e-22
80	gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putat...	113	6e-22
81	gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasm...	113	6e-22
82	emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4,...	113	6e-22
83	gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, comple...	111	2e-21
84	gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds	111	2e-21
85	gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water chann...	111	2e-21
86	gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com...	111	2e-21
87	emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,...	109	9e-21
88	gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, c...	109	9e-21
89	gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence	107	3e-20
90	gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN...	107	3e-20
91	ref|XM_468463.1| Oryza sativa (japonica cultivar-group), mRNA	105	1e-19
92	emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for p...	105	1e-19
93	gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 geno...	105	1e-19
94	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	105	1e-19
95	dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic D...	105	1e-19
96	dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clon...	105	1e-19
97	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	105	1e-19
98	gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, co...	105	1e-19
99	emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for p...	101	2e-18
100	gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds	101	2e-18
101	gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel...	101	2e-18
102	gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA	101	2e-18
103	dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membran...	101	2e-18
104	emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for p...	100	8e-18
105	emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Co...	100	8e-18
106	gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein ...	100	8e-18
107	gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (...	98	3e-17
108	gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds	98	3e-17
109	gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, c...	98	3e-17
110	gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma...	98	3e-17
111	gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putat...	96	1e-16
112	gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds	96	1e-16
113	emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major ...	94	5e-16
114	dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membra...	94	5e-16
115	dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane ...	94	5e-16
116	dbj|AB002149.1| Nicotiana excelsior mRNA for water channel prote...	94	5e-16
117	dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membran...	94	5e-16
118	ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channe...	92	2e-15
119	gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic pr...	92	2e-15
120	gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp...	92	2e-15
121	gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp...	92	2e-15
122	gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp...	92	2e-15
123	emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Co...	92	2e-15
124	emb|AJ249384.1|SOL249384 Spinacia oleracea mRNA for PM28B protei...	88	3e-14
125	gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds	88	3e-14
126	emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intri...	88	3e-14
127	dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D...	88	3e-14
128	gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein...	88	3e-14
129	dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic D...	88	3e-14
130	dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clon...	88	3e-14
131	dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clon...	88	3e-14
132	dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clon...	88	3e-14
133	dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clon...	88	3e-14
134	gb|AY107675.1| Zea mays PCO112712 mRNA sequence	88	3e-14
135	dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic D...	88	3e-14
136	gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic pr...	86	1e-13
137	gb|AY671950.1| Aegiceras corniculatum aquaporin 2 (PIP2) mRNA, c...	86	1e-13
138	dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membra...	86	1e-13
139	gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic pr...	86	1e-13
140	dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane ...	86	1e-13
141	emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for p...	84	5e-13
142	emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides m...	84	5e-13
143	dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3...	84	5e-13
144	ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channe...	82	2e-12
145	gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (...	82	2e-12
146	gb|AY081593.1| Arabidopsis thaliana water channel-like protein (...	82	2e-12
147	gb|AY059948.1| Arabidopsis thaliana water channel - like protein...	82	2e-12
148	emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Co...	82	2e-12
149	emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Co...	82	2e-12
150	emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Co...	82	2e-12
151	emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Co...	82	2e-12
152	gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete se...	82	2e-12
153	dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds	82	2e-12
154	ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G3...	80	8e-12
155	emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Co...	80	8e-12
156	emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Co...	80	8e-12
157	emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Co...	80	8e-12
158	emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Co...	80	8e-12
159	emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Co...	80	8e-12
160	emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Co...	80	8e-12
161	emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Co...	80	8e-12
162	gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete s...	80	8e-12
163	gb|AY333929.1| Pringlea antiscorbutica putative transmembrane pr...	78	3e-11
164	emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrins...	78	3e-11
165	gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, ...	78	3e-11
166	gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, c...	78	3e-11
167	gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, com...	78	3e-11
168	gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mip...	78	3e-11
169	emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic...	76	1e-10
170	emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for p...	76	1e-10
171	dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - li...	76	1e-10
172	dbj|AB206101.1| Mimosa pudica pip2;3 mRNA for plasma membrane in...	76	1e-10
173	dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membran...	76	1e-10
174	emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein	74	5e-10
175	gb|AF452014.1|AF452014 Petunia x hybrida aquaporin-like protein ...	74	5e-10
176	gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, co...	74	5e-10
177	ref|NM_202760.1| Arabidopsis thaliana TMP-C AT4G00430 (TMP-C) tr...	72	2e-09
178	ref|NM_116268.2| Arabidopsis thaliana TMP-C; water channel AT4G0...	72	2e-09
179	ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37...	72	2e-09
180	gb|BT000330.1| Arabidopsis thaliana probable plasma membrane int...	72	2e-09
181	emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel...	72	2e-09
182	gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (...	72	2e-09
183	emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrins...	72	2e-09
184	gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma m...	72	2e-09
185	emb|AJ001293.1|CPPIPB Craterostigma plantagineum mRNA for major ...	72	2e-09
186	gb|AY120785.1| Arabidopsis thaliana probable plasma membrane int...	72	2e-09
187	gb|AY099825.1| Arabidopsis thaliana probable plasma membrane int...	72	2e-09
188	dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds	72	2e-09
189	gb|BT006313.1| Arabidopsis thaliana At4g00430 mRNA, complete cds	72	2e-09
190	emb|BX827573.1|CNS0A3MW Arabidopsis thaliana Full-length cDNA Co...	72	2e-09
191	emb|BX829233.1|CNS0A3FQ Arabidopsis thaliana Full-length cDNA Co...	72	2e-09
192	dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane in...	72	2e-09
193	gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete s...	72	2e-09
194	dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative tran...	72	2e-09
195	dbj|D85192.1| Arabidopsis thaliana mRNA for transmembrane protei...	72	2e-09
196	dbj|D26609.1|ATHTMP Arabidopsis thaliana mRNA for transmembrane ...	72	2e-09
197	gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel prot...	72	2e-09
198	ref|NM_115202.1| Arabidopsis thaliana PIP2A; water channel AT3G5...	70	7e-09
199	ref|NM_001035774.1| Arabidopsis thaliana PIP2A AT3G53420 (PIP2A)...	70	7e-09
200	gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence	70	7e-09
201	emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel...	70	7e-09
202	emb|X75883.1|ATPIP2A A.thaliana mRNA for plasma membrane intrins...	70	7e-09
203	emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening memb...	70	7e-09
204	emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening memb...	70	7e-09
205	emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for p...	70	7e-09
206	emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp...	70	7e-09
207	gb|AY072374.1| Arabidopsis thaliana plasma membrane intrinsic pr...	70	7e-09
208	gb|AF428426.1|AF428426 Arabidopsis thaliana AT3g53420/F4P12_120 ...	70	7e-09
209	gb|AY056085.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, co...	70	7e-09
210	gb|AY044327.1| Arabidopsis thaliana plasma membrane intrinsic pr...	70	7e-09
211	gb|AY039579.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, co...	70	7e-09
212	emb|BX824659.1|CNS0A6W2 Arabidopsis thaliana Full-length cDNA Co...	70	7e-09
213	emb|BX824010.1|CNS0A6YX Arabidopsis thaliana Full-length cDNA Co...	70	7e-09
214	emb|BX823952.1|CNS0A4TL Arabidopsis thaliana Full-length cDNA Co...	70	7e-09
215	emb|BX842136.1|CNS09YDO Arabidopsis thaliana Full-length cDNA Co...	70	7e-09
216	gb|AY087854.1| Arabidopsis thaliana clone 38965 mRNA, complete s...	70	7e-09
217	gb|AC006260.4| Arabidopsis thaliana chromosome 2 clone T2N18 map...	68	3e-08
218	gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel...	68	3e-08
219	gb|U27347.1|GMU27347 Glycine max putative water channel protein ...	68	3e-08
220	gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrins...	68	3e-08
221	dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane ...	68	3e-08
222	ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channe...	66	1e-07
223	gb|BT013307.1| Lycopersicon esculentum clone 134975R, mRNA sequence	66	1e-07
224	gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, ...	66	1e-07
225	gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic pro...	66	1e-07
226	gb|AF290620.1|AF290620 Nicotiana glauca putative PIP2 (MIP4) mRN...	66	1e-07
227	gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, ...	66	1e-07
228	gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete s...	66	1e-07
229	emb|AL132966.1|ATF4P12 Arabidopsis thaliana DNA chromosome 3, BA...	66	1e-07
230	gb|DQ228343.1| Solanum tuberosum clone 148A12 unknown mRNA	64	5e-07
231	gb|AY663794.1| Fraxinus excelsior plasma membrane intrinsic prot...	64	5e-07
232	emb|AL161471.2|ATCHRIV1 Arabidopsis thaliana DNA chromosome 4, c...	64	5e-07
233	emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative pl...	64	5e-07
234	emb|AJ289695.1|POC289695 Posidonia oceanica partial aq2 gene for...	64	5e-07
235	gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic prot...	64	5e-07
236	emb|AJ605568.1| Ricinus communis partial mRNA for putative aquap...	64	5e-07
237	gb|AF195115.1|F5I10 Arabidopsis thaliana BAC F5I10	64	5e-07
238	gb|AF013293.1|IG005I10 Arabidopsis thaliana BAC IG005I10	64	5e-07
239	ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G0...	62	2e-06
240	emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B	62	2e-06
241	gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative pl...	62	2e-06
242	emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Co...	62	2e-06
243	gb|AF118383.1|AF118383 Brassica napus plasma membrane intrinsic ...	62	2e-06
244	gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, co...	62	2e-06
245	gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, com...	62	2e-06
246	dbj|AB012045.1| Raphanus sativus mRNA for Plasma membrane aquapo...	62	2e-06
247	ref|NM_116008.2| Arabidopsis thaliana PIP1A; water channel AT3G6...	60	7e-06
248	gb|DQ451602.1| Salicornia bigelovii plasma membrane major intrin...	60	7e-06
249	emb|AJ289701.1|VFA289701 Vicia faba mRNA for aquaporin (aq1 gene)	60	7e-06
250	gb|AF367458.1| Prunus persica clone Mip2 membrane intrinsic prot...	60	7e-06
251	gb|AY097398.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, com...	60	7e-06
252	gb|AY058113.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, com...	60	7e-06
253	emb|BX823595.1|CNS0A5AA Arabidopsis thaliana Full-length cDNA Co...	60	7e-06
254	gb|AY088439.1| Arabidopsis thaliana clone 6690 mRNA, complete se...	60	7e-06
255	gb|AF266760.1|AF266760 Vicia faba plasma membrane aquaporin mRNA...	60	7e-06
256	ref|XM_470514.1| Oryza sativa (japonica cultivar-group), mRNA	58	3e-05
257	gb|DQ226558.1| Boechera divaricarpa isolate SLW-1-E08 mRNA sequence	58	3e-05
258	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	58	3e-05
259	emb|AJ001416.1|NTAQUAPOR Nicotiana tabacum mRNA for aquaporin 1	58	3e-05
260	gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genom...	58	3e-05
261	emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, ...	58	3e-05
262	emb|AL132962.1|ATF2A19 Arabidopsis thaliana DNA chromosome 3, BA...	58	3e-05
263	emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, B...	58	3e-05
264	emb|AJ849324.1| Populus tremula x Populus tremuloides mRNA for p...	58	3e-05
265	gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map ...	58	3e-05
266	gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putat...	58	3e-05
267	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	58	3e-05
268	dbj|AB206100.1| Mimosa pudica pip2;2 mRNA for plasma membrane in...	58	3e-05
269	gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma...	58	3e-05
270	dbj|AB005246.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	58	3e-05
271	dbj|AK109024.1| Oryza sativa (japonica cultivar-group) cDNA clon...	58	3e-05
272	gb|AF024511.1|AF024511 Nicotiana tabacum aquaporin 1 mRNA, compl...	58	3e-05
273	dbj|AP004484.1| Lotus japonicus genomic DNA, chromosome 1, clone...	58	3e-05
274	gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker	56	1e-04
275	gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker	56	1e-04
276	emb|BX824874.1|CNS0A5T5 Arabidopsis thaliana Full-length cDNA Co...	56	1e-04
277	emb|AJ605575.1| Ricinus communis mRNA for aquaporin (Pip2-1 gene...	56	1e-04
278	dbj|AB091106.2| Lilium longiflorum PIP1 mRNA for plasma membrane...	56	1e-04
279	emb|AJ699398.2| Chenopodium rubrum mRNA for aquaporin PIP1 (PIP1...	56	1e-04
280	gb|AF004293.1|AF004293 Brassica rapa aquaporin (MOD) mRNA, compl...	56	1e-04
281	gb|L36095.1|CIPMIPA Mesembryanthemum crystallinum mipA mRNA, com...	56	1e-04
282	gb|AY961922.1| Picea abies probable aquaporin (Aqp) mRNA, partia...	54	4e-04
283	emb|AJ222973.1|LAAJ2973 Lupinus albus mRNA for aquaporin, partial	54	4e-04
284	gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic pr...	54	4e-04
285	gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, ...	54	4e-04
286	gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic pr...	54	4e-04
287	gb|U97023.1|PVU97023 Phaseolus vulgaris putative aquaporin-1 (Mi...	54	4e-04
288	dbj|AB002148.1| Nicotiana excelsior mRNA for water channel prote...	54	4e-04
289	emb|X75881.1|ATPIP1A A.thaliana mRNA for plasma membrane intrins...	52	0.002
290	gb|U56603.1|BMU56603 Bufo marinus vasopressin-insensitive water ...	52	0.002
291	gb|AY995195.1| Phaseolus vulgaris putative aquaporin (PIP2;1) mR...	52	0.002
292	dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane in...	52	0.002
293	gb|AF020620.1| Bufo marinus aquaporin-1 homolog (AQP-t1) mRNA, c...	52	0.002
294	ref|NM_115339.2| Arabidopsis thaliana PIP2;5/PIP2D; water channe...	50	0.007
295	gb|DQ018114.1| Physcomitrella patens plasma membrane aquaporin (...	50	0.007
296	gb|AF499725.1| Thellungiella halophila plasma membrane intrinsic...	50	0.007
297	gb|DQ450066.1| Arachis hypogaea clone 10A4R1GZ putative aquapori...	50	0.007
298	gb|AY189973.1| Juglans regia plasma intrinsic protein 2,1 mRNA, ...	50	0.007
299	gb|BT000670.1| Arabidopsis thaliana clone RAFL07-09-N03 (R10758)...	50	0.007
300	gb|AY062981.1| Arabidopsis thaliana putative aquaporin/MIP prote...	50	0.007
301	gb|AF370351.1| Arabidopsis thaliana putative aquaporin/MIP prote...	50	0.007
302	emb|AJ001292.1|CPPIPA2 Craterostigma plantagineum mRNA for major...	50	0.007
303	emb|BX822631.1|CNS0A61A Arabidopsis thaliana Full-length cDNA Co...	50	0.007
304	gb|AY084843.1| Arabidopsis thaliana clone 11929 mRNA, complete s...	50	0.007
305	emb|AJ605574.1| Ricinus communis mRNA for aquaporin (Pip1-1 gene...	50	0.007
306	emb|AJ605565.1| Ricinus communis partial mRNA for putative aquap...	50	0.007
307	gb|U60147.1|BVU60147 Beta vulgaris plasma membrane major intrins...	50	0.007
308	emb|Z93764.1|PAZ93764 P.abies mRNA for membrane intrinsic protein	48	0.027
309	gb|AF452010.1|AF452010 Petunia x hybrida channel-like protein (P...	48	0.027
310	emb|BX824209.1|CNS0A5OV Arabidopsis thaliana Full-length cDNA Co...	48	0.027
311	gb|AC061957.3|F22L4 Sequence of BAC F22L4 from Arabidopsis thali...	48	0.027
312	gb|AF255796.1|AF255796 Allium cepa aquaporin 2 (Aqp2) mRNA, comp...	48	0.027
313	gb|AF255795.1|AF255795 Allium cepa aquaporin 1 (Aqp1) mRNA, comp...	48	0.027
314	emb|AJ605569.1| Ricinus communis partial mRNA for putative aquap...	48	0.027
315	gb|AF118382.1|AF118382 Brassica napus plasma membrane intrinsic ...	48	0.027
316	gb|L77969.2|SPIAQUA Spinacia oleracea aquaporin mRNA, complete cds	48	0.027
317	ref|NM_119676.2| Arabidopsis thaliana PIP3 (PLASMA MEMBRANE INTR...	46	0.11
318	ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G4...	46	0.11
319	gb|AY781788.1| Glycyrrhiza uralensis plasma membrane intrinsic p...	46	0.11
320	gb|DQ226873.1| Boechera divaricarpa isolate SLW-C-G04 mRNA sequence	46	0.11
321	emb|Z83830.1|PAMIP1 P.abies mRNA for porin Mip1	46	0.11
322	emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein	46	0.11
323	emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic...	46	0.11
324	gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (...	46	0.11
325	emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A	46	0.11
326	gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma m...	46	0.11
327	gb|AY081580.1| Arabidopsis thaliana plasma membrane intrinsic pr...	46	0.11
328	gb|AY062803.1| Arabidopsis thaliana plasma membrane intrinsic pr...	46	0.11
329	gb|AF412110.1|AF412110 Arabidopsis thaliana AT4g35100/M4E13_150 ...	46	0.11
330	gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205),...	46	0.11
331	gb|AF003728.1|AF003728 Arabidopsis thaliana plasma membrane intr...	46	0.11
332	emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Co...	46	0.11
333	emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Co...	46	0.11
334	emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Co...	46	0.11
335	emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Co...	46	0.11
336	emb|BX826680.1|CNS0A37C Arabidopsis thaliana Full-length cDNA Co...	46	0.11
337	emb|BX826294.1|CNS0A39S Arabidopsis thaliana Full-length cDNA Co...	46	0.11
338	emb|BX827919.1|CNS0A2ZT Arabidopsis thaliana Full-length cDNA Co...	46	0.11
339	emb|BX827124.1|CNS0A2UI Arabidopsis thaliana Full-length cDNA Co...	46	0.11
340	dbj|AB206099.1| Mimosa pudica pip2;1 mRNA for plasma membrane in...	46	0.11
341	gb|AY088485.1| Arabidopsis thaliana clone 7108 mRNA, complete se...	46	0.11
342	gb|AY084470.1| Arabidopsis thaliana clone 108944 mRNA, complete ...	46	0.11
343	gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, comp...	46	0.11
344	dbj|D85193.1| Arabidopsis thaliana mRNA, partial cds	46	0.11
345	emb|AJ457188.2|PEU457188 Populus euramericana partial mRNA for p...	46	0.11
346	gb|AF051202.1|AF051202 Picea mariana probable aquaporin (Sb01) m...	46	0.11
347	gb|U78297.1|ATU78297 Arabidopsis thaliana plasma membrane intrin...	46	0.11
348	gb|AY961920.1| Picea abies probable aquaporin (Aqp) mRNA, comple...	44	0.43
349	emb|AJ515031.1|CAR515031 Cicer arietinum partial mRNA for aquopo...	44	0.43
350	emb|AJ005869.1|CAR005869 Cicer arietinum mRNA for putative trans...	44	0.43
351	gb|U22658.1|BMU22658 Bufo marinus urinary bladder aquaporin mRNA...	44	0.43
352	gb|AF386739.1|AF386739 Medicago truncatula aquaporin protein PIP...	44	0.43
353	gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp...	42	1.7
354	gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com...	42	1.7
355	gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome	42	1.7
356	ref|NM_001005829.1| Xenopus tropicalis aquaporin 1 (channel-form...	42	1.7
357	emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos...	42	1.7
358	emb|AJ243307.1|PSA243307 Pisum sativum mRNA for putative plasma ...	42	1.7
359	gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map...	42	1.7
360	gb|DQ354110.1| Streptomyces violaceusniger strain DSM 4137 polye...	42	1.7
361	gb|AF218774.1|AF218774 Lycopersicon esculentum putative water ch...	42	1.7
362	dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co...	42	1.7
363	gb|AF154641.1| Nicotiana tabacum clone PR16 mRNA sequence	42	1.7
364	gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome	42	1.7
365	emb|Z17399.1|ATORFB Arabidopsis thaliana PIP1b gene	42	1.7
366	gb|BC075384.1| Xenopus tropicalis aquaporin 1 (channel-forming i...	42	1.7
367	gb|BC084131.1| Xenopus laevis hypothetical LOC495037, mRNA (cDNA...	42	1.7
368	gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com...	42	1.7
369	gb|U26537.1|MCU26537 Mesembryanthemum crystallinum major intrins...	42	1.7
370	dbj|AB002147.1| Nicotiana excelsior mRNA for water channel prote...	42	1.7
371	gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome	40	6.7
372	gb|AY494191.1| Physcomitrella patens plasma membrane aquaporin (...	40	6.7
373	gb|AE014075.1| Escherichia coli CFT073, complete genome	40	6.7
374	gb|CP000272.1| Burkholderia xenovorans LB400 chromosome 3, compl...	40	6.7
375	emb|AL138650.1|ATT5N23 Arabidopsis thaliana DNA chromosome 3, BA...	40	6.7
376	emb|AL049655.2|ATF28P10 Arabidopsis thaliana DNA chromosome 3, B...	40	6.7
377	emb|AL596209.13| Mouse DNA sequence from clone RP23-278F12 on ch...	40	6.7
378	gb|AC083943.8| Genomic sequence for Oryza sativa, Nipponbare str...	40	6.7
379	gb|AF452013.1|AF452013 Petunia x hybrida aquaporin-like protein ...	40	6.7
380	gb|AY059380.1| Medicago truncatula aquaporin (PIP2-1) mRNA, comp...	40	6.7
381	dbj|AK220982.1| Arabidopsis thaliana mRNA for plasma membrane in...	40	6.7
382	gb|AC153905.5| Mus musculus 6 BAC RP23-215A7 (Roswell Park Cance...	40	6.7
383	gb|AF487998.1| Saccharopolyspora erythraea NRRL 2338 eryCI flank...	40	6.7
384	dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome	40	6.7
385	emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp...	40	6.7
386	emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple...	40	6.7
387	emb|AJ875019.1| Streptoalloteichus hindustanus partial apramycin...	40	6.7
388	gb|AC153601.6| Mus musculus 6 BAC RP23-405O6 (Roswell Park Cance...	40	6.7
389	dbj|AB012044.1| Raphanus sativus mRNA for plasma membrane aquapo...	40	6.7

