ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart37b07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1tpg|BK005644.1| TPA: TPA_inf: Triticum aestivum histidine-contai... 494 e-136
2dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 272 1e-69
3dbj|AK059519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 272 1e-69
4emb|AL731591.3|OSJN00240 Oryza sativa genomic DNA, chromosome 4,... 272 1e-69
5gb|BT018238.1| Zea mays clone EL01N0563B05.c mRNA sequence 268 2e-68
6ref|XM_472343.1| Oryza sativa (japonica cultivar-group), predic... 260 4e-66
7gb|AY109584.1| Zea mays CL2436_1 mRNA sequence 260 4e-66
8gb|M77224.1|MZERFESPA Zea mays mitochondrial Rieske Fe-S protein... 258 2e-65
9gb|BT017520.1| Zea mays clone EL01N0421A02.c mRNA sequence 256 6e-65
10gb|AY105531.1| Zea mays PCO113958 mRNA sequence 206 5e-50
11gb|DQ207870.1| Solanum tuberosum clone 087E11 rieske iron-sulfur... 119 9e-24
12gb|BT014059.1| Lycopersicon esculentum clone 133157F, mRNA sequence 113 6e-22
13emb|X79332.1|STFES1G S.tuberosum (Desiree) FeS1 mRNA for Rieske ... 111 2e-21
14gb|M77225.1|TOBRFESP Nicotiana tabacum mitochondrial Rieske Fe-S... 109 9e-21
15ref|XM_466001.1| Oryza sativa (japonica cultivar-group), mRNA 107 4e-20
16dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 107 4e-20
17dbj|AP005842.3| Oryza sativa (japonica cultivar-group) genomic D... 107 4e-20
18dbj|AP005749.3| Oryza sativa (japonica cultivar-group) genomic D... 107 4e-20
19dbj|AK102815.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 4e-20
20gb|L16813.1|TOBFESD Nicotiana tabacum clone 32.10 Rieske iron-su... 105 1e-19
21gb|L16812.1|TOBFESC Nicotiana tabacum clone 36.14 Rieske iron-su... 105 1e-19
22gb|L16810.1|TOBFESA Nicotiana tabacum clone 17.12 Rieske iron-su... 105 1e-19
23gb|L16811.1|TOBFESB Nicotiana tabacum clone 8.8 Rieske iron-sulf... 103 6e-19
24dbj|D21116.1|RICSS126 Oryza sativa mRNA for Rieske Fe-S protein,... 92 2e-15
25emb|AJ719669.1| Gallus gallus mRNA for hypothetical protein, clo... 72 2e-09
26ref|NM_001005843.1| Gallus gallus ubiquinol-cytochrome c reducta... 72 2e-09
27emb|AJ250370.1|CPA250370 Cyanophora paradoxa partial mRNA for ub... 70 8e-09
28gb|AY085370.1| Arabidopsis thaliana clone 1482 mRNA, complete se... 68 3e-08
29ref|NM_121346.2| Arabidopsis thaliana oxidoreductase/ ubiquinol-... 64 5e-07
30ref|XM_359684.1| Magnaporthe grisea 70-15 hypothetical protein (... 64 5e-07
31emb|AL163572.1|ATT22N19 Arabidopsis thaliana DNA chromosome 5, B... 64 5e-07
32gb|AF375413.1| Arabidopsis thaliana AT5g13430/T22N19_80 mRNA, co... 64 5e-07
33gb|AY066055.1| Arabidopsis thaliana AT5g13430/T22N19_80 mRNA, co... 64 5e-07
34dbj|AK221169.1| Arabidopsis thaliana mRNA for ubiquinol--cytochr... 64 5e-07
35emb|BX830387.1|CNS0A1JK Arabidopsis thaliana Full-length cDNA Co... 64 5e-07
36emb|BX829878.1|CNS0A1B9 Arabidopsis thaliana Full-length cDNA Co... 64 5e-07
37emb|BX831700.1|CNS0A14K Arabidopsis thaliana Full-length cDNA Co... 64 5e-07
38ref|XM_499709.1| Yarrowia lipolytica CLIB122, YALI0A02915g predi... 62 2e-06
39emb|X91795.1|CRUCCOR C.reinhardtii mRNa for ubiquinol-cytochrome... 62 2e-06