---

>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
            complete cds
          Length = 1283

 Score =  726 bits (366), Expect = 0.0
 Identities = 466/494 (94%), Gaps = 9/494 (1%)
 Strand = Plus / Minus

                                                                        
Query: 6    aggaaaaggaatgcgggctaattaagacaagcgatcccatggaccgaattacaacacacg 65
            |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 1189 aggaaaagcaatgcgggctaattaagacaagcgatcccatggaccgaattacaagacacg 1130

                                                                        
Query: 66   gcacgcatgactgggc-acatac---gcatatgcagctgccgacacataaataacacgac 121
            ||||||||||| || | || |||   |||||||||||||||||||||||| |||||||||
Sbjct: 1129 gcacgcatgaccggaccacgtactacgcatatgcagctgccgacacataa-taacacgac 1071

                                                                        
Query: 122  cattgcagcggcc-aactgaactgtcgagaagttgcaaaagcggctttctctttggatgg 180
            |||||| |||||| |||||||||||||||||||||||||||||  ||||||| |||||||
Sbjct: 1070 cattgcggcggccgaactgaactgtcgagaagttgcaaaagcgcatttctctctggatgg 1011

                                                                        
Query: 181  atggacacagcacaggtcgccattgcttcaatcttgcatgcacatcacatggat---aac 237
            ||||||||| ||| |||||||||||||||| |||||||| || || ||||||||   |||
Sbjct: 1010 atggacacaacacgggtcgccattgcttcagtcttgcatacagatgacatggatgataac 951

                                                                        
Query: 238  tcgttacgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgta 297
            | |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 950  ttgttacgcgttgctcctgaaggagccgagggccttgatggcgccggccctgaggatgta 891

                                                                        
Query: 298  ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 890  ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 831

                                                                        
Query: 358  atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 830  atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctccgggccgggtt 771

                                                                        
Query: 418  gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 477
            |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 770  gatgccggtgccggtgatggggatggtggccaggtggaccatgaacacggcgaagccgat 711

                          
Query: 478  cgggaggggcgcca 491
            ||||||||||||||
Sbjct: 710  cgggaggggcgcca 697

---

>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence
          Length = 1348

 Score =  335 bits (169), Expect = 8e-89
 Identities = 229/249 (91%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||
Sbjct: 924 acgcgttgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggt 865

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           |||||||||||||||| || ||||| |  | |||||| |||||||||||||| || || |
Sbjct: 864 ggtagaaggccgcgatggcagcgcccacgagggggcccacccagaagatccagtggtcgt 805

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
           |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 804 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 745

                                                                       
Query: 423 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 482
           ||||||||||||  ||||||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 744 cggtgccggtgacggggatggtggccaggtgcaccatgaacacggcgaagccgatgggga 685

                    
Query: 483 ggggcgcca 491
           |||| ||||
Sbjct: 684 ggggagcca 676

---

>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds
          Length = 1133

 Score =  327 bits (165), Expect = 2e-86
 Identities = 228/249 (91%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||
Sbjct: 872 acgcgttgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggt 813

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           |||||||||||||||| || ||||| |  |  ||||| |||||||||||||| || || |
Sbjct: 812 ggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatccagtggtcgt 753

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
           |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 752 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 693

                                                                       
Query: 423 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 482
           ||||||||||||  ||||||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 692 cggtgccggtgacggggatggtggccaggtgcaccatgaacacggcgaagccgatgggga 633

                    
Query: 483 ggggcgcca 491
           |||| ||||
Sbjct: 632 ggggagcca 624

---

>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete
           cds
          Length = 1171

 Score =  319 bits (161), Expect = 5e-84
 Identities = 227/249 (91%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           ||||||||||||||||||||||||||||||||||||| || |||| ||| ||||||||||
Sbjct: 943 acgcgttgctcctgaaggagccgagggccttgatggccccagcccggaggatgtactggt 884

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           |||||||||||||||| || ||||| |  |  ||||| |||||||||||||| || || |
Sbjct: 883 ggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatccagtggtcgt 824

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
           |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 823 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 764

                                                                       
Query: 423 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 482
           ||||||||||||  ||||||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 763 cggtgccggtgacggggatggtggccaggtgcaccatgaacacggcgaagccgatgggga 704

                    
Query: 483 ggggcgcca 491
           |||| ||||
Sbjct: 703 ggggagcca 695

---

>gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein ZmPIP2-2 mRNA, complete
           cds
          Length = 1268

 Score =  311 bits (157), Expect = 1e-81
 Identities = 226/249 (90%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           ||||||||||||||||||||||||| |||||||||||||| |||| ||| ||||||||||
Sbjct: 996 acgcgttgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggt 937

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           |||||||||||||||| || ||||| |  |  ||||| |||||||| ||||| || ||||
Sbjct: 936 ggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatccagtggtcat 877

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
           |||| | ||||||||||||||||| ||||||||| |||||||||||||||||||||||||
Sbjct: 876 cccatggcttgtccttgttgtagacgacggcggcgcccaggctcctggccgggttgatgc 817

                                                                       
Query: 423 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 482
           ||||||||||||  ||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 816 cggtgccggtgacggggatggtggccaggtggaccatgaacacggcgaagccgatgggga 757

                    
Query: 483 ggggcgcca 491
           |||| ||||
Sbjct: 756 ggggagcca 748

---

>gb|AY109332.1| Zea mays CL502_5 mRNA sequence
          Length = 1969

 Score =  311 bits (157), Expect = 1e-81
 Identities = 226/249 (90%)
 Strand = Plus / Minus

                                                                        
Query: 243  acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
            ||||||||||||||||||||||||| |||||||||||||| |||| ||| ||||||||||
Sbjct: 1646 acgcgttgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggt 1587

                                                                        
Query: 303  ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
            |||||||||||||||| || ||||| |  |  ||||| |||||||| ||||| || ||||
Sbjct: 1586 ggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatccagtggtcat 1527

                                                                        
Query: 363  cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            |||| | ||||||||||||||||| ||||||||| |||||||||||||||||||||||||
Sbjct: 1526 cccatggcttgtccttgttgtagacgacggcggcgcccaggctcctggccgggttgatgc 1467

                                                                        
Query: 423  cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 482
            ||||||||||||  ||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 1466 cggtgccggtgacggggatggtggccaggtggaccatgaacacggcgaagccgatgggga 1407

                     
Query: 483  ggggcgcca 491
            |||| ||||
Sbjct: 1406 ggggagcca 1398



 Score =  224 bits (113), Expect = 2e-55
 Identities = 179/201 (89%)
 Strand = Plus / Minus

                                                                       
Query: 295 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 354
           |||||||||||||  ||| ||||| || ||||||||||  ||||| ||||||||||||||
Sbjct: 321 gtactggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatcca 262

                                                                       
Query: 355 ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 414
            || || ||||||||||||||||||||||||||||| ||||| |||| |||||| |||||
Sbjct: 261 ttggtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgg 202

                                                                       
Query: 415 gttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagcc 474
           ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| ||
Sbjct: 201 gttgatgccggtgccggtgatggggatggtggccaggtgcaccatgaacacggcgaaccc 142

                                
Query: 475 gatcgggaggggcgccaacac 495
            ||||| || || ||||||||
Sbjct: 141 aatcggaagaggggccaacac 121

---

>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score =  281 bits (142), Expect = 1e-72
 Identities = 223/250 (89%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||
Sbjct: 968 acgcgttgctcctgaaggagccgagggccttgatggcgccggcccggaggatgtactggt 909

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 908 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 849

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 848 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 789

                                                                       
Query: 423 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 482
           ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || |
Sbjct: 788 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 729

                     
Query: 483 ggggcgccaa 492
           | ||||||||
Sbjct: 728 gcggcgccaa 719

---

>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score =  274 bits (138), Expect = 3e-70
 Identities = 222/250 (88%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799

                                                                       
Query: 423 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 482
           ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || |
Sbjct: 798 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 739

                     
Query: 483 ggggcgccaa 492
           | ||||||||
Sbjct: 738 gcggcgccaa 729

---

>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score =  274 bits (138), Expect = 3e-70
 Identities = 222/250 (88%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 980 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 921

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 920 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 860 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 801

                                                                       
Query: 423 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 482
           ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || |
Sbjct: 800 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 741

                     
Query: 483 ggggcgccaa 492
           | ||||||||
Sbjct: 740 gcggcgccaa 731

---

>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score =  274 bits (138), Expect = 3e-70
 Identities = 222/250 (88%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 922

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 921 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 861 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 802

                                                                       
Query: 423 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 482
           ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || |
Sbjct: 801 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 742

                     
Query: 483 ggggcgccaa 492
           | ||||||||
Sbjct: 741 gcggcgccaa 732

---

>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score =  274 bits (138), Expect = 3e-70
 Identities = 222/250 (88%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799

                                                                       
Query: 423 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 482
           ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || |
Sbjct: 798 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 739

                     
Query: 483 ggggcgccaa 492
           | ||||||||
Sbjct: 738 gcggcgccaa 729

---

>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full
           insert sequence
          Length = 1451

 Score =  274 bits (138), Expect = 3e-70
 Identities = 222/250 (88%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 572 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 513

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 512 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 453

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 452 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 393

                                                                       
Query: 423 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 482
           ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || |
Sbjct: 392 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 333

                     
Query: 483 ggggcgccaa 492
           | ||||||||
Sbjct: 332 gcggcgccaa 323

---

>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score =  274 bits (138), Expect = 3e-70
 Identities = 222/250 (88%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799

                                                                       
Query: 423 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 482
           ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || |
Sbjct: 798 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 739

                     
Query: 483 ggggcgccaa 492
           | ||||||||
Sbjct: 738 gcggcgccaa 729

---

>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score =  274 bits (138), Expect = 3e-70
 Identities = 222/250 (88%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 922

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 921 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 861 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 802

                                                                       
Query: 423 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 482
           ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || |
Sbjct: 801 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 742

                     
Query: 483 ggggcgccaa 492
           | ||||||||
Sbjct: 741 gcggcgccaa 732

---

>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score =  266 bits (134), Expect = 6e-68
 Identities = 221/250 (88%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           ||||||||||||||| |||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 980 acgcgttgctcctgagggagccgagggctttgatggcgccggcccggaggatgtactggt 921

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 920 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 860 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 801

                                                                       
Query: 423 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 482
           ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || |
Sbjct: 800 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 741

                     
Query: 483 ggggcgccaa 492
           | ||||||||
Sbjct: 740 gcggcgccaa 731

---

>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel
           protein, partial cds
          Length = 880

 Score =  226 bits (114), Expect = 5e-56
 Identities = 216/250 (86%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||||||||||| |||||||| ||| ||||||||||
Sbjct: 544 acgcgttgctcctgaaggagccgagggccttgatggggccggcccggaggatgtactggt 485

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 484 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccattggttgt 425

                                                                       
Query: 363 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 422
            ||||||||| || |||||| |||||||||| |  ||   | ||||||||||||||||||
Sbjct: 424 gccaggccttctcgttgttgaagatgacggccggtccggtggtcctggccgggttgatgc 365

                                                                       
Query: 423 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 482
           ||||||||||||||||||| || ||||| ||||||||||||   ||||||||||| || |
Sbjct: 364 cggtgccggtgatcgggatcgtcgccagttggaccatgaaccacgcgaagccgattggca 305

                     
Query: 483 ggggcgccaa 492
           | ||||||||
Sbjct: 304 gcggcgccaa 295

---

>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete
           cds
          Length = 1171

 Score =  224 bits (113), Expect = 2e-55
 Identities = 179/201 (89%)
 Strand = Plus / Minus

                                                                       
Query: 271 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 330
           |||| |||||| |||||| || | |||||||||||||  ||| ||||| || ||||| ||
Sbjct: 927 cttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccaat 868

                                                                       
Query: 331 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 390
           ||  ||||| |||||||||||||| || || |||||||||||||||||||||||||||||
Sbjct: 867 cagtgggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgac 808

                                                                       
Query: 391 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 450
            ||||| ||||||||||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 807 cgcggctcccaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccag 748

                                
Query: 451 gtggaccatgaacacggcgaa 471
           ||| |||||||||||||||||
Sbjct: 747 gtgcaccatgaacacggcgaa 727

---

>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete
           cds
          Length = 1156

 Score =  224 bits (113), Expect = 2e-55
 Identities = 179/201 (89%)
 Strand = Plus / Minus

                                                                       
Query: 295 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 354
           |||||||||||||  ||| ||||| || ||||||||||  ||||| ||||||||||||||
Sbjct: 893 gtactggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatcca 834

                                                                       
Query: 355 ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 414
            || || ||||||||||||||||||||||||||||| ||||| |||| |||||| |||||
Sbjct: 833 ttggtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgg 774

                                                                       
Query: 415 gttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagcc 474
           ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| ||
Sbjct: 773 gttgatgccggtgccggtgatggggatggtggccaggtgcaccatgaacacggcgaaccc 714

                                
Query: 475 gatcgggaggggcgccaacac 495
            ||||| || || ||||||||
Sbjct: 713 aatcggaagaggggccaacac 693

---

>ref|XM_466869.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1214

 Score =  212 bits (107), Expect = 8e-52
 Identities = 191/219 (87%)
 Strand = Plus / Minus

                                                                       
Query: 277 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
           ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 901 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 842

                                                                       
Query: 337 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 396
           ||| |||||||||||||| || ||||||||||||||||||||||||||||| || |||| 
Sbjct: 841 gcccacccagaagatccattggtcatcccaggccttgtccttgttgtagataaccgcggt 782

                                                                       
Query: 397 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 456
            |||| |||||| |||||||| ||||||||||||||||| |||||||||||||| |||||
Sbjct: 781 tcccaagctcctcgccgggttaatgccggtgccggtgatggggatggtggccagatggac 722

                                                  
Query: 457 catgaacacggcgaagccgatcgggaggggcgccaacac 495
           ||||||||| ||||| || || ||||| || ||||||||
Sbjct: 721 catgaacaccgcgaatccaattgggagaggagccaacac 683

---

>dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E03, full
           insert sequence
          Length = 1214

 Score =  212 bits (107), Expect = 8e-52
 Identities = 191/219 (87%)
 Strand = Plus / Minus

                                                                       
Query: 277 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
           ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 901 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 842

                                                                       
Query: 337 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 396
           ||| |||||||||||||| || ||||||||||||||||||||||||||||| || |||| 
Sbjct: 841 gcccacccagaagatccattggtcatcccaggccttgtccttgttgtagataaccgcggt 782

                                                                       
Query: 397 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 456
            |||| |||||| |||||||| ||||||||||||||||| |||||||||||||| |||||
Sbjct: 781 tcccaagctcctcgccgggttaatgccggtgccggtgatggggatggtggccagatggac 722

                                                  
Query: 457 catgaacacggcgaagccgatcgggaggggcgccaacac 495
           ||||||||| ||||| || || ||||| || ||||||||
Sbjct: 721 catgaacaccgcgaatccaattgggagaggagccaacac 683

---

>gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           complete cds
          Length = 1235

 Score =  196 bits (99), Expect = 5e-47
 Identities = 181/207 (87%), Gaps = 1/207 (0%)
 Strand = Plus / Minus

                                                                       
Query: 277 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
           ||||| |||||| || | |||||||||||||  ||| ||||| || ||||||||||  ||
Sbjct: 875 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagcgg 816

                                                                       
Query: 337 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 396
            || |||||||||||||| || ||||||||||||||||| |||||||||||||| || ||
Sbjct: 815 ccccacccagaagatccattggtcatcccaggccttgtctttgttgtagatgacagcagc 756

                                                                       
Query: 397 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 456
            |||| ||| || |||||||||||||||||||||||||| |||||||||| |||||||||
Sbjct: 755 tcccaagcttctcgccgggttgatgccggtgccggtgatggggatggtgg-caggtggac 697

                                      
Query: 457 catgaacacggcgaagccgatcgggag 483
           ||||||||||||||| ||||| |||||
Sbjct: 696 catgaacacggcgaatccgattgggag 670

---

>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence
          Length = 1215

 Score =  192 bits (97), Expect = 8e-46
 Identities = 175/201 (87%)
 Strand = Plus / Minus

                                                                       
Query: 271 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 330
           |||| |||||| |||||| || | |||||||||||||  ||| ||||| || ||||| ||
Sbjct: 935 cttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccaat 876

                                                                       
Query: 331 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 390
           ||  || || |||||||||||||| || || |||||||||||||||||||||||||||||
Sbjct: 875 cagtggacccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgac 816

                                                                       
Query: 391 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 450
            ||||| |||||| |||| ||||||||||||||||||||||||||  |||||||| ||||
Sbjct: 815 cgcggctcccaggatcctcgccgggttgatgccggtgccggtgatgcggatggtgtccag 756

                                
Query: 451 gtggaccatgaacacggcgaa 471
           ||| |||||||||||||||||
Sbjct: 755 gtgcaccatgaacacggcgaa 735

---

>ref|NM_187081.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1215

 Score =  186 bits (94), Expect = 5e-44
 Identities = 172/198 (86%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
           ||||  |||||||||||  ||||||||||  |||||| | || |||||||||||||||||
Sbjct: 841 atcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggtt 782

                                                                       
Query: 418 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 477
           |||||||||||||||||||||||| || |||||||| ||||||||||| ||||| |||||
Sbjct: 781 gatgccggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaacccgat 722

                             
Query: 478 cgggaggggcgccaacac 495
            || || || ||||||||
Sbjct: 721 tggcagcggagccaacac 704



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 242 tacgcgttgctcctgaaggagccg 265
           ||||||||||||| ||||||||||
Sbjct: 954 tacgcgttgctccggaaggagccg 931

---

>dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132K03, full
           insert sequence
          Length = 1215

 Score =  186 bits (94), Expect = 5e-44
 Identities = 172/198 (86%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
           ||||  |||||||||||  ||||||||||  |||||| | || |||||||||||||||||
Sbjct: 841 atcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggtt 782

                                                                       
Query: 418 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 477
           |||||||||||||||||||||||| || |||||||| ||||||||||| ||||| |||||
Sbjct: 781 gatgccggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaacccgat 722

                             
Query: 478 cgggaggggcgccaacac 495
            || || || ||||||||
Sbjct: 721 tggcagcggagccaacac 704



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 242 tacgcgttgctcctgaaggagccg 265
           ||||||||||||| ||||||||||
Sbjct: 954 tacgcgttgctccggaaggagccg 931

---

>ref|NM_187084.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 852

 Score =  178 bits (90), Expect = 1e-41
 Identities = 159/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 314 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 373
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 782 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 723

                                                                       
Query: 374 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 433
              |||||||||| ||||||||| || |||||||| ||||||||||||||||||||||||
Sbjct: 722 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtg 663

                                                                       
Query: 434 atcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaac 493
           |  |||||||| |||||||| ||||||||||||||||| |||||||| || |||||||||
Sbjct: 662 acggggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaac 603

             
Query: 494 ac 495
           ||
Sbjct: 602 ac 601

---

>ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group), P0475E07.134 mRNA
          Length = 619

 Score =  178 bits (90), Expect = 1e-41
 Identities = 159/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 314 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 373
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 340 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 281

                                                                       
Query: 374 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 433
              |||||||||| ||||||||| || |||||||| ||||||||||||||||||||||||
Sbjct: 280 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtg 221

                                                                       
Query: 434 atcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaac 493
           |  |||||||| |||||||| ||||||||||||||||| |||||||| || |||||||||
Sbjct: 220 acggggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaac 161

             
Query: 494 ac 495
           ||
Sbjct: 160 ac 159

---

>dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-132-C10, full
           insert sequence
          Length = 618

 Score =  178 bits (90), Expect = 1e-41
 Identities = 159/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 314 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 373
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 339 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 280

                                                                       
Query: 374 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 433
              |||||||||| ||||||||| || |||||||| ||||||||||||||||||||||||
Sbjct: 279 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtg 220

                                                                       
Query: 434 atcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaac 493
           |  |||||||| |||||||| ||||||||||||||||| |||||||| || |||||||||
Sbjct: 219 acggggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaac 160

             
Query: 494 ac 495
           ||
Sbjct: 159 ac 158

---

>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete
           cds
          Length = 1343

 Score =  176 bits (89), Expect = 4e-41
 Identities = 188/221 (85%)
 Strand = Plus / Minus

                                                                       
Query: 271 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 330
           |||| |||||| |||||| || | |||||||||||| ||||| ||||| || || |||||
Sbjct: 913 cttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggccccgat 854

                                                                       
Query: 331 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 390
            |  || || |||||||| ||||| || |||||||||||||| || ||||||||||| ||
Sbjct: 853 gaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcac 794

                                                                       
Query: 391 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 450
           ||| || || | |||||| |||||||||||||||||||||||||||||||| ||||||| 
Sbjct: 793 ggcagctccgaagctcctcgccgggttgatgccggtgccggtgatcgggatagtggccaa 734

                                                    
Query: 451 gtggaccatgaacacggcgaagccgatcgggaggggcgcca 491
           ||| ||||||||||| ||||||||||| || ||||| ||||
Sbjct: 733 gtgcaccatgaacaccgcgaagccgattggcaggggagcca 693

---

>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds
          Length = 1104

 Score =  172 bits (87), Expect = 7e-40
 Identities = 177/207 (85%)
 Strand = Plus / Minus

                                                                       
Query: 277 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
           ||||| |||||| || | ||||||||||||    || ||||| || |||||||| |  ||
Sbjct: 825 ggcgctggccctcagcacgtactggtggtacgccgcggcgatggcggcgccgatgaatgg 766

                                                                       
Query: 337 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 396
            || |||||||||||||| || ||||||||||||||||| |||||||||||||| || ||
Sbjct: 765 acccacccagaagatccagtggtcatcccaggccttgtcgttgttgtagatgacagcagc 706

                                                                       
Query: 397 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 456
            |||| ||||||||||||||||||||||||||||||||| ||||| |||||||| |||||
Sbjct: 705 gcccaagctcctggccgggttgatgccggtgccggtgatggggatcgtggccagatggac 646

                                      
Query: 457 catgaacacggcgaagccgatcgggag 483
           ||||||||| || || ||||| |||||
Sbjct: 645 catgaacaccgcaaacccgatggggag 619

---

>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete
           cds
          Length = 1207

 Score =  172 bits (87), Expect = 7e-40
 Identities = 177/207 (85%)
 Strand = Plus / Minus

                                                                       
Query: 277 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
           ||||| |||||| || | ||||||||||||    || ||||| || |||||||| |  ||
Sbjct: 880 ggcgctggccctcagcacgtactggtggtacgccgcggcgatggcggcgccgatgaatgg 821

                                                                       
Query: 337 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 396
            || |||||||||||||| || ||||||||||||||||| |||||||||||||| || ||
Sbjct: 820 acccacccagaagatccagtggtcatcccaggccttgtcgttgttgtagatgacagcagc 761

                                                                       
Query: 397 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 456
            |||| ||||||||||||||||||||||||||||||||| ||||| |||||||| |||||
Sbjct: 760 gcccaagctcctggccgggttgatgccggtgccggtgatggggatcgtggccagatggac 701

                                      
Query: 457 catgaacacggcgaagccgatcgggag 483
           ||||||||| || || ||||| |||||
Sbjct: 700 catgaacaccgcaaacccgatggggag 674

---

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score =  167 bits (84), Expect = 4e-38
 Identities = 156/180 (86%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 898 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 839

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
            ||   |||||| |  ||| |||||||||||| ||| || || |||||||| ||||||||
Sbjct: 838 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 779

                                                                       
Query: 418 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 477
           |||||||||||||||||| |||||||||||||||||||||| |||||||||||| |||||
Sbjct: 778 gatgccggtgccggtgatggggatggtggccaggtggaccaggaacacggcgaacccgat 719

---

>dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin, complete cds
          Length = 1318

 Score =  167 bits (84), Expect = 4e-38
 Identities = 162/188 (86%)
 Strand = Plus / Minus

                                                                       
Query: 296 tactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccac 355
           ||||||||||||  ||| || || || ||||||||||  || || |||||||||||||| 
Sbjct: 944 tactggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccat 885

                                                                       
Query: 356 tgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccggg 415
           || |||||||||||||||||  ||||||||||||| || || |||| ||| || || |||
Sbjct: 884 tggtcatcccaggccttgtcagtgttgtagatgacagcagctcccaagcttctcgcgggg 825

                                                                       
Query: 416 ttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccg 475
           |||||||||||||||||||| ||||||||||||| ||||||||||||||| ||||| |||
Sbjct: 824 ttgatgccggtgccggtgatggggatggtggccaagtggaccatgaacacagcgaatccg 765

                   
Query: 476 atcgggag 483
           || |||||
Sbjct: 764 attgggag 757

---

>dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd
          Length = 1251

 Score =  167 bits (84), Expect = 4e-38
 Identities = 162/188 (86%)
 Strand = Plus / Minus

                                                                       
Query: 296 tactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccac 355
           ||||||||||||  ||| || || || ||||||||||  || || |||||||||||||| 
Sbjct: 864 tactggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccat 805

                                                                       
Query: 356 tgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccggg 415
           || |||||||||||||||||  ||||||||||||| || || |||| ||| || || |||
Sbjct: 804 tggtcatcccaggccttgtcagtgttgtagatgacagcagctcccaagcttctcgcgggg 745

                                                                       
Query: 416 ttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccg 475
           |||||||||||||||||||| ||||||||||||| ||||||||||||||| ||||| |||
Sbjct: 744 ttgatgccggtgccggtgatggggatggtggccaagtggaccatgaacacagcgaatccg 685

                   
Query: 476 atcgggag 483
           || |||||
Sbjct: 684 attgggag 677

---

>ref|XM_473219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 873

 Score =  157 bits (79), Expect = 4e-35
 Identities = 166/195 (85%)
 Strand = Plus / Minus

                                                                       
Query: 277 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
           ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||| | |||
Sbjct: 837 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 778

                                                                       
Query: 337 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 396
            || |||||||||||||| || |||| ||| ||||||| || ||||||||| || || ||
Sbjct: 777 ccccacccagaagatccagtggtcatgccatgccttgtgctggttgtagatcaccgcagc 718

                                                                       
Query: 397 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 456
            |||| |||||| |||||||||||||||||||||||||||||||| ||||||| ||| ||
Sbjct: 717 tcccaagctccttgccgggttgatgccggtgccggtgatcgggatcgtggccaagtgaac 658

                          
Query: 457 catgaacacggcgaa 471
           ||||||||| |||||
Sbjct: 657 catgaacaccgcgaa 643

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  153 bits (77), Expect = 6e-34
 Identities = 113/125 (90%)
 Strand = Plus / Minus

                                                                            
Query: 368      gccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtg 427
                ||||| || |||||| |||||||||| || || | |||||||||||||||||||||||||
Sbjct: 15355603 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtg 15355544

                                                                            
Query: 428      ccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggc 487
                |||||||||||||| || |||||||||||||||||||||||||||||||| || || |||
Sbjct: 15355543 ccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggcagcggc 15355484

                     
Query: 488      gccaa 492
                |||||
Sbjct: 15355483 gccaa 15355479



 Score =  149 bits (75), Expect = 1e-32
 Identities = 105/115 (91%)
 Strand = Plus / Minus

                                                                            
Query: 243      acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
                |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 15355852 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 15355793

                                                                       
Query: 303      ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
                ||||||| |||||||| || |||||||  |  |||||||||||||||||||||||
Sbjct: 15355792 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccactg 15355738



 Score =  149 bits (75), Expect = 1e-32
 Identities = 108/119 (90%)
 Strand = Plus / Minus

                                                                            
Query: 377      ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 436
                |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||||  
Sbjct: 15324236 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacg 15324177

                                                                           
Query: 437      gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacac 495
                |||||||| |||||||| ||||||||||||||||| |||||||| || |||||||||||
Sbjct: 15324176 gggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaacac 15324118



 Score =  149 bits (75), Expect = 1e-32
 Identities = 108/119 (90%)
 Strand = Plus / Minus

                                                                            
Query: 377      ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 436
                |||||||| ||||||||||| || |||||||| |||||||||||||||||||||||||||
Sbjct: 15316356 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatc 15316297

                                                                           
Query: 437      gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacac 495
                ||||| || |||||||| ||||||||||| ||||| |||||||| || |||||||||||
Sbjct: 15316296 gggatcgtcgccaggtgcaccatgaacaccgcgaacccgatcggcagcggcgccaacac 15316238



 Score =  137 bits (69), Expect = 4e-29
 Identities = 123/141 (87%)
 Strand = Plus / Minus

                                                                            
Query: 355      ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 414
                |||||||  |||||||||||  ||||||||||  |||||| | || ||||||||||||||
Sbjct: 15306327 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 15306268

                                                                            
Query: 415      gttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagcc 474
                ||||||||||||||||||||||||||| || |||||||| ||||||||||| ||||| ||
Sbjct: 15306267 gttgatgccggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaaccc 15306208

                                     
Query: 475      gatcgggaggggcgccaacac 495
                ||| || || || ||||||||
Sbjct: 15306207 gattggcagcggagccaacac 15306187



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 298      ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
                ||||||||| |  |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 15316534 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 15316475



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 298      ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
                ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 15306498 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 15306439



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                            
Query: 314      gcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
                ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 15324431 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 15324388



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 242      tacgcgttgctcctgaaggagccg 265
                ||||||||||||| ||||||||||
Sbjct: 15306551 tacgcgttgctccggaaggagccg 15306528

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  153 bits (77), Expect = 6e-34
 Identities = 122/137 (89%)
 Strand = Plus / Minus

                                                                            
Query: 359      tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
                ||||||||||||||||||||||||||||| || ||||  |||| |||||| |||||||| 
Sbjct: 25184038 tcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtta 25183979

                                                                            
Query: 419      atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 478
                ||||||||||||||||| |||||||||||||| |||||||||||||| ||||| || || 
Sbjct: 25183978 atgccggtgccggtgatggggatggtggccagatggaccatgaacaccgcgaatccaatt 25183919

                                 
Query: 479      gggaggggcgccaacac 495
                ||||| || ||||||||
Sbjct: 25183918 gggagaggagccaacac 25183902



 Score =  117 bits (59), Expect = 4e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                            
Query: 359      tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
                |||| |||||| | ||||||||||||||||| ||| || || ||||||||||| ||||||
Sbjct: 27065064 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 27065005

                                                               
Query: 419      atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 465
                ||||| || |||||||| |||||||||||||||||||||| ||||||
Sbjct: 27065004 atgccagtaccggtgatggggatggtggccaggtggaccaggaacac 27064958



 Score =  105 bits (53), Expect = 1e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                            
Query: 391      ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 450
                |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| ||
Sbjct: 35369049 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 35368990

                                                         
Query: 451      gtggaccatgaacacggcgaagccgatcgggaggggcgcca 491
                |||||| | ||| |||||||||||||| ||||| |||||||
Sbjct: 35368989 gtggacgaggaagacggcgaagccgatggggagcggcgcca 35368949



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                            
Query: 277      ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
                ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 25184682 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 25184623

                                      
Query: 337      gccgacccagaagatccactga 358
                ||| ||||||||||||||||||
Sbjct: 25184622 gcccacccagaagatccactga 25184601

---

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score =  153 bits (77), Expect = 6e-34
 Identities = 113/125 (90%)
 Strand = Plus / Minus

                                                                         
Query: 368   gccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtg 427
             ||||| || |||||| |||||||||| || || | |||||||||||||||||||||||||
Sbjct: 62602 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtg 62543

                                                                         
Query: 428   ccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggc 487
             |||||||||||||| || |||||||||||||||||||||||||||||||| || || |||
Sbjct: 62542 ccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggcagcggc 62483

                  
Query: 488   gccaa 492
             |||||
Sbjct: 62482 gccaa 62478



 Score =  149 bits (75), Expect = 1e-32
 Identities = 105/115 (91%)
 Strand = Plus / Minus

                                                                         
Query: 243   acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
             |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 62851 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 62792

                                                                    
Query: 303   ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
             ||||||| |||||||| || |||||||  |  |||||||||||||||||||||||
Sbjct: 62791 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccactg 62737



 Score =  149 bits (75), Expect = 1e-32
 Identities = 108/119 (90%)
 Strand = Plus / Minus

                                                                         
Query: 377   ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 436
             |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||||  
Sbjct: 31235 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacg 31176

                                                                        
Query: 437   gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacac 495
             |||||||| |||||||| ||||||||||||||||| |||||||| || |||||||||||
Sbjct: 31175 gggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaacac 31117



 Score =  149 bits (75), Expect = 1e-32
 Identities = 108/119 (90%)
 Strand = Plus / Minus

                                                                         
Query: 377   ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 436
             |||||||| ||||||||||| || |||||||| |||||||||||||||||||||||||||
Sbjct: 23355 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatc 23296

                                                                        
Query: 437   gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacac 495
             ||||| || |||||||| ||||||||||| ||||| |||||||| || |||||||||||
Sbjct: 23295 gggatcgtcgccaggtgcaccatgaacaccgcgaacccgatcggcagcggcgccaacac 23237



 Score =  137 bits (69), Expect = 4e-29
 Identities = 123/141 (87%)
 Strand = Plus / Minus

                                                                         
Query: 355   ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 414
             |||||||  |||||||||||  ||||||||||  |||||| | || ||||||||||||||
Sbjct: 13326 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 13267

                                                                         
Query: 415   gttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagcc 474
             ||||||||||||||||||||||||||| || |||||||| ||||||||||| ||||| ||
Sbjct: 13266 gttgatgccggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaaccc 13207

                                  
Query: 475   gatcgggaggggcgccaacac 495
             ||| || || || ||||||||
Sbjct: 13206 gattggcagcggagccaacac 13186



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 298   ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
             ||||||||| |  |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 23533 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 23474



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 298   ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
             ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 13497 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 13438



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                         
Query: 314   gcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
             ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 31430 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 31387



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 242   tacgcgttgctcctgaaggagccg 265
             ||||||||||||| ||||||||||
Sbjct: 13550 tacgcgttgctccggaaggagccg 13527

---

>dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1469H02
          Length = 136602

 Score =  153 bits (77), Expect = 6e-34
 Identities = 122/137 (89%)
 Strand = Plus / Minus

                                                                         
Query: 359   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
             ||||||||||||||||||||||||||||| || ||||  |||| |||||| |||||||| 
Sbjct: 84431 tcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtta 84372

                                                                         
Query: 419   atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 478
             ||||||||||||||||| |||||||||||||| |||||||||||||| ||||| || || 
Sbjct: 84371 atgccggtgccggtgatggggatggtggccagatggaccatgaacaccgcgaatccaatt 84312

                              
Query: 479   gggaggggcgccaacac 495
             ||||| || ||||||||
Sbjct: 84311 gggagaggagccaacac 84295



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                         
Query: 277   ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
             ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 85075 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 85016

                                   
Query: 337   gccgacccagaagatccactga 358
             ||| ||||||||||||||||||
Sbjct: 85015 gcccacccagaagatccactga 84994

---

>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence
          Length = 698

 Score =  151 bits (76), Expect = 3e-33
 Identities = 154/180 (85%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 397 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 338

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
            ||| ||||||| | || || |||||| || |||||||| || |||||||  || |||||
Sbjct: 337 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 278

                                                                       
Query: 418 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 477
           |||||||||||||||||| |||||||||||||||||||| | ||||||||| || |||||
Sbjct: 277 gatgccggtgccggtgatagggatggtggccaggtggacgaggaacacggcaaacccgat 218

---

>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score =  151 bits (76), Expect = 3e-33
 Identities = 154/180 (85%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 828 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 769

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
            ||| ||||||| | || || |||||| || |||||||| || |||||||  || |||||
Sbjct: 768 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 709

                                                                       
Query: 418 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 477
           |||||||||||||||||| |||||||||||||||||||| | ||||||||| || |||||
Sbjct: 708 gatgccggtgccggtgatagggatggtggccaggtggacgaggaacacggcaaacccgat 649

---

>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0475E07
          Length = 139961

 Score =  149 bits (75), Expect = 1e-32
 Identities = 108/119 (90%)
 Strand = Plus / Minus

                                                                          
Query: 377    ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 436
              |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||||  
Sbjct: 110249 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacg 110190

                                                                         
Query: 437    gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacac 495
              |||||||| |||||||| ||||||||||||||||| |||||||| || |||||||||||
Sbjct: 110189 gggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaacac 110131



 Score =  149 bits (75), Expect = 1e-32
 Identities = 108/119 (90%)
 Strand = Plus / Minus

                                                                          
Query: 377    ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 436
              |||||||| ||||||||||| || |||||||| |||||||||||||||||||||||||||
Sbjct: 102369 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatc 102310

                                                                         
Query: 437    gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacac 495
              ||||| || |||||||| ||||||||||| ||||| |||||||| || |||||||||||
Sbjct: 102309 gggatcgtcgccaggtgcaccatgaacaccgcgaacccgatcggcagcggcgccaacac 102251



 Score =  137 bits (69), Expect = 4e-29
 Identities = 123/141 (87%)
 Strand = Plus / Minus

                                                                         
Query: 355   ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 414
             |||||||  |||||||||||  ||||||||||  |||||| | || ||||||||||||||
Sbjct: 92340 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 92281

                                                                         
Query: 415   gttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagcc 474
             ||||||||||||||||||||||||||| || |||||||| ||||||||||| ||||| ||
Sbjct: 92280 gttgatgccggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaaccc 92221

                                  
Query: 475   gatcgggaggggcgccaacac 495
             ||| || || || ||||||||
Sbjct: 92220 gattggcagcggagccaacac 92200



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                          
Query: 298    ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
              ||||||||| |  |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 102547 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 102488



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 298   ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
             ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 92511 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 92452



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                          
Query: 314    gcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
              ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 110444 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 110401



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 242   tacgcgttgctcctgaaggagccg 265
             ||||||||||||| ||||||||||
Sbjct: 92564 tacgcgttgctccggaaggagccg 92541

---

>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score =  149 bits (75), Expect = 1e-32
 Identities = 129/147 (87%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           |||||| |||||||||||||| || |||| |||||| | |||| |||||||||||| |||
Sbjct: 877 ggggcccacccagaagatccaatggtcattccaggcatggtccctgttgtagatgatggc 818

                                                                       
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 453
            ||||| |||||||| || ||||||||||||||||||||||| || ||||||||||||||
Sbjct: 817 agccccaaggctcctagctgggttgatgccggtgccggtgatgggaatggtggccaggtg 758

                                      
Query: 454 gaccatgaacacggcgaagccgatcgg 480
           ||||| |||||| ||||| || |||||
Sbjct: 757 gaccaggaacaccgcgaacccaatcgg 731

---

>gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-2
           (PIP2-2) mRNA, complete cds
          Length = 1171

 Score =  145 bits (73), Expect = 2e-31
 Identities = 112/125 (89%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           |||||||||||||||||||| || |||||  | || || |||||||||||||||||||| 
Sbjct: 787 ccgacccagaagatccactggtcgtcccaaactttttcattgttgtagatgacggcggcg 728

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || | ||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 727 ccgaagctcctggcggggttgatgccggtgccggtgatggggatggtggcaaggtggacc 668

                
Query: 458 atgaa 462
           |||||
Sbjct: 667 atgaa 663

---

>gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           partial cds
          Length = 411

 Score =  145 bits (73), Expect = 2e-31
 Identities = 112/125 (89%)
 Strand = Plus / Minus

                                                                       
Query: 359 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
           |||| ||||||| |||| |||||||||||||| || || |||| ||| || |||||||||
Sbjct: 407 tcattccaggccctgtctttgttgtagatgacagcagctcccaagcttctcgccgggttg 348

                                                                       
Query: 419 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 478
           ||||||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||| 
Sbjct: 347 atgccggtgccggtgatggggatggtggctaggtggaccatgaacacggcgaatccgatt 288

                
Query: 479 gggag 483
           |||||
Sbjct: 287 gggag 283

---

>ref|XM_475029.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score =  143 bits (72), Expect = 6e-31
 Identities = 120/136 (88%)
 Strand = Plus / Minus

                                                                       
Query: 342 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 401
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 742 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 683

                                                                       
Query: 402 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 461
            ||||| ||| ||||||||||| ||||||||||| ||||||||||||||||| |||||||
Sbjct: 682 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcaccatga 623

                           
Query: 462 acacggcgaagccgat 477
           |||||||||| |||||
Sbjct: 622 acacggcgaacccgat 607



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 247 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 303
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 837 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 781

---

>dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-B01, full
           insert sequence
          Length = 1067

 Score =  143 bits (72), Expect = 6e-31
 Identities = 120/136 (88%)
 Strand = Plus / Minus

                                                                       
Query: 342 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 401
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 728 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 669

                                                                       
Query: 402 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 461
            ||||| ||| ||||||||||| ||||||||||| ||||||||||||||||| |||||||
Sbjct: 668 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcaccatga 609

                           
Query: 462 acacggcgaagccgat 477
           |||||||||| |||||
Sbjct: 608 acacggcgaacccgat 593



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 249 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 303
           |||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 821 tgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 767

---

>dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086E18, full
           insert sequence
          Length = 1308

 Score =  143 bits (72), Expect = 6e-31
 Identities = 120/136 (88%)
 Strand = Plus / Minus

                                                                       
Query: 342 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 401
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 841 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 782

                                                                       
Query: 402 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 461
            ||||| ||| ||||||||||| ||||||||||| ||||||||||||||||| |||||||
Sbjct: 781 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcaccatga 722

                           
Query: 462 acacggcgaagccgat 477
           |||||||||| |||||
Sbjct: 721 acacggcgaacccgat 706



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 247 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 303
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 936 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 880

---

>dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-B05, full
           insert sequence
          Length = 1309

 Score =  143 bits (72), Expect = 6e-31
 Identities = 120/136 (88%)
 Strand = Plus / Minus

                                                                       
Query: 342 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 401
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 835 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 776

                                                                       
Query: 402 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 461
            ||||| ||| ||||||||||| ||||||||||| ||||||||||||||||| |||||||
Sbjct: 775 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcaccatga 716

                           
Query: 462 acacggcgaagccgat 477
           |||||||||| |||||
Sbjct: 715 acacggcgaacccgat 700



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 247 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 303
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 930 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 874

---

>dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-B10, full
           insert sequence
          Length = 1296

 Score =  143 bits (72), Expect = 6e-31
 Identities = 120/136 (88%)
 Strand = Plus / Minus

                                                                       
Query: 342 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 401
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 829 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 770

                                                                       
Query: 402 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 461
            ||||| ||| ||||||||||| ||||||||||| ||||||||||||||||| |||||||
Sbjct: 769 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcaccatga 710