40emb|AJ320239.1|CRE320239 Chlamydomonas reinhardtii risp gene for... 62 2e-06
41emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB1... 62 2e-06
42ref|NM_121347.3| Arabidopsis thaliana oxidoreductase/ ubiquinol-... 60 8e-06
43gb|AY081510.1| Arabidopsis thaliana ubiquinol--cytochrome-c redu... 60 8e-06
44gb|AF370533.1|AF370533 Arabidopsis thaliana ubiquinol--cytochrom... 60 8e-06
45emb|BX829960.1|CNS0A1KF Arabidopsis thaliana Full-length cDNA Co... 60 8e-06
46emb|BX829847.1|CNS0A1CH Arabidopsis thaliana Full-length cDNA Co... 60 8e-06
47emb|BX833733.1|CNS0A0BW Arabidopsis thaliana Full-length cDNA Co... 60 8e-06
48gb|AY086148.1| Arabidopsis thaliana clone 21819 mRNA, complete s... 60 8e-06
49gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chr... 58 3e-05
50ref|XM_570926.1| Cryptococcus neoformans var. neoformans JEC21 u... 58 3e-05
51dbj|AP007175.1| Aspergillus oryzae RIB40 genomic DNA, SC010 58 3e-05
52gb|CP000081.1| Leishmania major chromosome 35, complete sequence 56 1e-04
53ref|XM_460873.1| Debaryomyces hansenii CBS767 hypothetical prote... 56 1e-04
54ref|XM_838166.1| Leishmania major strain Friedlin reiske iron-su... 56 1e-04
55emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS... 56 1e-04
56dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 56 1e-04
57gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 56 1e-04
58ref|NM_210148.1| Eremothecium gossypii AEL067Wp (AEL067W), mRNA 56 1e-04
59ref|XM_447387.1| Candida glabrata CBS138 hypothetical protein (C... 54 5e-04
60emb|CR380955.1| Candida glabrata strain CBS138 chromosome I comp... 54 5e-04
61dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 54 5e-04
62gb|AE005720.1| Caulobacter crescentus CB15 section 46 of 359 of ... 52 0.002
63emb|BX829679.1|CNS0A1GR Arabidopsis thaliana Full-length cDNA Co... 52 0.002
64emb|BX830982.1|CNS0A0P7 Arabidopsis thaliana Full-length cDNA Co... 52 0.002
65gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 50 0.007
66ref|XM_748490.1| Aspergillus fumigatus Af293 ubiquinol-cytochrom... 50 0.007
67ref|XM_957255.1| Neurospora crassa OR74A hypothetical protein (N... 48 0.029
68ref|XM_326460.1| Neurospora crassa OR74A hypothetical protein (N... 48 0.029
69gb|AC110374.3| Mus musculus BAC clone RP23-293P18 from 15, compl... 48 0.029
70emb|X02472.1|NCCYRFES Neurospora gene for mitochondrial ubiquino... 48 0.029
71gb|BC019934.1| Mus musculus ubiquinol-cytochrome c reductase, Ri... 46 0.11
72gb|BT010222.1| Drosophila melanogaster RH01528 full insert cDNA 46 0.11
73gb|DQ445508.1| Graphocephala atropunctata isolate WHGA0169 Riesk... 46 0.11
74emb|AL611944.10| Mouse DNA sequence from clone RP23-279E14 on ch... 46 0.11
75gb|DQ122922.1| Chlamydomonas incerta mitochondrial ubiquinol-cyt... 46 0.11
76ref|NM_164426.1| Drosophila melanogaster Rieske iron-sulfur prot... 46 0.11
77ref|NM_080009.2| Drosophila melanogaster Rieske iron-sulfur prot... 46 0.11
78dbj|AK152391.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 46 0.11
79gb|AC104630.1| Drosophila melanogaster, chromosome 2L, region 22... 46 0.11
80gb|CP000264.1| Jannaschia sp. CCS1, complete genome 46 0.11