                           
Query: 462 acacggcgaagccgat 477
           |||||||||| |||||
Sbjct: 709 acacggcgaacccgat 694



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 247 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 303
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 924 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 868

---

>gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein ZmPIP2-6 mRNA, complete
           cds
          Length = 1257

 Score =  139 bits (70), Expect = 1e-29
 Identities = 151/178 (84%)
 Strand = Plus / Minus

                                                                       
Query: 314 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 373
           ||||||||||| ||||| |  ||||| ||||||||||||||||| ||   |||||| |||
Sbjct: 884 gcgatcgccgctccgatgaacgggcccacccagaagatccactggtcgctccaggctttg 825

                                                                       
Query: 374 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 433
              |||||||| | ||||||||| || |||||||| ||||||||||| |||||||| |||
Sbjct: 824 ctgttgttgtacacgacggcggcgccgaggctcctcgccgggttgataccggtgccagtg 765

                                                                     
Query: 434 atcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgcca 491
           |||||||| || |||||||| ||||||||||| ||||| |||||||| || |||||||
Sbjct: 764 atcgggatcgtcgccaggtgcaccatgaacacagcgaacccgatcggaagcggcgcca 707

---

>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score =  137 bits (69), Expect = 4e-29
 Identities = 111/125 (88%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 812 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 753

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| |
Sbjct: 752 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 693

                
Query: 461 aacac 465
           |||||
Sbjct: 692 aacac 688

---

>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score =  137 bits (69), Expect = 4e-29
 Identities = 111/125 (88%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| |
Sbjct: 785 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 726

                
Query: 461 aacac 465
           |||||
Sbjct: 725 aacac 721

---

>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score =  137 bits (69), Expect = 4e-29
 Identities = 111/125 (88%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 900 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 841

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| |
Sbjct: 840 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 781

                
Query: 461 aacac 465
           |||||
Sbjct: 780 aacac 776

---

>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score =  137 bits (69), Expect = 4e-29
 Identities = 111/125 (88%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| |
Sbjct: 785 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 726

                
Query: 461 aacac 465
           |||||
Sbjct: 725 aacac 721

---

>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1140

 Score =  137 bits (69), Expect = 4e-29
 Identities = 111/125 (88%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 840 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 781

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| |
Sbjct: 780 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 721

                
Query: 461 aacac 465
           |||||
Sbjct: 720 aacac 716

---

>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score =  137 bits (69), Expect = 4e-29
 Identities = 111/125 (88%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 843 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 784

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| |
Sbjct: 783 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 724

                
Query: 461 aacac 465
           |||||
Sbjct: 723 aacac 719

---

>ref|XM_473480.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score =  135 bits (68), Expect = 2e-28
 Identities = 116/132 (87%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 774 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 715

                                                                       
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 453
            || || |||||||| || ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 714 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggccaggtg 655

                       
Query: 454 gaccatgaacac 465
            |||| ||||||
Sbjct: 654 aaccaagaacac 643

---

>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin
          Length = 1291

 Score =  135 bits (68), Expect = 2e-28
 Identities = 92/100 (92%)
 Strand = Plus / Minus

                                                                       
Query: 378 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 437
           |||||||||||| ||| || || |||||||| |||||||||||||||||||||||||| |
Sbjct: 657 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 598

                                                   
Query: 438 ggatggtggccaggtggaccatgaacacggcgaagccgat 477
           ||||||||||||||||||||| |||||||||||| |||||
Sbjct: 597 ggatggtggccaggtggaccaggaacacggcgaacccgat 558



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                        
Query: 298  ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
            ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||||||
Sbjct: 1291 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccactg 1232

---

>gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-1
           (PIP2-1) mRNA, complete cds
          Length = 1300

 Score =  135 bits (68), Expect = 2e-28
 Identities = 182/220 (82%)
 Strand = Plus / Minus

                                                                       
Query: 249 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtaga 308
           |||||||||| || || || |||||||| || || || || | |||| ||||||||||||
Sbjct: 912 tgctcctgaatgacccaagagccttgatagctccagctctcaatatgaactggtggtaga 853

                                                                       
Query: 309 aggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccagg 368
           |||| || || || || || || | ||| || ||||| ||||||||||| ||||||||||
Sbjct: 852 aggctgcaatggctgcaccaatgaagggtccaacccaaaagatccactggtcatcccagg 793

                                                                       
Query: 369 ccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgc 428
           |||| || ||||||||||| || || |||||||  |||||||| |||||||| |||||||
Sbjct: 792 ccttctcattgttgtagataacagcagcccccaaactcctggcagggttgataccggtgc 733

                                                   
Query: 429 cggtgatcgggatggtggccaggtggaccatgaacacggc 468
           | ||||| || || ||||||| ||| ||||||||||||||
Sbjct: 732 cagtgataggaatagtggccaagtgaaccatgaacacggc 693

---

>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score =  135 bits (68), Expect = 2e-28
 Identities = 116/132 (87%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 851 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 792

                                                                       
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 453
            || || |||||||| || ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 791 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggccaggtg 732

                       
Query: 454 gaccatgaacac 465
            |||| ||||||
Sbjct: 731 aaccaagaacac 720

---

>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score =  135 bits (68), Expect = 2e-28
 Identities = 143/168 (85%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || |  || ||||| || | |||||| |||||||||||||| ||
Sbjct: 888 ctggtggtagatggcagcaagggcagcgccaatgaaggggccaacccagaagatccaatg 829

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
            ||||||||||| | | || |||||||||||| ||| || || |||||||| || |||||
Sbjct: 828 gtcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggtt 769

                                                           
Query: 418 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 465
           |||||||||||||||||| ||||||||||||||||| |||| ||||||
Sbjct: 768 gatgccggtgccggtgatggggatggtggccaggtgaaccaagaacac 721

---

>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full
           insert sequence
          Length = 1167

 Score =  135 bits (68), Expect = 2e-28
 Identities = 116/132 (87%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 854 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 795

                                                                       
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 453
            || || |||||||| || ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 794 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggccaggtg 735

                       
Query: 454 gaccatgaacac 465
            |||| ||||||
Sbjct: 734 aaccaagaacac 723

---

>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
            insert sequence
          Length = 1462

 Score =  135 bits (68), Expect = 2e-28
 Identities = 116/132 (87%)
 Strand = Plus / Minus

                                                                        
Query: 334  ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
            |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 1150 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 1091

                                                                        
Query: 394  ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 453
             || || |||||||| || ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 1090 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggccaggtg 1031

                        
Query: 454  gaccatgaacac 465
             |||| ||||||
Sbjct: 1030 aaccaagaacac 1019

---

>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete
           cds
          Length = 1153

 Score =  131 bits (66), Expect = 2e-27
 Identities = 147/174 (84%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 940 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 881

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
            ||   ||| || |  |||  ||||||||||| |||||| || |||||||| ||||||||
Sbjct: 880 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 821

                                                                 
Query: 418 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 471
           |||||||||||||||||| ||||||||||| |||||||||| |||||| |||||
Sbjct: 820 gatgccggtgccggtgatggggatggtggcaaggtggaccaggaacaccgcgaa 767

---

>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete
           cds
          Length = 1296

 Score =  131 bits (66), Expect = 2e-27
 Identities = 147/174 (84%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 935 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 876

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
            ||   ||| || |  |||  ||||||||||| |||||| || |||||||| ||||||||
Sbjct: 875 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 816

                                                                 
Query: 418 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 471
           |||||||||||||||||| ||||||||||| |||||||||| |||||| |||||
Sbjct: 815 gatgccggtgccggtgatggggatggtggcaaggtggaccaggaacaccgcgaa 762

---

>gb|AY103580.1| Zea mays PCO072544 mRNA sequence
          Length = 1633

 Score =  131 bits (66), Expect = 2e-27
 Identities = 147/174 (84%)
 Strand = Plus / Minus

                                                                        
Query: 298  ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
            ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 1264 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 1205

                                                                        
Query: 358  atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
             ||   ||| || |  |||  ||||||||||| |||||| || |||||||| ||||||||
Sbjct: 1204 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 1145

                                                                  
Query: 418  gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 471
            |||||||||||||||||| ||||||||||| |||||||||| |||||| |||||
Sbjct: 1144 gatgccggtgccggtgatggggatggtggcaaggtggaccaggaacaccgcgaa 1091

---

>gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds
          Length = 1216

 Score =  129 bits (65), Expect = 9e-27
 Identities = 149/177 (84%)
 Strand = Plus / Minus

                                                                       
Query: 292 tatgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagat 351
           |||| |||||||||||||||| || || || || || || | ||| || ||||| |||||
Sbjct: 873 tatgaactggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagat 814

                                                                       
Query: 352 ccactgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggc 411
           |||||| |||||||||||||| || ||||||||||| || || |||||||  ||||||||
Sbjct: 813 ccactggtcatcccaggccttctcattgttgtagataacagcagcccccaaactcctggc 754

                                                                    
Query: 412 cgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggc 468
            |||||||| |||||||| ||||| || || ||||||| ||| ||||||||||||||
Sbjct: 753 agggttgataccggtgccagtgataggaatagtggccaagtgaaccatgaacacggc 697

---

>gb|AY107589.1| Zea mays PCO085320 mRNA sequence
          Length = 569

 Score =  129 bits (65), Expect = 9e-27
 Identities = 134/157 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcg 394
           |||||||||||||| ||||| ||||| ||||| |||||   || |||||| |  ||||| 
Sbjct: 194 gggccgacccagaatatccagtgatcctcccacgcctttcgctggttgtacacaacggcc 135

                                                                       
Query: 395 gcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtgg 454
           | |||||||||||| |||||||||||||| ||||||||||  ||||||||||||||||| 
Sbjct: 134 ggccccaggctccttgccgggttgatgcccgtgccggtgacggggatggtggccaggtgc 75

                                                
Query: 455 accatgaacacggcgaagccgatcgggaggggcgcca 491
           ||||||||||| ||||| ||||| || || |||||||
Sbjct: 74  accatgaacaccgcgaatccgatgggcagcggcgcca 38

---

>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score =  127 bits (64), Expect = 4e-26
 Identities = 151/180 (83%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 885 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 826

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
            ||| ||||||| | || || |||||| || |||||||| || |||||||  || |||||
Sbjct: 825 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 766

                                                                       
Query: 418 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 477
           ||||||||||||||||||    ||||||||||||||||| | ||||||||| || |||||
Sbjct: 765 gatgccggtgccggtgatacccatggtggccaggtggacgaggaacacggcaaacccgat 706

---

>emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0093G06,
             complete sequence
          Length = 127420

 Score =  127 bits (64), Expect = 4e-26
 Identities = 103/116 (88%)
 Strand = Plus / Plus

                                                                         
Query: 362   tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 421
             ||||| ||||| | || |||||||||||||||||| || | ||||| ||| |||||||||
Sbjct: 91210 tcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagggttgatg 91269

                                                                     
Query: 422   ccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 477
             || ||||||||||| ||||||||||||||||| ||||||||||||||||| |||||
Sbjct: 91270 cccgtgccggtgatggggatggtggccaggtgcaccatgaacacggcgaacccgat 91325



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 247   gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 303
             |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 91012 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 91068

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score =  127 bits (64), Expect = 4e-26
 Identities = 103/116 (88%)
 Strand = Plus / Plus

                                                                           
Query: 362     tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 421
               ||||| ||||| | || |||||||||||||||||| || | ||||| ||| |||||||||
Sbjct: 8906901 tcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagggttgatg 8906960

                                                                       
Query: 422     ccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 477
               || ||||||||||| ||||||||||||||||| ||||||||||||||||| |||||
Sbjct: 8906961 cccgtgccggtgatggggatggtggccaggtgcaccatgaacacggcgaacccgat 8907016



 Score =  113 bits (57), Expect = 6e-22
 Identities = 99/113 (87%)
 Strand = Plus / Minus

                                                                            
Query: 359      tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
                |||| ||| ||||||| || ||||||||| || || || |||| |||||| |||||||||
Sbjct: 26074238 tcatgccatgccttgtgctggttgtagatcaccgcagctcccaagctccttgccgggttg 26074179

                                                                     
Query: 419      atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 471
                ||||||||||||||||||||||| ||||||| ||| ||||||||||| |||||
Sbjct: 26074178 atgccggtgccggtgatcgggatcgtggccaagtgaaccatgaacaccgcgaa 26074126



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                            
Query: 359      tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
                ||||||||||| | | || |||||||||||| ||| || || |||||||| || ||||||
Sbjct: 28020793 tcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggttg 28020734

                                                               
Query: 419      atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 465
                ||||||||||||||||| ||||||||||||||||| |||| ||||||
Sbjct: 28020733 atgccggtgccggtgatggggatggtggccaggtgaaccaagaacac 28020687



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                            
Query: 277      ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
                ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||| | |||
Sbjct: 26074829 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 26074770

                                    
Query: 337      gccgacccagaagatccact 356
                 || ||||||||||||||||
Sbjct: 26074769 ccccacccagaagatccact 26074750



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                        
Query: 247     gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 303
               |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 8906703 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 8906759



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 334      ggggccgacccagaagatccactg 357
                |||||| |||||||||||||||||
Sbjct: 28021379 ggggccaacccagaagatccactg 28021356

---

>gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1) mRNA, complete
           cds
          Length = 480

 Score =  127 bits (64), Expect = 4e-26
 Identities = 181/220 (82%)
 Strand = Plus / Minus

                                                                       
Query: 249 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtaga 308
           |||||||||| || || || |||||||| || || || || | |||| ||||||||||||
Sbjct: 466 tgctcctgaatgacccaagagccttgatagctccagctctcaatatgaactggtggtaga 407

                                                                       
Query: 309 aggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccagg 368
           |||| || || || || || || | ||| || ||||| ||||||||||| ||||||||||
Sbjct: 406 aggctgcaatggctgcaccaatgaagggtccaacccaaaagatccactggtcatcccagg 347

                                                                       
Query: 369 ccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgc 428
           |||| || ||||||||||| || || |||||||  |||||||| |||||||| ||||| |
Sbjct: 346 ccttctcattgttgtagataacagcagcccccaaactcctggcagggttgataccggtac 287

                                                   
Query: 429 cggtgatcgggatggtggccaggtggaccatgaacacggc 468
           | ||||| || || ||||||| ||| ||||||||||||||
Sbjct: 286 cagtgataggaatagtggccaagtgaaccatgaacacggc 247

---

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score =  127 bits (64), Expect = 4e-26
 Identities = 160/192 (83%)
 Strand = Plus / Minus

                                                                       
Query: 301 gtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatc 360
           ||||||||  ||||| | |||||||||||| |  || || |||||||||||||| || ||
Sbjct: 914 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 855

                                                                       
Query: 361 atcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgat 420
            ||||| ||||  | |||||||||||||| |||||| || |||  ||| |||||||||||
Sbjct: 854 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 795

                                                                       
Query: 421 gccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgg 480
           ||||||||| ||||| ||||| || |||||||| |||| |||||| ||||| ||||||||
Sbjct: 794 gccggtgcccgtgatggggatcgtcgccaggtgcaccaggaacaccgcgaacccgatcgg 735

                       
Query: 481 gaggggcgccaa 492
            || ||||||||
Sbjct: 734 aagcggcgccaa 723

---

>ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative aquaporin
           (OSJNBa0093B11.9), mRNA
          Length = 729

 Score =  125 bits (63), Expect = 1e-25
 Identities = 132/155 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||||||||| | ||| || |||  || |||||||| ||||||||| || 
Sbjct: 626 acccagaagatccactgatcgtgccaagcattgggctggttgtagacgacggcggcgccg 567

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           | |||||| ||||| |||||||| ||||||||||||||||||||||| ||||| |||| |
Sbjct: 566 aagctcctcgccggattgatgcccgtgccggtgatcgggatggtggcgaggtgcaccacg 507

                                              
Query: 461 aacacggcgaagccgatcgggaggggcgccaacac 495
           ||||| ||||| ||||| || |  |||||||||||
Sbjct: 506 aacaccgcgaaaccgatgggcaatggcgccaacac 472

---

>dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-C02, full
           insert sequence
          Length = 1232

 Score =  125 bits (63), Expect = 1e-25
 Identities = 132/155 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||||||||| | ||| || |||  || |||||||| ||||||||| || 
Sbjct: 808 acccagaagatccactgatcgtgccaagcattgggctggttgtagacgacggcggcgccg 749

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           | |||||| ||||| |||||||| ||||||||||||||||||||||| ||||| |||| |
Sbjct: 748 aagctcctcgccggattgatgcccgtgccggtgatcgggatggtggcgaggtgcaccacg 689

                                              
Query: 461 aacacggcgaagccgatcgggaggggcgccaacac 495
           ||||| ||||| ||||| || |  |||||||||||
Sbjct: 688 aacaccgcgaaaccgatgggcaatggcgccaacac 654

---

>gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete
           cds
          Length = 1325

 Score =  121 bits (61), Expect = 2e-24
 Identities = 91/101 (90%)
 Strand = Plus / Minus

                                                                       
Query: 377 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 436
           |||| |||||||| |||||| || ||||||||||| ||||||||||||||||||||||| 
Sbjct: 968 ttgtcgtagatgatggcggcgccgaggctcctggcggggttgatgccggtgccggtgatg 909

                                                    
Query: 437 gggatggtggccaggtggaccatgaacacggcgaagccgat 477
           ||||||||||| ||||| |||| ||| ||||||||||||||
Sbjct: 908 gggatggtggcgaggtgcaccaggaatacggcgaagccgat 868

---

>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1486_E07
          Length = 110494

 Score =  117 bits (59), Expect = 4e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                         
Query: 359   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
             |||| |||||| | ||||||||||||||||| ||| || || ||||||||||| ||||||
Sbjct: 36713 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 36654

                                                            
Query: 419   atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 465
             ||||| || |||||||| |||||||||||||||||||||| ||||||
Sbjct: 36653 atgccagtaccggtgatggggatggtggccaggtggaccaggaacac 36607

---

>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0461B08
          Length = 153743

 Score =  117 bits (59), Expect = 4e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                          
Query: 359    tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
              |||| |||||| | ||||||||||||||||| ||| || || ||||||||||| ||||||
Sbjct: 118266 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 118207

                                                             
Query: 419    atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 465
              ||||| || |||||||| |||||||||||||||||||||| ||||||
Sbjct: 118206 atgccagtaccggtgatggggatggtggccaggtggaccaggaacac 118160

---

>gb|AY170841.1| Axonopus compressus plasma membrane MIP protein mRNA, partial cds
          Length = 423

 Score =  115 bits (58), Expect = 1e-22
 Identities = 145/174 (83%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || |  || ||||| || | ||||||||||||||||||||| ||
Sbjct: 384 ctggtggtagatggcggctagggcagcgccaatgaaggggccgacccagaagatccaatg 325

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
            |||| |||||| |  ||| |||||||||||| ||| || || |||||||| || |||||
Sbjct: 324 gtcattccaggcgtgctccctgttgtagatgatggcagcgccaaggctcctagctgggtt 265

                                                                 
Query: 418 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 471
           |||||| ||||| || || ||||||||||| |||||||||| |||||| |||||
Sbjct: 264 gatgccagtgccagtaatggggatggtggcaaggtggaccaagaacaccgcgaa 211

---

>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1
           (PIP1-1) mRNA, complete cds
          Length = 1115

 Score =  113 bits (57), Expect = 6e-22
 Identities = 117/137 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || || ||||| || | ||||||||||||||||| ||| || |||
Sbjct: 810 acccagaagatccagtggtcgtcccatgcgtggtccttgttgtagatgatggccgcaccc 751

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |||||||  || |||||||||||||| ||||| || ||||||||||||| ||| |||| |
Sbjct: 750 aggctccgagctgggttgatgccggttccggttatggggatggtggccaagtgcaccaag 691

                            
Query: 461 aacacggcgaagccgat 477
           ||||| ||||| |||||
Sbjct: 690 aacactgcgaacccgat 674

---

>gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasma membrane
           intrinsic protein mRNA, complete cds
          Length = 1120

 Score =  113 bits (57), Expect = 6e-22
 Identities = 108/125 (86%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||||||||||||||| |||||||| ||||||||||||||||| || || || || || 
Sbjct: 746 acccagaagatccactggtcatcccatgccttgtccttgttgtaaattacagcagctccg 687

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  |||||||| |||||||| ||||||||||| || ||||| ||||||| ||| ||||||
Sbjct: 686 aaactcctggctgggttgataccggtgccggtaattgggatagtggccaagtgaaccatg 627

                
Query: 461 aacac 465
           |||||
Sbjct: 626 aacac 622



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 248 ttgctcctgaaggagccgagggccttgatggc 279
           |||||||||||||| ||||| |||||||||||
Sbjct: 839 ttgctcctgaaggatccgagagccttgatggc 808

---

>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11,
              complete sequence
          Length = 163039

 Score =  113 bits (57), Expect = 6e-22
 Identities = 99/113 (87%)
 Strand = Plus / Minus

                                                                          
Query: 359    tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
              |||| ||| ||||||| || ||||||||| || || || |||| |||||| |||||||||
Sbjct: 108565 tcatgccatgccttgtgctggttgtagatcaccgcagctcccaagctccttgccgggttg 108506

                                                                   
Query: 419    atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 471
              ||||||||||||||||||||||| ||||||| ||| ||||||||||| |||||
Sbjct: 108505 atgccggtgccggtgatcgggatcgtggccaagtgaaccatgaacaccgcgaa 108453



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                          
Query: 277    ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
              ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||| | |||
Sbjct: 109156 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 109097

                                  
Query: 337    gccgacccagaagatccact 356
               || ||||||||||||||||
Sbjct: 109096 ccccacccagaagatccact 109077

---

>gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, complete cds
          Length = 901

 Score =  111 bits (56), Expect = 2e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||| ||||| || ||||||||||||||||| ||||| |||||||| || || 
Sbjct: 771 ccgacccagaacatccaatggtcatcccaggccttgtcgttgttatagatgacagcagct 712

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || | ||| || ||||||||||| |||||||||||||| || || || |||||||| |||
Sbjct: 711 ccgaagcttctagccgggttgataccggtgccggtgatgggaattgttgccaggtgaacc 652

                   
Query: 458 atgaacac 465
           ||||||||
Sbjct: 651 atgaacac 644

---

>gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds
          Length = 1070

 Score =  111 bits (56), Expect = 2e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| ||||||||||| || ||||| ||||||||||| |||||||| || 
Sbjct: 746 acccagaaaatccattgatcatcccaagctttgtctttgttgtagattacggcggctccg 687

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           | ||| ||||| ||||| || ||||||||||||||||| |||||||| | ||| ||||||
Sbjct: 686 aagcttctggcggggttaattccggtgccggtgatcggaatggtggctaagtgaaccatg 627

                   
Query: 461 aacacggc 468
           || |||||
Sbjct: 626 aagacggc 619

---

>gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water channel protein MipH (MipH)
           mRNA, complete cds
          Length = 1347

 Score =  111 bits (56), Expect = 2e-21
 Identities = 146/176 (82%)
 Strand = Plus / Minus

                                                                       
Query: 293 atgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatc 352
           ||||| |||||||||| ||| ||||| || || || || |  || ||||||||||| |||
Sbjct: 890 atgtattggtggtagatggcggcgatggcagccccaatgaacggtccgacccagaaaatc 831

                                                                       
Query: 353 cactgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggcc 412
           ||||||||||||||||||||||  ||||||||||| || || || || || || |  || 
Sbjct: 830 cactgatcatcccaggccttgttgttgttgtagatcacagcagcaccaagactacgagca 771

                                                                   
Query: 413 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggc 468
           |||||||| || |||||||| || ||||||||||||| ||| ||||||||||||||
Sbjct: 770 gggttgatacctgtgccggtaattgggatggtggccaagtgaaccatgaacacggc 715

---

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score =  111 bits (56), Expect = 2e-21
 Identities = 158/192 (82%)
 Strand = Plus / Minus

                                                                       
Query: 301 gtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatc 360
           |||||||| |||||| | |||||| ||||| |  || || |||||||||||||| || ||
Sbjct: 899 gtggtagatggccgccagcgccgcaccgatgaacggaccaacccagaagatccagtggtc 840

                                                                       
Query: 361 atcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgat 420
            ||||| ||||  | |||||||||||||| |||||| || |||  ||| |||||||||||
Sbjct: 839 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 780

                                                                       
Query: 421 gccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgg 480
           |||||| || ||||| ||||| || |||||||| |||| |||||| ||||| ||||| ||
Sbjct: 779 gccggtccccgtgatggggatcgtcgccaggtgcaccaggaacaccgcgaacccgatggg 720

                       
Query: 481 gaggggcgccaa 492
            || ||||||||
Sbjct: 719 aagcggcgccaa 708

---

>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                         
Query: 359   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
             ||||||||||| | | || |||||||||||| ||| || || |||||||| || ||||||
Sbjct: 28019 tcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggttg 27960

                                                            
Query: 419   atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 465
             ||||||||||||||||| ||||||||||||||||| |||| ||||||
Sbjct: 27959 atgccggtgccggtgatggggatggtggccaggtgaaccaagaacac 27913



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 334   ggggccgacccagaagatccactg 357
             |||||| |||||||||||||||||
Sbjct: 28605 ggggccaacccagaagatccactg 28582

---

>gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, complete cds
          Length = 1192

 Score =  109 bits (55), Expect = 9e-21
 Identities = 130/155 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           |||||||| || ||||| |||||||||||||||||    ||||||||||| || || || 
Sbjct: 816 ccgacccaaaatatccattgatcatcccaggccttagaattgttgtagataaccgcagct 757

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || | ||| || || |||||||| |||||||| ||||| ||||||||||||||||| |||
Sbjct: 756 ccgaagcttctagcggggttgattccggtgcctgtgattgggatggtggccaggtgaacc 697

                                              
Query: 458 atgaacacggcgaagccgatcgggaggggcgccaa 492
           ||||| |||||||| ||||| ||||| || |||||
Sbjct: 696 atgaatacggcgaatccgattgggagcggagccaa 662

---

>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence
          Length = 1154

 Score =  107 bits (54), Expect = 3e-20
 Identities = 144/174 (82%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 790 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 731

                                                                       
Query: 358 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 417
            ||   ||| || |  |||  ||||||||||| |||||| || ||||||||    |||||
Sbjct: 730 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctaaaggggtt 671

                                                                 
Query: 418 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 471
           |||||||||||||||||| ||||||||||| |||||||||| |||||| |||||
Sbjct: 670 gatgccggtgccggtgatggggatggtggcaaggtggaccaggaacaccgcgaa 617

---

>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds
          Length = 1280

 Score =  107 bits (54), Expect = 3e-20
 Identities = 117/138 (84%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           ||||||||||||||||||||| || || | |||||| |  ||| |||||||||||| |||
Sbjct: 855 ggggccgacccagaagatccaatggtcgttccaggcgtgatccctgttgtagatgatggc 796

                                                                       
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 453
            || || |||||||| || ||||||||||| ||||| || || ||||||||||| |||||
Sbjct: 795 agcgccaaggctcctagctgggttgatgccagtgccagtaatggggatggtggcaaggtg 736

                             
Query: 454 gaccatgaacacggcgaa 471
           ||||| |||||| |||||
Sbjct: 735 gaccaggaacaccgcgaa 718

---

>ref|XM_468463.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1319

 Score =  105 bits (53), Expect = 1e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                       
Query: 391 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 450
           |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| ||
Sbjct: 887 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 828

                                                    
Query: 451 gtggaccatgaacacggcgaagccgatcgggaggggcgcca 491
           |||||| | ||| |||||||||||||| ||||| |||||||
Sbjct: 827 gtggacgaggaagacggcgaagccgatggggagcggcgcca 787

---

>emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.4 gene)
          Length = 1135

 Score =  105 bits (53), Expect = 1e-19
 Identities = 107/125 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |  |||||||||||||| | ||||||||| || ||||| |||
Sbjct: 771 acccagaagatccagtggtggtcccaggccttgtcttggttgtagataacagcggctccc 712

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || ||||| || ||||||||||| || || ||||| ||||||||||||| ||| ||||||
Sbjct: 711 agactcctagcagggttgatgccagttccagtgatggggatggtggccaagtgaaccatg 652

                
Query: 461 aacac 465
           |||||
Sbjct: 651 aacac 647

---

>gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 genomic sequence, complete
             sequence
          Length = 178692

 Score =  105 bits (53), Expect = 1e-19
 Identities = 101/117 (86%)
 Strand = Plus / Plus

                                                                         
Query: 379   gttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 438
             |||||||| ||||||||| || | |||||| ||||| |||||||| ||||||||||||||
Sbjct: 47653 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 47712

                                                                      
Query: 439   gatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacac 495
             ||||||||| ||||| |||| |||||| ||||| ||||| || |  |||||||||||
Sbjct: 47713 gatggtggcgaggtgcaccacgaacaccgcgaaaccgatgggcaatggcgccaacac 47769

---

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  105 bits (53), Expect = 1e-19
 Identities = 101/117 (86%)
 Strand = Plus / Minus

                                                                            
Query: 379      gttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 438
                |||||||| ||||||||| || | |||||| ||||| |||||||| ||||||||||||||
Sbjct: 17626978 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 17626919

                                                                         
Query: 439      gatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacac 495
                ||||||||| ||||| |||| |||||| ||||| ||||| || |  |||||||||||
Sbjct: 17626918 gatggtggcgaggtgcaccacgaacaccgcgaaaccgatgggcaatggcgccaacac 17626862



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 306      agaaggccgcgatcgccgcg 325
                ||||||||||||||||||||
Sbjct: 13136748 agaaggccgcgatcgccgcg 13136767

---

>dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1136_C04
          Length = 103194

 Score =  105 bits (53), Expect = 1e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                         
Query: 391   ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 450
             |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| ||
Sbjct: 29597 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 29538

                                                      
Query: 451   gtggaccatgaacacggcgaagccgatcgggaggggcgcca 491
             |||||| | ||| |||||||||||||| ||||| |||||||
Sbjct: 29537 gtggacgaggaagacggcgaagccgatggggagcggcgcca 29497

---

>dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086K14, full
           insert sequence
          Length = 1318

 Score =  105 bits (53), Expect = 1e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                       
Query: 391 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 450
           |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| ||
Sbjct: 886 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 827

                                                    
Query: 451 gtggaccatgaacacggcgaagccgatcgggaggggcgcca 491
           |||||| | ||| |||||||||||||| ||||| |||||||
Sbjct: 826 gtggacgaggaagacggcgaagccgatggggagcggcgcca 786

---

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  105 bits (53), Expect = 1e-19
 Identities = 101/117 (86%)
 Strand = Plus / Minus

                                                                            
Query: 379      gttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 438
                |||||||| ||||||||| || | |||||| ||||| |||||||| ||||||||||||||
Sbjct: 17636018 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 17635959

                                                                         
Query: 439      gatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacac 495
                ||||||||| ||||| |||| |||||| ||||| ||||| || |  |||||||||||
Sbjct: 17635958 gatggtggcgaggtgcaccacgaacaccgcgaaaccgatgggcaatggcgccaacac 17635902



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 306      agaaggccgcgatcgccgcg 325
                ||||||||||||||||||||
Sbjct: 13144088 agaaggccgcgatcgccgcg 13144107

---

>gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, complete cds
          Length = 1201

 Score =  105 bits (53), Expect = 1e-19
 Identities = 107/125 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || ||||||||||| || |  | |||| |||| || || || || 
Sbjct: 814 acccagaagatccaatggtcatcccaggctttctgttggttgaagataacagcagctccg 755

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || |||||||||||||||||||||||||||||||  ||||||||||||| ||| ||||||
Sbjct: 754 agactcctggccgggttgatgccggtgccggtgactgggatggtggccaagtgaaccatg 695

                
Query: 461 aacac 465
           |||||
Sbjct: 694 aacac 690

---

>emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.2 gene)
          Length = 978

 Score =  101 bits (51), Expect = 2e-18
 Identities = 129/155 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| |||||||||||||| || || |||||| ||||||| || || || 
Sbjct: 826 acccagaaaatccaatgatcatcccaggctttttcattgttgaagatgacagcagcgcca 767

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           | ||||||||| ||||||||||| || || || || ||||| ||||||| ||| ||||||
Sbjct: 766 aagctcctggcagggttgatgccagttccagttatagggattgtggccaagtgtaccatg 707

                                              
Query: 461 aacacggcgaagccgatcgggaggggcgccaacac 495
           ||||| ||||| ||||| || || || ||||||||
Sbjct: 706 aacacagcgaacccgattggaagaggagccaacac 672

---

>gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds
          Length = 740

 Score =  101 bits (51), Expect = 2e-18
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                       
Query: 342 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 401
           ||||||| ||||||||||||||||| | ||| |  ||||||||||| || ||||| ||||
Sbjct: 481 cccagaaaatccactgatcatcccatgtcttttttttgttgtagatcacagcggctccca 422

                                                                       
Query: 402 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 461
            ||| | ||||||||| ||||| || |||||||||||||| ||||||| ||||||||| |
Sbjct: 421 agctacgggccgggttaatgccagttccggtgatcgggatcgtggccaagtggaccataa 362

                  
Query: 462 acacggc 468
           | |||||
Sbjct: 361 aaacggc 355

---

>gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel protein MipC mRNA,
           complete cds
          Length = 1066

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| ||||||||||||||||| |  | ||||||||| ||||| || || 
Sbjct: 838 acccagaaaatccaatgatcatcccaggccttctgttggttgtagatcacggcagctccg 779

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  || || || ||||||||||| ||||||||||| ||||||||||||| ||| ||||||
Sbjct: 778 aaacttctagctgggttgatgccagtgccggtgattgggatggtggccaagtgaaccatg 719

                      
Query: 461 aacacggcgaa 471
           ||||| |||||
Sbjct: 718 aacaccgcgaa 708

---

>gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA
          Length = 582

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| ||||||||||||||||| |  | ||||||||| ||||| || || 
Sbjct: 354 acccagaaaatccaatgatcatcccaggccttctgttggttgtagatcacggcagctccg 295

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  || || || ||||||||||| ||||||||||| ||||||||||||| ||| ||||||
Sbjct: 294 aaacttctagctgggttgatgccagtgccggtgattgggatggtggccaagtgaaccatg 235

                      
Query: 461 aacacggcgaa 471
           ||||| |||||
Sbjct: 234 aacaccgcgaa 224

---

>dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membrane intrinsic protein
           2-2, complete cds
          Length = 1051

 Score =  101 bits (51), Expect = 2e-18
 Identities = 138/167 (82%)
 Strand = Plus / Minus

                                                                       
Query: 299 tggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactga 358
           |||||||||||||| || || || || || || | ||| || |||||||| ||||| || 
Sbjct: 874 tggtggtagaaggctgcaattgctgctccaatgaagggtcctacccagaaaatccattgg 815

                                                                       
Query: 359 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
           |||||||| |||||||| ||||||||||| || || || || || || || || ||||||
Sbjct: 814 tcatcccaagccttgtctttgttgtagataacagcagctccaagacttctagcggggttg 755

                                                          
Query: 419 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 465
           ||||| ||||| ||||| ||||||||||||| |||||| ||||||||
Sbjct: 754 atgccagtgccagtgattgggatggtggccaagtggacaatgaacac 708

---

>emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.5 gene)
          Length = 1094

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 131/158 (82%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||| || |||||||| |||||||| | |||||| || || || || 
Sbjct: 809 ccgacccagaagatccaatggtcatcccatgccttgtcttcgttgtatatcacagcagct 750

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || | |||||| ||||||||||| || || |||||||| ||||| ||||||||||| |||
Sbjct: 749 ccaaagctcctagccgggttgataccagttccggtgattgggatagtggccaggtgaacc 690

                                                 
Query: 458 atgaacacggcgaagccgatcgggaggggcgccaacac 495
           ||||| || || || ||||| || || || ||||||||
Sbjct: 689 atgaagacagcaaatccgatgggaagtggtgccaacac 652

---

>emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB75ZE10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1128

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 110/130 (84%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 819 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 760

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || |  ||||| |||||||| || |||||||| ||||| || || ||||| |  || |||
Sbjct: 759 ccaaaactcctagccgggtttattccggtgccagtgattggaattgtggctaaatgaacc 700

                     
Query: 458 atgaacacgg 467
           ||||||||||
Sbjct: 699 atgaacacgg 690

---

>gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein (Mip1) mRNA, partial cds
          Length = 539

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 116/138 (84%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           ||||||||||||||||||||| || ||   |||||| |  ||| |||||||||||| |||
Sbjct: 280 ggggccgacccagaagatccaatggtcgctccaggcatgatccctgttgtagatgatggc 221

                                                                       
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 453
            || || |||||||| || ||||||||||| ||||| || || ||||||||||| |||||
Sbjct: 220 agcgccaaggctcctagctgggttgatgccagtgccagtaatggggatggtggcaaggtg 161

                             
Query: 454 gaccatgaacacggcgaa 471
           ||||| |||||| |||||
Sbjct: 160 gaccaggaacaccgcgaa 143

---

>gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (pip2) mRNA,
           complete cds
          Length = 1260

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 106/125 (84%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||| || ||||| || |||||||||| |||||| | |||||||||||| || || || 
Sbjct: 843 acccaaaaaatccaatggtcatcccagggcttgtcttcgttgtagatgacagcagctcca 784

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           | |||||| || ||||||||||| || |||||||| ||||||||||| ||||| ||||||
Sbjct: 783 aagctcctagcagggttgatgccagttccggtgatggggatggtggcaaggtgaaccatg 724

                
Query: 461 aacac 465
           |||||
Sbjct: 723 aacac 719



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 269 gccttgatggcgccggccctgagtatgtactggtggtaga 308
           ||||||||||| || ||||| || ||||| ||||||||||
Sbjct: 915 gccttgatggctcctgcccttaggatgtattggtggtaga 876

---

>gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds
          Length = 534

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 94/109 (86%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || ||||||||||| |  ||||||||||||||||  ||||| || 
Sbjct: 458 acccagaatatccaatgttcatcccaggcttgatccttgttgtagatgattgcggcacca 399

                                                            
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 449
           ||||||||||| |||||||| ||||| || ||||| |||||||||||||
Sbjct: 398 aggctcctggcggggttgataccggtacctgtgattgggatggtggcca 350

---

>gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, complete cds
          Length = 867

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 94/109 (86%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || ||||||||||| |  ||||||||||||||||  ||||| || 
Sbjct: 788 acccagaatatccaatgttcatcccaggcttgatccttgttgtagatgattgcggcacca 729

                                                            
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 449
           ||||||||||| |||||||| ||||| || ||||| |||||||||||||
Sbjct: 728 aggctcctggcggggttgataccggtacctgtgattgggatggtggcca 680

---

>gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1a) mRNA, complete cds
          Length = 1129

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 106/125 (84%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||||   ||||||||||| |  ||  |||||||||||| ||||||||||
Sbjct: 833 acccagaaaatccacatgtcatcccaggcatgctctctgttgtagatgatggcggccccc 774

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || ||||| || |||||||||||||| |||||||| |||||||| ||||| || |||| |
Sbjct: 773 agactcctagcagggttgatgccggttccggtgatggggatggttgccagatgaaccaag 714

                
Query: 461 aacac 465
           |||||
Sbjct: 713 aacac 709

---

>gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-2
           (PIP1-2) mRNA, complete cds
          Length = 1154

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 126/152 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||||   ||||||||||| |  || |||||||||| || ||||||||||
Sbjct: 841 acccagaaaatccacatgtcatcccaggcatgctctttgttgtagacgatggcggccccc 782

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || ||||| || |||||||||||||| || ||||| |||||||| ||||| || |||| |
Sbjct: 781 agactcctagcagggttgatgccggttccagtgatggggatggttgccagatgaaccaag 722

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || || |||||||| || |||||
Sbjct: 721 aacactgcaaacccaatcgggagaggagccaa 690

---

>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 78/88 (88%)
 Strand = Plus / Minus

                                                                       
Query: 378 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 437
           |||||||||||| ||| || ||||||||||| || |||||||||||||||||||||||||
Sbjct: 830 tgttgtagatgatggcagctcccaggctccttgcagggttgatgccggtgccggtgatcg 771

                                       
Query: 438 ggatggtggccaggtggaccatgaacac 465
           |||| || |||| ||| |||| ||||||
Sbjct: 770 ggatcgtcgccaagtgcaccaagaacac 743

---

>emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major intrinsic protein PIPc
          Length = 800

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 128/155 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| || ||  | |||||| |||| |||||||| || 
Sbjct: 501 acccagaaaatccaatggtcatcccaagcttttccgttgttgaagatcacggcggcgccg 442

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           | |||||| |||||||| || ||||||||||||||||| || || |||| ||| ||||||
Sbjct: 441 aagctcctcgccgggttaatcccggtgccggtgatcggaatagttgccaagtgtaccatg 382

                                              
Query: 461 aacacggcgaagccgatcgggaggggcgccaacac 495
           ||||| || || || || ||||| |||||||||||
Sbjct: 381 aacaccgcaaaacctattgggagaggcgccaacac 347

---

>dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1223

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 110/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || ||||||||||| |    |||||||||||||| ||| || || 
Sbjct: 874 acccagaatatccagtggtcatcccaggcatgccgcttgttgtagatgatggcagcgccg 815

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || |||||||| ||||||||||| || |||||||  ||||||||||||| ||| |||| |
Sbjct: 814 agactcctggctgggttgatgccagttccggtgacggggatggtggccaagtgcaccaag 755

                      
Query: 461 aacacggcgaa 471
           |||||||||||
Sbjct: 754 aacacggcgaa 744

---

>dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane aquaporin 2c,
           complete cds
          Length = 1065

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 128/155 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  || ||||||||| || ||||| || 
Sbjct: 788 acccagaatatccagtggtcatcccacggcttggactcgttgtagataaccgcggctccg 729

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  |||||||||||||| || ||||| ||||||||||| || ||||||| ||| ||||||
Sbjct: 728 aaactcctggccgggttaataccggttccggtgatcggaatagtggccaagtgaaccatg 669

                                              
Query: 461 aacacggcgaagccgatcgggaggggcgccaacac 495
           ||||| || || || ||||| || |||||||||||
Sbjct: 668 aacaccgcaaatccaatcggaagtggcgccaacac 634

---

>dbj|AB002149.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1064

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 110/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| ||||||||||| |||| ||| | |||| ||||||  || || || 
Sbjct: 815 acccagaagatccagtgatcatcccatgcctggtcgtggttgaagatgatagcagctcca 756

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           ||||||| ||| |||||||||||||| || ||||| |||||||||||||  || |||| |
Sbjct: 755 aggctccgggcggggttgatgccggttccagtgatagggatggtggccaaatgaaccaag 696

                      
Query: 461 aacacggcgaa 471
           ||||| |||||
Sbjct: 695 aacaccgcgaa 685

---

>dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membrane intrinsic protein
            1-1, complete cds
          Length = 1351

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 110/131 (83%)
 Strand = Plus / Minus

                                                                        
Query: 341  acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
            |||||||| | ||| || ||||||||||| |  | |||||||||||||| ||| || || 
Sbjct: 1015 acccagaaaacccagtggtcatcccaggcatgctgcttgttgtagatgatggcagcgcca 956