81dbj|AK153139.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 46 0.11
82gb|AC092188.1|AC092188 Drosophila melanogaster, chromosome 2L, r... 46 0.11
83dbj|AK012180.1| Mus musculus 10 days embryo whole body cDNA, RIK... 46 0.11
84dbj|AK014470.1| Mus musculus 14 days embryo liver cDNA, RIKEN fu... 46 0.11
85dbj|AK003966.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 46 0.11
86ref|NM_025710.1| Mus musculus ubiquinol-cytochrome c reductase, ... 46 0.11
87dbj|AK217705.1| Mus musculus cDNA, clone:Y2G0142L01, strand:plus... 46 0.11
88dbj|AK212564.1| Mus musculus cDNA, clone:Y2G0125G04, strand:plus... 46 0.11
89dbj|AK210928.1| Mus musculus cDNA, clone:Y2G0120B13, strand:minu... 46 0.11
90dbj|AK180820.1| Mus musculus cDNA, clone:Y0G0116A06, strand:minu... 46 0.11
91gb|AE003585.5| Drosophila melanogaster chromosome 2L, section 6 ... 46 0.11
92gb|AC004445.1|AC004445 Drosophila melanogaster DNA sequence (P1 ... 46 0.11
93gb|BC047125.1| Mus musculus ubiquinol-cytochrome c reductase, Ri... 46 0.11
94ref|XM_654818.1| Aspergillus nidulans FGSC A4 hypothetical prote... 44 0.45
95gb|AY558341.1| Saccharomyces cerevisiae clone FLH111526.01X YEL0... 44 0.45
96ref|XM_754879.1| Ustilago maydis 521 hypothetical protein (UM038... 44 0.45
97ref|XM_385427.1| Gibberella zeae PH-1 chromosome 3 hypothetical ... 44 0.45
98emb|AL022104.2|SPBC16H5 S.pombe chromosome II cosmid c16H5 44 0.45
99dbj|AK221073.1| Arabidopsis thaliana mRNA for ubiquinol--cytochr... 44 0.45
100ref|NM_001021849.1| Schizosaccharomyces pombe 972h- hypothetical... 44 0.45
101emb|AL116266.1|CNS01D1U Botrytis cinerea strain T4 cDNA library 44 0.45
102emb|AL114037.1|CNS01BBX Botrytis cinerea strain T4 cDNA library 44 0.45
103emb|AL113155.1|CNS01ANF Botrytis cinerea strain T4 cDNA library 44 0.45
104emb|AL111908.1|CNS019OS Botrytis cinerea strain T4 cDNA library 44 0.45
105gb|U18530.1|SCE9871 Saccharomyces cerevisiae chromosome V cosmid... 44 0.45
106gb|AE004857.1| Pseudomonas aeruginosa PAO1, section 418 of 529 o... 44 0.45
107gb|U40480.1|SPU40480 Schizosaccharomyces pombe Rieske iron-sulfu... 44 0.45
108gb|M24500.1|YSCRIP1A S.cerevisiae Rieske iron-sulfur protein (RI... 44 0.45
109gb|M23316.1|YSCRIP1 Yeast (S.cerevisiae; DC5) Rieske iron-sulfur... 44 0.45
110gb|DQ213880.1| Taeniopygia guttata clone 0058P0044G07 ubiquinol-... 42 1.8
111gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence 42 1.8
112emb|AL365215.23| Human DNA sequence from clone RP11-416D8 on chr... 42 1.8
113emb|AL162455.14| Human DNA sequence from clone RP11-62D23 on chr... 42 1.8
114emb|AL626770.9| Mouse DNA sequence from clone RP23-379J18 on chr... 42 1.8
115gb|AC160031.8| Mus musculus 10 BAC RP24-395H7 (Roswell Park Canc... 42 1.8
116gb|AE009490.1| Brucella melitensis 16M chromosome I, section 47 ... 42 1.8
117gb|AF035964.1|AF035964 Brucella abortus tRNA/rRNA methyltransfer... 42 1.8
118gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I... 42 1.8
119emb|CT033644.1| Platynereis dumerilii EST IB0AAA16DC02EM1 42 1.8
120emb|CT033533.1| Platynereis dumerilii EST IB0AAA18DC05EM1 42 1.8