                                                                        
Query: 401  aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
            || |||||||| ||||||||||| || |||||||  ||||||||||||| ||| |||| |
Sbjct: 955  agactcctggctgggttgatgccagttccggtgacggggatggtggccaagtgcaccaag 896

                       
Query: 461  aacacggcgaa 471
            |||||||||||
Sbjct: 895  aacacggcgaa 885

---

>ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channel AT2G39010
           (PIP2;6/PIP2E) mRNA, complete cds
          Length = 1245

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 109/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 845 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 786

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || |  ||||| |||||||| || |||||||| || || || || ||||| |  || |||
Sbjct: 785 ccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaatgaacc 726

                     
Query: 458 atgaacacgg 467
           ||||||||||
Sbjct: 725 atgaacacgg 716

---

>gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic protein 2-like mRNA,
           complete cds
          Length = 1277

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 112/134 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||| ||||| || |||||||| ||||||||   |||| | || ||||| |||
Sbjct: 828 ccgacccagaaaatccagtgttcatcccacgccttgtcgccgttgaaaatcacggccgcc 769

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || |  ||||| ||||||||||| ||||| ||||||||||| || ||||| ||||| |||
Sbjct: 768 ccgaaactcctcgccgggttgattccggtaccggtgatcggaatagtggcaaggtgaacc 709

                         
Query: 458 atgaacacggcgaa 471
           ||||| ||||||||
Sbjct: 708 atgaatacggcgaa 695

---

>gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1201

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 109/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 840 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 781

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || |  ||||| |||||||| || |||||||| || || || || ||||| |  || |||
Sbjct: 780 ccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaatgaacc 721

                     
Query: 458 atgaacacgg 467
           ||||||||||
Sbjct: 720 atgaacacgg 711

---

>gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 870

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 109/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 758 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 699

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || |  ||||| |||||||| || |||||||| || || || || ||||| |  || |||
Sbjct: 698 ccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaatgaacc 639

                     
Query: 458 atgaacacgg 467
           ||||||||||
Sbjct: 638 atgaacacgg 629

---

>gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1169

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 109/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 842 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 783

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || |  ||||| |||||||| || |||||||| || || || || ||||| |  || |||
Sbjct: 782 ccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaatgaacc 723

                     
Query: 458 atgaacacgg 467
           ||||||||||
Sbjct: 722 atgaacacgg 713

---

>emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS74ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1160

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 109/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 829 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 770

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || |  ||||| |||||||| || |||||||| || || || || ||||| |  || |||
Sbjct: 769 ccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaatgaacc 710

                     
Query: 458 atgaacacgg 467
           ||||||||||
Sbjct: 709 atgaacacgg 700

---

>emb|AJ249384.1|SOL249384 Spinacia oleracea mRNA for PM28B protein (pm28b gene)
          Length = 913

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 125/152 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| |||| |||||| || | |||||||||| |||| |  || || |||
Sbjct: 809 acccagaaaatccaatgatgatcccaagcatggtccttgttgaagataatagcagcaccc 750

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || |||||||| |||||||| ||||| || ||||| ||||||||||||| ||| |||| |
Sbjct: 749 agactcctggctgggttgattccggtacctgtgatggggatggtggccaagtgaaccagg 690

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || ||||| || || ||||||||
Sbjct: 689 aacaccgcaaatccgataggcagtggcgccaa 658

---

>gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds
          Length = 1248

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Minus

                                                                       
Query: 377 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 436
           |||||||||||||  ||||  || || ||||| || |||||||| ||||||||||| || 
Sbjct: 785 ttgttgtagatgatagcggtaccaagactcctagcagggttgataccggtgccggtaatg 726

                                                                   
Query: 437 gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaa 492
           ||||||||||||| ||| |||| |||||| ||||| ||||| |||||||| |||||
Sbjct: 725 gggatggtggccaagtgaaccaagaacacagcgaacccgattgggaggggtgccaa 670

---

>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene)
          Length = 1364

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 95/112 (84%)
 Strand = Plus / Minus

                                                                       
Query: 378 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 437
           ||||||||| || |||||| || ||||| |  || ||||||||||||||||||||||| |
Sbjct: 829 tgttgtagacgatggcggcgccgaggctgcgcgcggggttgatgccggtgccggtgatgg 770

                                                               
Query: 438 ggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgc 489
           ||||||| |||||||| || | ||| ||||||||||| || ||||| |||||
Sbjct: 769 ggatggtcgccaggtgcacgaggaagacggcgaagcctatggggagcggcgc 718

---

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                            
Query: 389      acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 448
                |||||||| || |||||||| |||||||||||||| |||||||||||||| || || |||
Sbjct: 21009488 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 21009429

                                                
Query: 449      aggtggaccatgaacacggcgaagccgatcgg 480
                ||||| || | |||||| ||||| ||||||||
Sbjct: 21009428 aggtgcacgacgaacaccgcgaacccgatcgg 21009397

---

>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete
           cds
          Length = 1338

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 95/112 (84%)
 Strand = Plus / Minus

                                                                       
Query: 378 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 437
           ||||||||| || |||||| || ||||| |  || ||||||||||||||||||||||| |
Sbjct: 820 tgttgtagacgatggcggcgccgaggctgcgcgcggggttgatgccggtgccggtgatgg 761

                                                               
Query: 438 ggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgc 489
           ||||||| |||||||| || | ||| ||||||||||| || ||||| |||||
Sbjct: 760 ggatggtcgccaggtgcacgaggaagacggcgaagcctatggggagcggcgc 709

---

>dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:B1274F11
          Length = 171257

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                          
Query: 389    acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 448
              |||||||| || |||||||| |||||||||||||| |||||||||||||| || || |||
Sbjct: 101577 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 101518

                                              
Query: 449    aggtggaccatgaacacggcgaagccgatcgg 480
              ||||| || | |||||| ||||| ||||||||
Sbjct: 101517 aggtgcacgacgaacaccgcgaacccgatcgg 101486

---

>dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-H08, full
           insert sequence
          Length = 1247

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 448
           |||||||| || |||||||| |||||||||||||| |||||||||||||| || || |||
Sbjct: 750 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 691

                                           
Query: 449 aggtggaccatgaacacggcgaagccgatcgg 480
           ||||| || | |||||| ||||| ||||||||
Sbjct: 690 aggtgcacgacgaacaccgcgaacccgatcgg 659

---

>dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-G06, full
           insert sequence
          Length = 1066

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 448
           |||||||| || |||||||| |||||||||||||| |||||||||||||| || || |||
Sbjct: 648 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 589

                                           
Query: 449 aggtggaccatgaacacggcgaagccgatcgg 480
           ||||| || | |||||| ||||| ||||||||
Sbjct: 588 aggtgcacgacgaacaccgcgaacccgatcgg 557

---

>dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D11, full
           insert sequence
          Length = 1249

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 448
           |||||||| || |||||||| |||||||||||||| |||||||||||||| || || |||
Sbjct: 748 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 689

                                           
Query: 449 aggtggaccatgaacacggcgaagccgatcgg 480
           ||||| || | |||||| ||||| ||||||||
Sbjct: 688 aggtgcacgacgaacaccgcgaacccgatcgg 657

---

>dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013118N06, full
           insert sequence
          Length = 1302

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 448
           |||||||| || |||||||| |||||||||||||| |||||||||||||| || || |||
Sbjct: 743 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 684

                                           
Query: 449 aggtggaccatgaacacggcgaagccgatcgg 480
           ||||| || | |||||| ||||| ||||||||
Sbjct: 683 aggtgcacgacgaacaccgcgaacccgatcgg 652

---

>gb|AY107675.1| Zea mays PCO112712 mRNA sequence
          Length = 791

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 95/112 (84%)
 Strand = Plus / Minus

                                                                       
Query: 378 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 437
           ||||||||| || |||||| || ||||| |  || ||||||||||||||||||||||| |
Sbjct: 253 tgttgtagacgatggcggcgccgaggctgcgcgcggggttgatgccggtgccggtgatgg 194

                                                               
Query: 438 ggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgc 489
           ||||||| |||||||| || | ||| ||||||||||| || ||||| |||||
Sbjct: 193 ggatggtcgccaggtgcacgaggaagacggcgaagcctatggggagcggcgc 142

---

>dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone: P0478E02
          Length = 140715

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                         
Query: 389   acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 448
             |||||||| || |||||||| |||||||||||||| |||||||||||||| || || |||
Sbjct: 30788 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 30729

                                             
Query: 449   aggtggaccatgaacacggcgaagccgatcgg 480
             ||||| || | |||||| ||||| ||||||||
Sbjct: 30728 aggtgcacgacgaacaccgcgaacccgatcgg 30697

---

>gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1086

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 109/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |||| ||| |||||||||||||  || || || 
Sbjct: 815 acccagaaaatccagtggtcatcccatgcctcgtctttgttgtagatgatagcagctcca 756

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || |||||||| |||||||| || || |||||||| |||||||||||||  || |||| |
Sbjct: 755 agactcctggcagggttgataccagttccggtgattgggatggtggccaaatgaaccaag 696

                      
Query: 461 aacacggcgaa 471
           ||||| |||||
Sbjct: 695 aacaccgcgaa 685

---

>gb|AY671950.1| Aegiceras corniculatum aquaporin 2 (PIP2) mRNA, complete cds
          Length = 855

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 106/127 (83%)
 Strand = Plus / Minus

                                                                       
Query: 342 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 401
           ||||||| ||||||||||||||||| | ||| |  |||  |||||| || ||||| ||||
Sbjct: 754 cccagaaaatccactgatcatcccatgtcttttttttgccgtagatcacagcggctccca 695

                                                                       
Query: 402 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 461
            ||| | ||||||||| ||||| || |||||||||||||| ||||||| ||||||||| |
Sbjct: 694 agctacgggccgggttaatgccagttccggtgatcgggatcgtggccaagtggaccataa 635

                  
Query: 462 acacggc 468
           | |||||
Sbjct: 634 aaacggc 628

---

>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1260

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 109/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || ||||||||||| |  | |||||||||||||| ||| || || 
Sbjct: 878 acccagaatatccagtggtcatcccaggcatgcttcttgttgtagatgatggcagcgcca 819

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || || || || ||||||||||| || |||||||  ||||||||||||| ||| |||| |
Sbjct: 818 agacttcttgctgggttgatgccagttccggtgacggggatggtggccaagtgcaccaag 759

                      
Query: 461 aacacggcgaa 471
           |||||||||||
Sbjct: 758 aacacggcgaa 748

---

>gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1153

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 109/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| ||| |||| ||| |||||||||||||  || || || 
Sbjct: 825 acccagaagatccagtggtcattccatgcctcgtctttgttgtagatgatagcagctcca 766

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || |||||||| |||||||| || || |||||||| |||||||||||||  || |||| |
Sbjct: 765 agactcctggcagggttgataccagttccggtgattgggatggtggccaaatgaaccaag 706

                      
Query: 461 aacacggcgaa 471
           ||||| |||||
Sbjct: 705 aacaccgcgaa 695

---

>dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane aquaporin 2b,
           complete cds
          Length = 1087

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 127/155 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  || ||||||||| || ||||| || 
Sbjct: 789 acccagaaaatccagtggtcatcccacggcttggactcgttgtagataaccgcggctcca 730

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  |||||||||||||| || ||||| |||||||| || || ||||||| ||| ||||||
Sbjct: 729 aaactcctggccgggttaatcccggttccggtgattggaatagtggccaagtgaaccatg 670

                                              
Query: 461 aacacggcgaagccgatcgggaggggcgccaacac 495
           |||||||| || || || || || |||||||||||
Sbjct: 669 aacacggcaaatccaattggaagtggcgccaacac 635

---

>emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.3 gene)
          Length = 1187

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 102/122 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| ||||| |||||||||||||| || || || || 
Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           | |||||| || |||||||| || || |||||||| || |||||||||| ||| ||||||
Sbjct: 740 aagctcctagcagggttgataccagtaccggtgattggaatggtggccaagtgaaccatg 681

             
Query: 461 aa 462
           ||
Sbjct: 680 aa 679

---

>emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides mRNA for major intrinsic
           protein 1 (mip1 gene)
          Length = 1187

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 102/122 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| ||||| |||||||||||||| || || || || 
Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           | |||||| || |||||||| || || |||||||| || |||||||||| ||| ||||||
Sbjct: 740 aagctcctagcagggttgataccagtaccggtgattggaatggtggccaagtgaaccatg 681

             
Query: 461 aa 462
           ||
Sbjct: 680 aa 679

---

>dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3, promoter region and
            complete cds
          Length = 5325

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 72/82 (87%)
 Strand = Plus / Minus

                                                                        
Query: 391  ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 450
            |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| ||
Sbjct: 4551 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 4492

                                  
Query: 451  gtggaccatgaacacggcgaag 472
            |||||| | ||| |||||||||
Sbjct: 4491 gtggacgaggaagacggcgaag 4470

---

>ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channel AT4G23400
           (PIP1;5/PIP1D) mRNA, complete cds
          Length = 1128

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 834 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 775

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || || |||||||||||||| ||||| || || || || |||||||| |||| ||| |||
Sbjct: 774 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 715

            
Query: 458 a 458
           |
Sbjct: 714 a 714

---

>gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (pip1) mRNA,
           complete cds
          Length = 1152

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| ||||||||||| |||||||| |||||||||||||  || || || 
Sbjct: 799 acccagaatatccagtgatcatcccatgccttgtctttgttgtagatgattgctgcacca 740

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || |||||||| ||||| || || || ||||| || |||||||| |||| ||| |||| |
Sbjct: 739 agactcctggcggggttaatacctgtaccggtaatagggatggttgccaagtgcaccaag 680

                
Query: 461 aacac 465
           |||||
Sbjct: 679 aacac 675

---

>gb|AY081593.1| Arabidopsis thaliana water channel-like protein (At4g23400) mRNA,
           complete cds
          Length = 956

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 785 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 726

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || || |||||||||||||| ||||| || || || || |||||||| |||| ||| |||
Sbjct: 725 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 666

            
Query: 458 a 458
           |
Sbjct: 665 a 665

---

>gb|AY059948.1| Arabidopsis thaliana water channel - like protein (At4g23400;
           F16G20.100) mRNA, complete cds
          Length = 1125

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 834 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 775

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || || |||||||||||||| ||||| || || || || |||||||| |||| ||| |||
Sbjct: 774 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 715

            
Query: 458 a 458
           |
Sbjct: 714 a 714

---

>emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 454

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 158 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 99

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || || |||||||||||||| ||||| || || || || |||||||| |||| ||| |||
Sbjct: 98  ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 39

            
Query: 458 a 458
           |
Sbjct: 38  a 38

---

>emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB51ZF11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 710

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 417 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 358

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || || |||||||||||||| ||||| || || || || |||||||| |||| ||| |||
Sbjct: 357 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 298

            
Query: 458 a 458
           |
Sbjct: 297 a 297

---

>emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS16ZB08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1066

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 823 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 764

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || || |||||||||||||| ||||| || || || || |||||||| |||| ||| |||
Sbjct: 763 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 704

            
Query: 458 a 458
           |
Sbjct: 703 a 703

---

>emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS21ZB06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 798 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 739

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || || |||||||||||||| ||||| || || || || |||||||| |||| ||| |||
Sbjct: 738 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 679

            
Query: 458 a 458
           |
Sbjct: 678 a 678

---

>gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete sequence
          Length = 1089

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 832 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 773

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || || |||||||||||||| ||||| || || || || |||||||| |||| ||| |||
Sbjct: 772 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 713

            
Query: 458 a 458
           |
Sbjct: 712 a 712

---

>dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds
          Length = 1403

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 391 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 450
           |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| ||
Sbjct: 864 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 805

                                
Query: 451 gtggaccatgaacacggcgaa 471
           |||||| | ||| ||||||||
Sbjct: 804 gtggacgaggaagacggcgaa 784

---

>ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G37170 (PIP2B) mRNA,
           complete cds
          Length = 1143

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 124/152 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 815 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 756

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 755 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 696

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || || ||||| || ||||||||
Sbjct: 695 aacaccgcaaacccaatcggaagtggcgccaa 664

---

>emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB17ZB02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1041

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 124/152 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 681

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || || ||||| || ||||||||
Sbjct: 680 aacaccgcaaacccaatcggaagtggcgccaa 649

---

>emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH65ZF08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1079

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 124/152 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 681

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || || ||||| || ||||||||
Sbjct: 680 aacaccgcaaacccaatcggaagtggcgccaa 649

---

>emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZA12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 124/152 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 791 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 732

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 731 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 672

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || || ||||| || ||||||||
Sbjct: 671 aacaccgcaaacccaatcggaagtggcgccaa 640

---

>emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH49ZD05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1074

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 124/152 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 681

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || || ||||| || ||||||||
Sbjct: 680 aacaccgcaaacccaatcggaagtggcgccaa 649

---

>emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH47ZD11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1095

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 124/152 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 681

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || || ||||| || ||||||||
Sbjct: 680 aacaccgcaaacccaatcggaagtggcgccaa 649

---

>emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS38ZC08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 821

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 124/152 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 492 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 433

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 432 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 373

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || || ||||| || ||||||||
Sbjct: 372 aacaccgcaaacccaatcggaagtggcgccaa 341

---

>emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH30ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1083

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 124/152 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 801 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 742

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 741 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 682

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || || ||||| || ||||||||
Sbjct: 681 aacaccgcaaacccaatcggaagtggcgccaa 650

---

>gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete sequence
          Length = 1104

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 124/152 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 816 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 757

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 756 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 697

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || || ||||| || ||||||||
Sbjct: 696 aacaccgcaaacccaatcggaagtggcgccaa 665

---

>gb|AY333929.1| Pringlea antiscorbutica putative transmembrane protein mRNA,
           partial cds
          Length = 380

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 126/155 (81%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||| ||||| || || ||||| |  | ||||||||||||||| | |||||| 
Sbjct: 219 ccgacccagaaaatccaatggtcgtcccaagagtggtccttgttgtagataatggcggct 160

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || ||||| || || |||||||| || || ||||| ||||| || || |||||||| |||
Sbjct: 159 ccaaggcttctagctgggttgattccagttccggttatcggaattgtcgccaggtgtacc 100

                                              
Query: 458 atgaacacggcgaagccgatcgggaggggcgccaa 492
           | |||||| || || ||||| ||||| ||||||||
Sbjct: 99  aagaacactgcaaacccgattgggagtggcgccaa 65

---

>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c
          Length = 986

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 126/155 (81%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||  || || 
Sbjct: 814 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 755

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || || ||||| || |||||||| || || |||||||| |||||| | |||| ||| |||
Sbjct: 754 ccaagactcctagctgggttgattcctgttccggtgattgggatgctcgccaagtgaacc 695

                                              
Query: 458 atgaacacggcgaagccgatcgggaggggcgccaa 492
           | |||||| ||||| ||||| ||||| || |||||
Sbjct: 694 aagaacaccgcgaatccgattgggagtggtgccaa 660

---

>gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, complete cds
          Length = 1084

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||| ||| || |||||||| || |||||||||||| |||||| ||| || || 
Sbjct: 815 acccagaagacccaatggtcatcccaagcgttgtccttgttgaagatgatggcagcacca 756

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || || || || |||||||| || || || ||||| |||||||| |||| |||||||| |
Sbjct: 755 agacttcttgctgggttgattccagttccagtgatggggatggttgccaagtggaccaag 696

                      
Query: 461 aacacggcgaa 471
           ||||| |||||
Sbjct: 695 aacacagcgaa 685

---

>gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, complete cds
          Length = 1189

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| ||||||| ||| || |  || ||||||||||||| ||| || || 
Sbjct: 867 acccagaagatccaatgatcattccatgcgtgttcattgttgtagatgatggctgcaccg 808

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || || | ||||||||| || || |||||||||||||| ||||| |||| ||| |||| |
Sbjct: 807 agacttcgggccgggttaatacccgtgccggtgatcggaatggtagccaagtgcaccaag 748

                      
Query: 461 aacacggcgaa 471
           || ||||||||
Sbjct: 747 aagacggcgaa 737

---

>gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, complete cds
          Length = 1049

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| ||||||||||| |||  ||| | |||| ||||||  || || || 
Sbjct: 797 acccagaagatccagtgatcatcccatgcccggtcttggttgaagatgatagcagctcca 738

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           ||||||| ||| ||| |||| ||||| |||||||| |||||||||||||  || |||| |
Sbjct: 737 aggctccgggcgggggtgataccggttccggtgattgggatggtggccaaatgaaccaag 678

                      
Query: 461 aacacggcgaa 471
           ||||| |||||
Sbjct: 677 aacaccgcgaa 667

---

>gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mipB) mRNA, complete cds
          Length = 1217

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| ||||||||||| || | | |||||||| ||||||  || || || 
Sbjct: 805 acccagaaaatccagtgatcatcccaagcgtggcccttgttgaagatgatagcagcaccg 746

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || ||||| || |||||||||||||| || ||||| |||||||| |||| ||| |||| |
Sbjct: 745 agactccttgctgggttgatgccggttccagtgattgggatggttgccaagtgaaccaag 686

                      
Query: 461 aacacggcgaa 471
           ||||| |||||
Sbjct: 685 aacactgcgaa 675

---

>emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic protein 2
          Length = 1214

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 110/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||| ||||| || || ||||| ||||||||   |||| | || ||||| |||
Sbjct: 794 ccgacccagaaaatccagtgttcgtcccatgccttgtcgccgttgaaaatcacggccgcc 735

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || |  ||||| ||||||||||| ||||| |||||||| || || ||||| ||||| |||
Sbjct: 734 ccgaaactcctcgccgggttgattccggtaccggtgattggaatagtggcaaggtgaacc 675