121emb|CT033153.1| Platynereis dumerilii EST IB0AAA25DC05EM1 42 1.8
122emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I,... 42 1.8
123gb|AC005591.1| Homo sapiens chromosome 16, P1 clone 94-10H (LANL... 40 7.0
124gb|BC020241.1| Homo sapiens cDNA clone IMAGE:4661475, with appar... 40 7.0
125emb|CR769784.10| Zebrafish DNA sequence from clone DKEY-3N10 in ... 40 7.0
126gb|AC092117.4| Homo sapiens chromosome 16 clone CTD-2270P14, com... 40 7.0
127gb|AC141586.2| Homo sapiens chromosome 16 clone CTD-3126B10, com... 40 7.0
128emb|CR752649.9| Zebrafish DNA sequence from clone DKEY-238J13, c... 40 7.0
129emb|AL607026.11| Human DNA sequence from clone RP11-498G22 on ch... 40 7.0
130emb|CR388002.6| Zebrafish DNA sequence from clone DKEY-75M8 in l... 40 7.0
131gb|CP000087.1| Rickettsia bellii RML369-C, complete genome 40 7.0
132emb|X05630.1|RCPETG Rhodopseudomonas capsulata petABC operon 40 7.0
133emb|X05799.1|PDBC1 P. denitrificans bc1 gene for cytochrome bc1 ... 40 7.0
134emb|X03476.1|RCFBC Rhodopseudomonas sphaeroides fbc operon (fbcF... 40 7.0
135emb|AL645564.6| Mouse DNA sequence from clone RP23-35N22 on chro... 40 7.0
136emb|BX511162.8| Zebrafish DNA sequence from clone DKEY-240B22 in... 40 7.0
137emb|BX323017.6| Zebrafish DNA sequence from clone DKEYP-41F9, co... 40 7.0
138emb|AJ785968.1| Homo sapiens mRNA for PDPK2 protein 40 7.0
139gb|AC068308.12| Homo sapiens 3 BAC RP11-275H4 (Roswell Park Canc... 40 7.0
140gb|AC068892.7| Homo sapiens chromosome 10 clone RP11-116D21, com... 40 7.0
141ref|XM_496112.2| PREDICTED: Homo sapiens similar to 3-phosphoino... 40 7.0
142ref|XM_935349.1| PREDICTED: Homo sapiens similar to 3-phosphoino... 40 7.0
143ref|XM_935348.1| PREDICTED: Homo sapiens similar to 3-phosphoino... 40 7.0
144gb|BC002659.1|BC002659 Homo sapiens, clone IMAGE:3609437, mRNA 40 7.0
145ref|XM_394267.2| PREDICTED: Apis mellifera similar to ENSANGP000... 40 7.0
146gb|AC092577.3| Homo sapiens BAC clone RP11-12E5 from 4, complete... 40 7.0
147gb|AC093517.3| Homo sapiens chromosome 16 clone CTD-2593F12, com... 40 7.0
148gb|AC093525.3| Homo sapiens chromosome 16 clone RP11-20I23, comp... 40 7.0
149dbj|AK197173.1| Mus musculus cDNA, clone:Y1G0124E03, strand:minu... 40 7.0
150dbj|AK191429.1| Mus musculus cDNA, clone:Y1G0105N20, strand:minu... 40 7.0
151dbj|AP006850.2| Oryza sativa (japonica cultivar-group) genomic D... 40 7.0
152dbj|AP005845.2| Oryza sativa (japonica cultivar-group) genomic D... 40 7.0
153gb|AC150478.3| Monodelphis domestica clone VMRC6-508P4, complete... 40 7.0
154gb|AC147872.3| Monodelphis domestica clone VMRC6-555H19, complet... 40 7.0
155emb|BX323453.7| Zebrafish DNA sequence from clone CH211-212G2 in... 40 7.0
156emb|AL138478.3|CNS01DWR Human chromosome 14 DNA sequence BAC R-6... 40 7.0
157emb|CR812957.13| Zebrafish DNA sequence from clone DKEY-41L5 in ... 40 7.0
158emb|AL954329.7| Zebrafish DNA sequence from clone CH211-226C11 i... 40 7.0
159gb|DP000021.1| Monodelphis domestica target 1 genomic scaffold 40 7.0
160emb|AL137785.6|CNS01DWN Human chromosome 14 DNA sequence BAC R-1... 40 7.0
161gb|M17522.1|PDEBC1 P.denitrificans bc1 operon genes encoding thr... 40 7.0