                         
Query: 458 atgaacacggcgaa 471
           ||||| ||||||||
Sbjct: 674 atgaatacggcgaa 661

---

>emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.1 gene)
          Length = 943

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 113/138 (81%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           |||||| |||||||| ||||| ||||||||||||||  ||||||||||| ||||||  ||
Sbjct: 883 ggggccaacccagaaaatccagtgatcatcccaggcgctgtccttgttgaagatgattgc 824

                                                                       
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 453
            || ||||| ||||  || |||||||| || || || || || ||||| ||||||| |||
Sbjct: 823 agcacccagactccgagctgggttgatcccagttcctgtaattgggattgtggccaagtg 764

                             
Query: 454 gaccatgaacacggcgaa 471
            |||| |||||| |||||
Sbjct: 763 caccaagaacacagcgaa 746

---

>dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - like protein, partial
           cds, clone: RAFL24-17-A12
          Length = 392

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 90  ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 31

                                     
Query: 398 cccaggctcctggccgggttgatgcc 423
           || || |||||||||||||| |||||
Sbjct: 30  ccgagactcctggccgggttaatgcc 5

---

>dbj|AB206101.1| Mimosa pudica pip2;3 mRNA for plasma membrane intrinsic protein
           2;3, complete cds
          Length = 1218

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                       
Query: 404 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 463
           |||||||||||||| |||||||| |||||||  ||||||||||||| ||| |||||||||
Sbjct: 790 ctcctggccgggttaatgccggtaccggtgactgggatggtggccaagtgaaccatgaac 731

             
Query: 464 ac 465
           ||
Sbjct: 730 ac 729

---

>dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membrane intrinsic protein
           2-1, complete cds
          Length = 1311

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 173/218 (79%)
 Strand = Plus / Minus

                                                                       
Query: 248 ttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtag 307
           ||||| ||||| || || || ||||||||||| || || || || ||||| |||||||||
Sbjct: 907 ttgcttctgaaagatcccagagccttgatggctcctgctctcagaatgtattggtggtag 848

                                                                       
Query: 308 aaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccag 367
           ||||| || || || || || || |  || || | |||||||||||| || |||||||| 
Sbjct: 847 aaggcagcaatggcagctccaatgaaaggtccaagccagaagatccattggtcatcccaa 788

                                                                       
Query: 368 gccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtg 427
           || ||||||||||| |||||||| || || || |  ||||| || ||||||||||| || 
Sbjct: 787 gctttgtccttgttatagatgacagcagctcctaaactcctagcagggttgatgccagtt 728

                                                 
Query: 428 ccggtgatcgggatggtggccaggtggaccatgaacac 465
           || ||||| || || ||||||| ||| || ||||||||
Sbjct: 727 ccagtgatgggaatagtggccaagtgaacaatgaacac 690

---

>emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein
          Length = 1179

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                
Query: 413 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 465
           |||||||| |||||||||||||| ||||||||||||||||| |||| ||||||
Sbjct: 778 gggttgattccggtgccggtgatggggatggtggccaggtgaaccaagaacac 726

---

>gb|AF452014.1|AF452014 Petunia x hybrida aquaporin-like protein (PIP2;3) mRNA, complete
           cds
          Length = 1279

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 103/125 (82%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||| |||||||| || || | ||| || ||||| | |||| |||| ||||| || || 
Sbjct: 797 acccaaaagatccaatggtctttccaagctttgtcttggttgaagataacggcagctcca 738

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || ||||| || |||||||||||||||||||| ||||| |||||||| | ||| ||||||
Sbjct: 737 agactccttgctgggttgatgccggtgccggtaatcggaatggtggctaagtgaaccatg 678

                
Query: 461 aacac 465
           |||||
Sbjct: 677 aacac 673

---

>gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1179

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                
Query: 413 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 465
           |||||||| |||||||||||||| ||||||||||||||||| |||| ||||||
Sbjct: 778 gggttgattccggtgccggtgatggggatggtggccaggtgaaccaagaacac 726

---

>ref|NM_202760.1| Arabidopsis thaliana TMP-C AT4G00430 (TMP-C) transcript variant
           AT4G00430.2 mRNA, complete cds
          Length = 1367

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 996 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 937

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| |
Sbjct: 936 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 877

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || ||||| ||||| ||||||||
Sbjct: 876 aacactgcaaatccgattgggagcggcgccaa 845

---

>ref|NM_116268.2| Arabidopsis thaliana TMP-C; water channel AT4G00430 (TMP-C)
           transcript variant AT4G00430.1 mRNA, complete cds
          Length = 1643

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 868 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 809

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| |
Sbjct: 808 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 749

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || ||||| ||||| ||||||||
Sbjct: 748 aacactgcaaatccgattgggagcggcgccaa 717

---

>ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37180 (RD28) mRNA,
           complete cds
          Length = 1143

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 819 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 760

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| ||||||||||| ||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 759 aaactcctagccgggttgataccggttccggtgatcggaatagtggccaaatgtaccata 700

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || || ||||| || ||||||||
Sbjct: 699 aacaccgcaaacccaatcggaagtggcgccaa 668

---

>gb|BT000330.1| Arabidopsis thaliana probable plasma membrane intrinsic protein 1c
           (At4g00430) mRNA, complete cds
          Length = 1331

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 782 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 723

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| |
Sbjct: 722 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 663

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || ||||| ||||| ||||||||
Sbjct: 662 aacactgcaaatccgattgggagcggcgccaa 631

---

>emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel protein (mipB)
          Length = 1114

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 114/140 (81%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           |||||||| |||| ||| || |||||||| || |||||||||||| |||||| ||| || 
Sbjct: 800 ccgacccaaaagacccaatggtcatcccaagcgttgtccttgttgaagatgatggcagct 741

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || || ||||| || |||||||| || || || || || |||||||| || | |||||||
Sbjct: 740 ccaagactccttgctgggttgattccagttccagtaatggggatggttgctaagtggacc 681

                               
Query: 458 atgaacacggcgaagccgat 477
           | |||||| ||||| |||||
Sbjct: 680 aagaacacagcgaatccgat 661

---

>gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (At2g37180) mRNA,
           complete cds
          Length = 889

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 752 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 693

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| ||||||||||| ||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 692 aaactcctagccgggttgataccggttccggtgatcggaatagtggccaaatgtaccata 633

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || || ||||| || ||||||||
Sbjct: 632 aacaccgcaaacccaatcggaagtggcgccaa 601

---

>emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrinsic protein 2b
          Length = 1095

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||  || || 
Sbjct: 767 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggacgctccg 708

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 707 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 648

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || || ||||| || ||||||||
Sbjct: 647 aacaccgcaaacccaatcggaagtggcgccaa 616

---

>gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic
           protein 2C (At2g37180) mRNA, complete cds
          Length = 1151

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 819 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 760

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| ||||||||||| ||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 759 aaactcctagccgggttgataccggttccggtgatcggaatagtggccaaatgtaccata 700

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || || ||||| || ||||||||
Sbjct: 699 aacaccgcaaacccaatcggaagtggcgccaa 668

---

>emb|AJ001293.1|CPPIPB Craterostigma plantagineum mRNA for major intrinsic protein PIPb
          Length = 1179

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 114/140 (81%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||| | ||| || |||||||| || |  || |||||||| |||| ||| || 
Sbjct: 843 ccgacccagaaaacccagtggtcatcccaagcatgatctttgttgtaaatgatggctgca 784

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || || || | ||| ||||||||||| || || |||||||| ||||| ||||||||||| 
Sbjct: 783 ccaagactacgggcggggttgatgcccgtcccagtgatcggaatggtcgccaggtggact 724

                               
Query: 458 atgaacacggcgaagccgat 477
           | |||||||||||| |||||
Sbjct: 723 aagaacacggcgaatccgat 704

---

>gb|AY120785.1| Arabidopsis thaliana probable plasma membrane intrinsic protein 1c
           (At4g00430) mRNA, complete cds
          Length = 1083

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 860 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 801

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| |
Sbjct: 800 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 741

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || ||||| ||||| ||||||||
Sbjct: 740 aacactgcaaatccgattgggagcggcgccaa 709

---

>gb|AY099825.1| Arabidopsis thaliana probable plasma membrane intrinsic protein 1c
           (At4g00430) mRNA, complete cds
          Length = 1631

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 856 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 797

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| |
Sbjct: 796 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 737

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || ||||| ||||| ||||||||
Sbjct: 736 aacactgcaaatccgattgggagcggcgccaa 705

---

>dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds
          Length = 1278

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 99/120 (82%)
 Strand = Plus / Minus

                                                                       
Query: 343 ccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccccag 402
           |||||||||||| || |||||||| || ||||||||||||||||| || || || || | 
Sbjct: 768 ccagaagatccattggtcatcccaagctttgtccttgttgtagatcacagcagctccaaa 709

                                                                       
Query: 403 gctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaa 462
            || || || |||||||| || || || ||||| ||||||||||||||||| || |||||
Sbjct: 708 acttctagcagggttgataccagttccagtgattgggatggtggccaggtgaacgatgaa 649

---

>gb|BT006313.1| Arabidopsis thaliana At4g00430 mRNA, complete cds
          Length = 864

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 782 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 723

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| |
Sbjct: 722 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 663

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || ||||| ||||| ||||||||
Sbjct: 662 aacactgcaaatccgattgggagcggcgccaa 631

---

>emb|BX827573.1|CNS0A3MW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS77ZD01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1155

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 975 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 916

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| |
Sbjct: 915 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 856

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || ||||| ||||| ||||||||
Sbjct: 855 aacactgcaaatccgattgggagcggcgccaa 824

---

>emb|BX829233.1|CNS0A3FQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL83ZB07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1000

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 843 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 784

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| |
Sbjct: 783 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 724

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || ||||| ||||| ||||||||
Sbjct: 723 aacactgcaaatccgattgggagcggcgccaa 692

---

>dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane intrinsic protein
           2;4, complete cds
          Length = 1263

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                       
Query: 377 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 436
           |||||||| ||||| || ||||| | |||||||||||||||||| || ||||| ||||| 
Sbjct: 759 ttgttgtacatgactgcagccccaaagctcctggccgggttgataccagtgccagtgatg 700

                                           
Query: 437 gggatggtggccaggtggaccatgaacacggc 468
           || |||||||  ||||| |||||||| |||||
Sbjct: 699 ggaatggtggttaggtgaaccatgaaaacggc 668

---

>gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete sequence
          Length = 1060

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 819 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 760

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| ||||||||||| ||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 759 aaactcctagccgggttgataccggttccggtgatcggaatagtggccaaatgtaccata 700

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || || ||||| || ||||||||
Sbjct: 699 aacaccgcaaacccaatcggaagtggcgccaa 668

---

>dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative transmenbrane channel
           protein
          Length = 1121

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 802 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 743

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| ||||||||||| ||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 742 aaactcctagccgggttgataccggttccggtgatcggaatagtggccaaatgtaccata 683

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || || ||||| || ||||||||
Sbjct: 682 aacaccgcaaacccaatcggaagtggcgccaa 651

---

>dbj|D85192.1| Arabidopsis thaliana mRNA for transmembrane protein, complete cds
          Length = 1024

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 819 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 760

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| |
Sbjct: 759 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 700

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || ||||| ||||| ||||||||
Sbjct: 699 aacactgcaaatccgattgggagcggcgccaa 668

---

>dbj|D26609.1|ATHTMP Arabidopsis thaliana mRNA for transmembrane protein, complete cds
          Length = 1100

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 915 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 856

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| |
Sbjct: 855 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 796

                                           
Query: 461 aacacggcgaagccgatcgggaggggcgccaa 492
           ||||| || || ||||| ||||| ||||||||
Sbjct: 795 aacactgcaaatccgattgggagcggcgccaa 764

---

>gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel protein-like mRNA,
           complete cds
          Length = 1172

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 109/132 (82%), Gaps = 1/132 (0%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| ||| |||| ||| |||||||||||||  || || || 
Sbjct: 815 acccagaagatccagtggtcattccatgcctcgtctttgttgtagatgatagcagctcca 756

                                                                       
Query: 401 aggctcctggc-cgggttgatgccggtgccggtgatcgggatggtggccaggtggaccat 459
           || ||||||||  |||||||| || || |||||||| |||||||||||||  || |||| 
Sbjct: 755 agactcctggcaggggttgataccagttccggtgattgggatggtggccaaatgaaccaa 696

                       
Query: 460 gaacacggcgaa 471
           |||||| |||||
Sbjct: 695 gaacaccgcgaa 684

---

>ref|NM_115202.1| Arabidopsis thaliana PIP2A; water channel AT3G53420 (PIP2A)
            transcript variant AT3G53420.1 mRNA, complete cds
          Length = 1347

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 125/155 (80%)
 Strand = Plus / Minus

                                                                        
Query: 341  acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
            ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 1017 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 958

                                                                        
Query: 401  aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
            |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 957  aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 898

                                               
Query: 461  aacacggcgaagccgatcgggaggggcgccaacac 495
            |||||||| || ||||| || || |||||||||||
Sbjct: 897  aacacggcaaatccgattggaagtggcgccaacac 863

---

>ref|NM_001035774.1| Arabidopsis thaliana PIP2A AT3G53420 (PIP2A) transcript variant
           AT3G53420.2 mRNA, complete cds
          Length = 1278

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 125/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 967 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 908

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 907 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 848

                                              
Query: 461 aacacggcgaagccgatcgggaggggcgccaacac 495
           |||||||| || ||||| || || |||||||||||
Sbjct: 847 aacacggcaaatccgattggaagtggcgccaacac 813

---

>gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence
          Length = 1159

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| ||| || |  || | |||||||||||  || || || 
Sbjct: 854 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 795

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || |||||||| ||||||||||| || |||||||| |||||||||||||  || |||| |
Sbjct: 794 agactcctggcggggttgatgccagttccggtgatggggatggtggccaaatgaaccaag 735

                      
Query: 461 aacacggcgaa 471
           ||||| |||||
Sbjct: 734 aacactgcgaa 724

---

>emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel protein (mipA)
          Length = 1104

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||| ||| || |||||||| || |||||||||||  |||||| ||| || || 
Sbjct: 816 acccagaagacccaatggtcatcccaagcgttgtccttgttcaagatgatggcagcacca 757

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || || || || |||||||| || || || ||||| |||||||| |||| |||||||| |
Sbjct: 756 agacttcttgctgggttgattccagttccagtgatggggatggttgccaagtggaccaag 697

                      
Query: 461 aacacggcgaa 471
           ||||| |||||
Sbjct: 696 aacacagcgaa 686

---

>emb|X75883.1|ATPIP2A A.thaliana mRNA for plasma membrane intrinsic protein 2a
          Length = 1112

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 125/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 797 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 738

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 737 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 678

                                              
Query: 461 aacacggcgaagccgatcgggaggggcgccaacac 495
           |||||||| || ||||| || || |||||||||||
Sbjct: 677 aacacggcaaatccgattggaagtggcgccaacac 643

---

>emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening membrane protein, clone
           pNY507
          Length = 1107

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| ||| || |  || | |||||||||||  || || || 
Sbjct: 794 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 735

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || |||||||| ||||||||||| || |||||||| |||||||||||||  || |||| |
Sbjct: 734 agactcctggcggggttgatgccagttccggtgatggggatggtggccaaatgaaccaag 675

                      
Query: 461 aacacggcgaa 471
           ||||| |||||
Sbjct: 674 aacactgcgaa 664

---

>emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening membrane protein, clone
           pTOM75
          Length = 859

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || |||| ||| || |  || | |||||||||||  || || || 
Sbjct: 605 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 546

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || |||||||| ||||||||||| || |||||||| |||||||||||||  || |||| |
Sbjct: 545 agactcctggcggggttgatgccagttccggtgatggggatggtggccaaatgaaccaag 486

                      
Query: 461 aacacggcgaa 471
           ||||| |||||
Sbjct: 485 aacactgcgaa 475

---

>emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.2 gene)
          Length = 1124

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 95/115 (82%)
 Strand = Plus / Minus

                                                                       
Query: 335 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcg 394
           ||||| |||||||||||||| || |||||||| || | ||| |||||| |||||| ||||
Sbjct: 866 gggccaacccagaagatccagtggtcatcccatgcatggtctttgttgaagatgatggcg 807

                                                                  
Query: 395 gcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 449
           || || || ||||| |||||||| ||||| || || || || |||||||| ||||
Sbjct: 806 gctccaagactccttgccgggttaatgccagttccagttatggggatggtagcca 752

---

>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||||||||| || ||||||||||| | |||| ||||||||||||  ||||| || 
Sbjct: 770 acccagaagatccagtggtcatcccaggcgtggtccctgttgtagatgattgcggcacca 711

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || || |  || ||||| || || || |||||||| |||||||| |||| ||| |||| |
Sbjct: 710 agactacgtgcggggttaatacctgtaccggtgattgggatggtagccaagtgcaccaag 651

                      
Query: 461 aacacggcgaa 471
           || ||||||||
Sbjct: 650 aatacggcgaa 640

---

>gb|AY072374.1| Arabidopsis thaliana plasma membrane intrinsic protein 2a
           (At3g53420) mRNA, complete cds
          Length = 1122

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 125/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 809 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 750

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 749 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 690

                                              
Query: 461 aacacggcgaagccgatcgggaggggcgccaacac 495
           |||||||| || ||||| || || |||||||||||
Sbjct: 689 aacacggcaaatccgattggaagtggcgccaacac 655

---

>gb|AF428426.1|AF428426 Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds
          Length = 1112

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 125/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 817 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 758

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 757 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 698

                                              
Query: 461 aacacggcgaagccgatcgggaggggcgccaacac 495
           |||||||| || ||||| || || |||||||||||
Sbjct: 697 aacacggcaaatccgattggaagtggcgccaacac 663

---

>gb|AY056085.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds
          Length = 864

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 125/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 758 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 699

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 698 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 639

                                              
Query: 461 aacacggcgaagccgatcgggaggggcgccaacac 495
           |||||||| || ||||| || || |||||||||||
Sbjct: 638 aacacggcaaatccgattggaagtggcgccaacac 604

---

>gb|AY044327.1| Arabidopsis thaliana plasma membrane intrinsic protein 2a
           (F4P12.12) mRNA, complete cds
          Length = 956

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 125/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 758 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 699

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 698 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 639

                                              
Query: 461 aacacggcgaagccgatcgggaggggcgccaacac 495
           |||||||| || ||||| || || |||||||||||
Sbjct: 638 aacacggcaaatccgattggaagtggcgccaacac 604

---

>gb|AY039579.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds
          Length = 1129

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 125/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 817 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 758

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 757 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 698

                                              
Query: 461 aacacggcgaagccgatcgggaggggcgccaacac 495
           |||||||| || ||||| || || |||||||||||
Sbjct: 697 aacacggcaaatccgattggaagtggcgccaacac 663

---

>emb|BX824659.1|CNS0A6W2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH62ZH05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1056

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 125/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 800 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 741

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 740 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 681

                                              
Query: 461 aacacggcgaagccgatcgggaggggcgccaacac 495
           |||||||| || ||||| || || |||||||||||
Sbjct: 680 aacacggcaaatccgattggaagtggcgccaacac 646

---

>emb|BX824010.1|CNS0A6YX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH14ZC12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1035

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 125/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 797 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 738

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 737 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 678

                                              
Query: 461 aacacggcgaagccgatcgggaggggcgccaacac 495
           |||||||| || ||||| || || |||||||||||
Sbjct: 677 aacacggcaaatccgattggaagtggcgccaacac 643

---

>emb|BX823952.1|CNS0A4TL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH10ZA03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1071

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 125/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 805 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 746

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 745 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 686

                                              
Query: 461 aacacggcgaagccgatcgggaggggcgccaacac 495
           |||||||| || ||||| || || |||||||||||
Sbjct: 685 aacacggcaaatccgattggaagtggcgccaacac 651

---

>emb|BX842136.1|CNS09YDO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS52ZB11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1117

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 125/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 801 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 742

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 741 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 682

                                              
Query: 461 aacacggcgaagccgatcgggaggggcgccaacac 495
           |||||||| || ||||| || || |||||||||||
Sbjct: 681 aacacggcaaatccgattggaagtggcgccaacac 647

---

>gb|AY087854.1| Arabidopsis thaliana clone 38965 mRNA, complete sequence
          Length = 1352

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 125/155 (80%)
 Strand = Plus / Minus

                                                                        
Query: 341  acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
            ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 1019 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 960

                                                                        
Query: 401  aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
            |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 959  aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 900

                                               
Query: 461  aacacggcgaagccgatcgggaggggcgccaacac 495
            |||||||| || ||||| || || |||||||||||
Sbjct: 899  aacacggcaaatccgattggaagtggcgccaacac 865

---

>gb|AC006260.4| Arabidopsis thaliana chromosome 2 clone T2N18 map ve018, complete
             sequence
          Length = 80736

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 109/134 (81%)
 Strand = Plus / Minus

                                                                         
Query: 359   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
             |||||||| | ||||  |||||| ||||| ||||| || || |  ||||| |||||||||
Sbjct: 25113 tcatcccatggcttgctcttgttatagattacggcagctccgaaactcctagccgggttg 25054

                                                                         
Query: 419   atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 478
             |||||||| ||||||||||| || |||||||  || ||||| ||||| || || || |||
Sbjct: 25053 atgccggttccggtgatcggaatagtggccaaatgtaccataaacaccgcaaacccaatc 24994

                           
Query: 479   gggaggggcgccaa 492
             || || ||||||||
Sbjct: 24993 ggaagtggcgccaa 24980



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 108/134 (80%)
 Strand = Plus / Plus

                                                                         
Query: 359   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
             |||||||| | ||||  ||||||  |||| |||||||| || |  ||||| |||||||||
Sbjct: 20235 tcatcccatggcttgctcttgttaaagattacggcggctccgaaactcctagccgggttg 20294

                                                                         
Query: 419   atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 478
             || ||||| ||||||||||| || |||||||  || ||||| ||||| || || || |||
Sbjct: 20295 ataccggttccggtgatcggaatagtggccaaatgtaccataaacaccgcaaacccaatc 20354

                           
Query: 479   gggaggggcgccaa 492
             || || ||||||||
Sbjct: 20355 ggaagtggcgccaa 20368

---

>gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel protein MipE mRNA,
           complete cds
          Length = 1179

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 404 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 463
           ||||| || ||||||||||||||||| ||||| |||||||||||||  || |||||||||
Sbjct: 808 ctcctagcagggttgatgccggtgccagtgatggggatggtggccaaatgaaccatgaac 749

             
Query: 464 ac 465
           ||
Sbjct: 748 ac 747

---

>gb|U27347.1|GMU27347 Glycine max putative water channel protein (Pip1) mRNA, complete
           cds
          Length = 1255

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 109/134 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||| |||||||| || |||||||||||||| |  | |||||| ||||| || || || 
Sbjct: 848 acccaaaagatccaatggtcatcccaggccttctgttggttgtacatgacagcagctcct 789

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |||||||| || ||||| ||||| ||||| || |  |||||| |||||| ||| ||||||
Sbjct: 788 aggctcctagcagggttaatgccagtgcctgttactgggatgttggccaagtgaaccatg 729

                         
Query: 461 aacacggcgaagcc 474
           ||||| || |||||
Sbjct: 728 aacacagcaaagcc 715

---

>gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrinsic protein homolog
           (mipE) mRNA, partial cds
          Length = 963

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 404 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 463
           ||||| || ||||||||||||||||| ||||| |||||||||||||  || |||||||||
Sbjct: 592 ctcctagcagggttgatgccggtgccagtgatggggatggtggccaaatgaaccatgaac 533

             
Query: 464 ac 465
           ||
Sbjct: 532 ac 531

---

>dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane aquaporin 1b,
           complete cds
          Length = 1053

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 100/122 (81%)
 Strand = Plus / Minus

                                                                       
Query: 362 tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 421
           ||||| || |||||||||||| ||||||  || || || || ||||| || |||||||||
Sbjct: 779 tcccaagcgttgtccttgttgaagatgattgcagctccaagactccttgctgggttgatg 720

                                                                       
Query: 422 ccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggg 481
           || || || ||||| |||||||| || | |||||||| |||||| ||||| ||||| |||
Sbjct: 719 ccagtaccagtgatggggatggttgctaagtggaccaagaacacagcgaatccgataggg 660

             
Query: 482 ag 483
           ||
Sbjct: 659 ag 658

---

>ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channel AT5G60660
           (PIP2;4/PIP2F) mRNA, complete cds
          Length = 1139

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 120/149 (80%)
 Strand = Plus / Minus

                                                                       
Query: 326 ccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtag 385
           |||||||| || || ||||| || ||||| || || ||||||||||| || |||||||| 
Sbjct: 823 ccgatcatcggtccaacccaaaaaatccattggtcgtcccaggccttttcgttgttgtaa 764

                                                                       
Query: 386 atgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtg 445
           || ||||| || || | ||| |  ||||||||||| ||||| |||||||| || ||||||
Sbjct: 763 ataacggcagctccaaagctacgagccgggttgataccggttccggtgatgggaatggtg 704

                                        
Query: 446 gccaggtggaccatgaacacggcgaagcc 474
           || |  || |||||||| ||||| |||||
Sbjct: 703 gctaaatgaaccatgaagacggcaaagcc 675

---

>gb|BT013307.1| Lycopersicon esculentum clone 134975R, mRNA sequence
          Length = 1260

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 404 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 463
           ||||| ||||||||||| ||||| ||||||||||| || ||||| ||||| |||||||| 
Sbjct: 791 ctcctcgccgggttgattccggtaccggtgatcggaatagtggcaaggtgaaccatgaat 732

                
Query: 464 acggc 468
           |||||
Sbjct: 731 acggc 727

---

>gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, complete cds
          Length = 1278

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 147/185 (79%)
 Strand = Plus / Minus

                                                                       
Query: 293 atgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatc 352
           ||||||||||| ||||| || || || || || || || | ||| ||||||||||| |||
Sbjct: 937 atgtactggtgatagaatgcagctattgcggcaccaatgaagggtccgacccagaaaatc 878

                                                                       
Query: 353 cactgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggcc 412
           || || |||||||| ||||| ||||||   ||||| || || || || | ||| |  |||
Sbjct: 877 cattggtcatcccatgccttatccttgccatagatcacagcagctccgaagcttcgagcc 818

                                                                       
Query: 413 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaag 472
           || || || || || |||||||| || |||||||||||||| |||||||||||||| || 
Sbjct: 817 ggattaataccagttccggtgattggaatggtggccaggtgaaccatgaacacggcaaat 758

                
Query: 473 ccgat 477
           |||||
Sbjct: 757 ccgat 753

---

>gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic protein 1-like
           protein mRNA, partial cds
          Length = 474

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 449
           ||||||||||| ||||||||||| ||||||||||| || ||||||||||
Sbjct: 380 aggctcctggcagggttgatgccagtgccggtgataggtatggtggcca 332

---

>gb|AF290620.1|AF290620 Nicotiana glauca putative PIP2 (MIP4) mRNA, complete cds
          Length = 1108

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                       
Query: 379 gttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 438
           |||| |||| ||||| || || || ||||| ||||||||||| |||||||||||||||||
Sbjct: 742 gttgaagataacggcagcgccaagactcctagccgggttgattccggtgccggtgatcgg 683

                    
Query: 439 gatggtggc 447
            ||||||||
Sbjct: 682 aatggtggc 674

---

>gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, complete cds
          Length = 1101

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 111/137 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||| |||| ||| || |||||||| || |||||||||||| |||||| ||| || || 
Sbjct: 798 acccaaaagacccaatggtcatcccaagcgttgtccttgttgaagatgatggcagctcca 739

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || ||||| || |||||||| || || || || || |||||||| || | |||||||| |
Sbjct: 738 agactccttgctgggttgattccagttccagtaatggggatggttgctaagtggaccaag 679

                            
Query: 461 aacacggcgaagccgat 477
           ||||| ||||| |||||
Sbjct: 678 aacacagcgaatccgat 662

---

>gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete sequence
          Length = 1120

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 120/149 (80%)
 Strand = Plus / Minus

                                                                       
Query: 326 ccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtag 385
           |||||||| || || ||||| || ||||| || || ||||||||||| || |||||||| 
Sbjct: 823 ccgatcatcggtccaacccaaaaaatccattggtcgtcccaggccttttcgttgttgtaa 764

                                                                       
Query: 386 atgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtg 445
           || ||||| || || | ||| |  ||||||||||| ||||| |||||||| || ||||||
Sbjct: 763 ataacggcagctccaaagctacgagccgggttgataccggttccggtgatgggaatggtg 704

                                        
Query: 446 gccaggtggaccatgaacacggcgaagcc 474
           || |  || |||||||| ||||| |||||
Sbjct: 703 gctaaatgaaccatgaagacggcaaagcc 675

---

>emb|AL132966.1|ATF4P12 Arabidopsis thaliana DNA chromosome 3, BAC clone F4P12
          Length = 144628

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 111/137 (81%)
 Strand = Plus / Plus

                                                                         
Query: 359   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
             |||||||| | ||||  |||||||||||| ||||| || || |  ||||| |||||||| 
Sbjct: 44790 tcatcccatggcttgctcttgttgtagattacggcagctccgaaactccttgccgggtta 44849

                                                                         
Query: 419   atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 478
             || ||||| ||||| || || ||||| ||||  || |||||||||||||| || ||||| 
Sbjct: 44850 attccggttccggtaatgggaatggtagccaaatgtaccatgaacacggcaaatccgatt 44909

                              
Query: 479   gggaggggcgccaacac 495
             || || |||||||||||
Sbjct: 44910 ggaagtggcgccaacac 44926

---

>gb|DQ228343.1| Solanum tuberosum clone 148A12 unknown mRNA
          Length = 1082

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 404 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 463
           |||||||| ||||||||||| || |||||||| |||||||||||||  || |||| ||||
Sbjct: 775 ctcctggcggggttgatgccagttccggtgatggggatggtggccaaatgaaccaagaac 716

                   
Query: 464 acggcgaa 471
           || |||||
Sbjct: 715 accgcgaa 708

---

>gb|AY663794.1| Fraxinus excelsior plasma membrane intrinsic protein PIP1-1 mRNA,
           complete cds
          Length = 1174

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| ||||| ||||| || | ||| |||||||||||||  || || || 
Sbjct: 801 acccagaatatccaatgatcgtcccatgcgtggtctttgttgtagatgattgctgctcca 742

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           || |||||||| ||||| || || || || || || |||||||| |||| |||||||| |
Sbjct: 741 agactcctggcggggttaataccagtacccgtaatagggatggtcgccaagtggaccaag 682

                   
Query: 461 aacacggc 468
           ||||||||
Sbjct: 681 aacacggc 674

---

>emb|AL161471.2|ATCHRIV1 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 1
          Length = 197119

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                          
Query: 373    gtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 432
              ||||||||||||||| |  ||||| || || || || || |||||||| ||||| |||||
Sbjct: 185351 gtccttgttgtagataattgcggctccaagacttctagctgggttgattccggtcccggt 185410

                                                                          
Query: 433    gatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaa 492
              |||||| || || |||| ||| |||| |||||| || || ||||| ||||| ||||||||
Sbjct: 185411 gatcggtattgttgccaagtgtaccaagaacactgcaaatccgattgggagcggcgccaa 185470

---

>emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative plasma membrane intrinsic
           protein (pip1a gene)
          Length = 1139

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 376 cttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgat 435
           ||||||||| |||||||| || || |  || ||||| ||||||||||| ||||| |||||
Sbjct: 763 cttgttgtaaatgacggcagctccaaaacttctggctgggttgatgccagtgccagtgat 704

                                               
Query: 436 cgggatggtggccaggtggaccatgaacacggcgaa 471
            ||||||||||| ||||| || | |||||| |||||
Sbjct: 703 ggggatggtggcaaggtgaacaaggaacacagcgaa 668

---

>emb|AJ289695.1|POC289695 Posidonia oceanica partial aq2 gene for putative aquaporin, exon 1
          Length = 880

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 376 cttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgat 435
           ||||||||| |||||||| || || |  || ||||| ||||||||||| ||||| |||||
Sbjct: 741 cttgttgtaaatgacggcagctccaaaacttctggctgggttgatgccagtgccagtgat 682

                                               
Query: 436 cgggatggtggccaggtggaccatgaacacggcgaa 471
            ||||||||||| ||||| || | |||||| |||||
Sbjct: 681 ggggatggtggcaaggtgaacaaggaacacagcgaa 646

---

>gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic protein (mip3) mRNA,
           partial cds
          Length = 495

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 362 tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 421
           |||||||||||||| ||||||||||| || || || || ||||| || || ||||| |||
Sbjct: 485 tcccaggccttgtcattgttgtagatcactgcagctccaaggcttcttgctgggtttatg 426

                                           
Query: 422 ccggtgccggtgatcgggatggtggccaggtg 453
           || ||||| ||||| ||||| ||||| |||||
Sbjct: 425 ccagtgccagtgattgggattgtggcaaggtg 394

---

>emb|AJ605568.1| Ricinus communis partial mRNA for putative aquaporin (Pip2-3 gene),
           clone pR450-4
          Length = 452

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 86/104 (82%)
 Strand = Plus / Minus

                                                                       
Query: 359 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 418
           ||||||||||||||||||| |||||| || || || || || |  ||||| || ||||||
Sbjct: 428 tcatcccaggccttgtcctggttgtaaataacagcagctcctaaactccttgctgggttg 369

                                                       
Query: 419 atgccggtgccggtgatcgggatggtggccaggtggaccatgaa 462
           ||||| ||||| ||||| || ||||| |||| ||| ||||||||
Sbjct: 368 atgccagtgccagtgattggaatggtagccaagtgaaccatgaa 325

---

>gb|AF195115.1|F5I10 Arabidopsis thaliana BAC F5I10
          Length = 111906

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                         
Query: 373   gtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 432
             ||||||||||||||| |  ||||| || || || || || |||||||| ||||| |||||
Sbjct: 85870 gtccttgttgtagataattgcggctccaagacttctagctgggttgattccggtcccggt 85929

                                                                         
Query: 433   gatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaa 492
             |||||| || || |||| ||| |||| |||||| || || ||||| ||||| ||||||||
Sbjct: 85930 gatcggtattgttgccaagtgtaccaagaacactgcaaatccgattgggagcggcgccaa 85989

---

>gb|AF013293.1|IG005I10 Arabidopsis thaliana BAC IG005I10
          Length = 111906

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 98/120 (81%)
 Strand = Plus / Minus

                                                                         
Query: 373   gtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 432
             ||||||||||||||| |  ||||| || || || || || |||||||| ||||| |||||
Sbjct: 26037 gtccttgttgtagataattgcggctccaagacttctagctgggttgattccggtcccggt 25978

                                                                         
Query: 433   gatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaa 492
             |||||| || || |||| ||| |||| |||||| || || ||||| ||||| ||||||||
Sbjct: 25977 gatcggtattgttgccaagtgtaccaagaacactgcaaatccgattgggagcggcgccaa 25918

---

>ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G01620 (PIP1C) mRNA,
           complete cds
          Length = 1251

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 124/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||  || || 
Sbjct: 908 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 849

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || || ||||| || ||||| || || || |||||||| || || || |||| ||| |||
Sbjct: 848 ccaagactcctagctgggttaattcctgttccggtgattggaatcgtcgccaagtgaacc 789

                                              
Query: 458 atgaacacggcgaagccgatcgggaggggcgccaa 492
           | |||||| ||||| ||||| ||||| || |||||
Sbjct: 788 aagaacacagcgaatccgattgggagtggtgccaa 754

---

>emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B
          Length = 1057

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 124/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||  || || 
Sbjct: 795 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 736

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || || ||||| || ||||| || || || |||||||| || || || |||| ||| |||
Sbjct: 735 ccaagactcctagctgggttaattcctgttccggtgattggaatcgtcgccaagtgaacc 676

                                              
Query: 458 atgaacacggcgaagccgatcgggaggggcgccaa 492
           | |||||| ||||| ||||| ||||| || |||||
Sbjct: 675 aagaacacagcgaatccgattgggagtggtgccaa 641

---

>gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative plasma membrane
           intrinsic protein 1c (At1g01620) mRNA, complete cds
          Length = 861

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 124/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||  || || 
Sbjct: 782 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 723

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || || ||||| || ||||| || || || |||||||| || || || |||| ||| |||
Sbjct: 722 ccaagactcctagctgggttaattcctgttccggtgattggaatcgtcgccaagtgaacc 663

                                              
Query: 458 atgaacacggcgaagccgatcgggaggggcgccaa 492
           | |||||| ||||| ||||| ||||| || |||||
Sbjct: 662 aagaacacagcgaatccgattgggagtggtgccaa 628

---

>emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 963

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 124/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 397
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||  || || 
Sbjct: 826 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 767

                                                                       
Query: 398 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 457
           || || ||||| || ||||| || || || |||||||| || || || |||| ||| |||
Sbjct: 766 ccaagactcctagctgggttaattcctgttccggtgattggaatcgtcgccaagtgaacc 707

                                              
Query: 458 atgaacacggcgaagccgatcgggaggggcgccaa 492
           | |||||| ||||| ||||| ||||| || |||||
Sbjct: 706 aagaacacagcgaatccgattgggagtggtgccaa 672

---

>gb|AF118383.1|AF118383 Brassica napus plasma membrane intrinsic protein 2 (PIP2) mRNA,
           complete cds
          Length = 1026

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 124/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           |||||||| ||||| || |||||||| | ||||  || ||||||||| || || || || 
Sbjct: 777 acccagaatatccagtggtcatcccacggcttggactcgttgtagataaccgcagctccg 718

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| |||||||| || || || ||||||||||| || ||||||| ||| ||||||
Sbjct: 717 aaactccttgccgggttaattcctgttccggtgatcggaatagtggccaagtgaaccatg 658

                                              
Query: 461 aacacggcgaagccgatcgggaggggcgccaacac 495
           || || || || || ||||| || |||||||||||
Sbjct: 657 aagaccgcaaaccctatcggaagtggcgccaacac 623

---

>gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, complete cds
          Length = 1298

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 413 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 471
           |||||||||||||| |||||||| ||||||||||||| ||| ||||  ||||| |||||
Sbjct: 774 gggttgatgccggttccggtgatggggatggtggccaagtgaaccaaaaacacagcgaa 716

---

>gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, complete cds
          Length = 1071

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 115/143 (80%)
 Strand = Plus / Minus

                                                                       
Query: 335 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcg 394
           ||||| ||||||||||||||||| || ||||| |||||| |    ||||| |  ||||||
Sbjct: 777 gggccaacccagaagatccactggtcgtcccaagccttgccgccattgtacaccacggcg 718

                                                                       
Query: 395 gcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtgg 454
           || || | |||||| || || ||||| ||||| |||||||  ||||| ||||| ||||| 
Sbjct: 717 gcgccaaagctccttgctggattgatcccggttccggtgacggggatagtggcgaggtgc 658

                                  
Query: 455 accatgaacacggcgaagccgat 477
            |||||| ||||||||| |||||
Sbjct: 657 gccatgagcacggcgaacccgat 635

---

>dbj|AB012045.1| Raphanus sativus mRNA for Plasma membrane aquaporin (PAQ2),
           complete cds
          Length = 1126

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 124/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 400
           ||||| || ||||| || |||||||||| ||||  || |||| |||||||||| || || 
Sbjct: 804 acccaaaatatccagtggtcatcccagggcttgctctcgttgaagatgacggctgctccg 745

                                                                       
Query: 401 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 460
           |  ||||| |||||||| || || || |||||||| || ||||| |||| ||| ||||||
Sbjct: 744 aaactccttgccgggttaataccagttccggtgatgggaatggtagccaagtgcaccatg 685

                                              
Query: 461 aacacggcgaagccgatcgggaggggcgccaacac 495
           ||||| || || || || || || |||||||||||
Sbjct: 684 aacaccgcaaatccaattggaagtggcgccaacac 650

---

>ref|NM_116008.2| Arabidopsis thaliana PIP1A; water channel AT3G61430 (PIP1A) mRNA,
           complete cds
          Length = 1254

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 120/150 (80%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           |||||| ||||| || | ||| || ||||||||||  | ||| |||||||||||||  ||
Sbjct: 969 ggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgc 910

                                                                       
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 453
            || || ||||| || || ||||||||||| ||||| ||||| |||||||| |||| |||
Sbjct: 909 agctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggttgccaagtg 850

                                         
Query: 454 gaccatgaacacggcgaagccgatcgggag 483
            |||| ||| || || || ||||| |||||
Sbjct: 849 aaccaagaaaaccgcaaacccgattgggag 820

---

>gb|DQ451602.1| Salicornia bigelovii plasma membrane major intrinsic protein (PIP1)
           mRNA, complete cds
          Length = 1268

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 78/94 (82%)
 Strand = Plus / Minus

                                                                       
Query: 378 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 437
           |||||||||||| ||| |  || || ||||| || |||||||| |||||||| || |  |
Sbjct: 824 tgttgtagatgatggcagtaccaagactcctagcagggttgataccggtgccagtaacgg 765

                                             
Query: 438 ggatggtggccaggtggaccatgaacacggcgaa 471
           |||||||||||| ||| |||| ||||||||||||
Sbjct: 764 ggatggtggccaagtgaaccaagaacacggcgaa 731

---

>emb|AJ289701.1|VFA289701 Vicia faba mRNA for aquaporin (aq1 gene)
          Length = 995

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 120/150 (80%)
 Strand = Plus / Minus

                                                                       
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 393
           |||||| ||||| || | ||| || ||||||||||  | ||| |||||||||||||  ||
Sbjct: 873 ggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgc 814

                                                                       
Query: 394 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 453
            || || ||||| || || ||||||||||| ||||| ||||| |||||||| |||| |||
Sbjct: 813 agctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggttgccaagtg 754

                                         
Query: 454 gaccatgaacacggcgaagccgatcgggag 483
            |||| ||| || || || ||||| |||||
Sbjct: 753 aaccaagaaaaccgcaaacccgattgggag 724

---

>gb|AF367458.1| Prunus persica clone Mip2 membrane intrinsic protein (mip2) mRNA,
           partial cds
          Length = 495

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 87/106 (82%)
 Strand = Plus / Minus

                                                                       
Query: 357 gatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggt 416
           |||| |||||||| ||||||||||||||||| || || || || |  || || || ||||
Sbjct: 490 gatcgtcccaggctttgtccttgttgtagatcacagcagctccaaaacttctagcagggt 431

                                                         
Query: 417 tgatgccggtgccggtgatcgggatggtggccaggtggaccatgaa 462
           |||| || || || ||||| ||||||||||||||||| || |||||
Sbjct: 430 tgataccagttccagtgattgggatggtggccaggtgaacaatgaa 385


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,918,933
Number of Sequences: 3902068
Number of extensions: 3918933
Number of successful extensions: 73260
Number of sequences better than 10.0: 389
Number of HSP's better than 10.0 without gapping: 387
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 71278
Number of HSP's gapped (non-prelim): 1943
length of query: 495
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 473
effective length of database: 17,147,199,772
effective search space: 8110625492156
effective search space used: 8110625492156
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---