>tpg|BK005644.1| TPA: TPA_inf: Triticum aestivum histidine-containing
           phosphotransfer protein 2 (HP) mRNA, complete cds
          Length = 1212

 Score =  494 bits (249), Expect = e-136
 Identities = 280/289 (96%), Gaps = 1/289 (0%)
 Strand = Plus / Plus

                                                                       
Query: 5   aatatccttccgatagggtctcagaaaatcagtacaaagtaacttacaatccagtagcaa 64
           |||||||||||||||||||||||||||||||||| |||  ||||||||||||||||||||
Sbjct: 63  aatatccttccgatagggtctcagaaaatcagtataaaacaacttacaatccagtagcaa 122

                                                                       
Query: 65  cataggagaaacaattatttcgcactgcaaatgaacttcagtaggtaacagtggatcacc 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 123 cataggagaaacaattatttcgcactgcaaatgaacttcagtaggtaacagtggatcacc 182

                                                                       
Query: 125 attgtgatagtcctgaaacaaaaactcctagccacattgagaacaaaataacagcgcaac 184
            ||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 183 gttgcgatagtcctgaaacaaaaactcctagccacattgaaaacaaaataacagcgcaac 242

                                                                       
Query: 185 aggaattcactcctgtggagaatatatgttggtaggtactggtctttaggctcttagcct 244
           |||||||||||||||| |||||||||||| ||||||||||||| ||||||||||||||||
Sbjct: 243 aggaattcactcctgtcgagaatatatgtcggtaggtactggt-tttaggctcttagcct 301

                                                            
Query: 245 atgagcatcttgttatcttccaagaaactgtaggtgggcacctcaaggt 293
           |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 302 atgagcatcttgttatcttccaagaaactgtaggtgggcacctcaaggt 350



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  272 bits (137), Expect = 1e-69
 Identities = 242/277 (87%)
 Strand = Plus / Minus

                                                                            
Query: 232      aggctcttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaag 291
                |||||||||||||||||| | |||||| || ||||||||||||||||| || ||||| ||
Sbjct: 19696266 aggctcttagcctatgaggagcttgttctcctccaagaaactgtaggtagggacctccag 19696207

                                                                            
Query: 292      gttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggca 351
                |||| | || || ||||||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 19696206 gttgaatggagcggggcccttgcgaatcctgccagagatgtcgtagtgggagccatggca 19696147

                                                                            
Query: 352      cgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagt 411
                ||||||||||||||| || || |||||||  ||||| || || ||||||||||| || ||
Sbjct: 19696146 cgggcagaaccaacctccgaaatctccagcattggggagaggaatgcaaccaaggtgggt 19696087

                                                                            
Query: 412      gcagacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgg 471
                |||||| ||||| ||||| |||||||||||||||||||||||||| ||||| ||||  ||
Sbjct: 19696086 gcagacgccaatgaccactagccactctgggttcttcacacgctctgcgtcctgctgggg 19696027

                                                     
Query: 472      gtggcgcagggatgcaacatccacgctgttggccagc 508
                 |||||||||||  |||| |||||||| |||||||||
Sbjct: 19696026 atggcgcagggacccaacgtccacgctattggccagc 19695990



to top

>dbj|AK059519.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-C04, full
           insert sequence
          Length = 1242

 Score =  272 bits (137), Expect = 1e-69
 Identities = 242/277 (87%)
 Strand = Plus / Minus

                                                                       
Query: 232 aggctcttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaag 291
           |||||||||||||||||| | |||||| || ||||||||||||||||| || ||||| ||
Sbjct: 972 aggctcttagcctatgaggagcttgttctcctccaagaaactgtaggtagggacctccag 913

                                                                       
Query: 292 gttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggca 351
           |||| | || || ||||||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 912 gttgaatggagcggggcccttgcgaatcctgccagagatgtcgtagtgggagccatggca 853

                                                                       
Query: 352 cgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagt 411
           ||||||||||||||| || || |||||||  ||||| || || ||||||||||| || ||
Sbjct: 852 cgggcagaaccaacctccgaaatctccagcattggggagaggaatgcaaccaaggtgggt 793

                                                                       
Query: 412 gcagacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgg 471
           |||||| ||||| ||||| |||||||||||||||||||||||||| ||||| ||||  ||
Sbjct: 792 gcagacgccaatgaccactagccactctgggttcttcacacgctctgcgtcctgctgggg 733

                                                
Query: 472 gtggcgcagggatgcaacatccacgctgttggccagc 508
            |||||||||||  |||| |||||||| |||||||||
Sbjct: 732 atggcgcagggacccaacgtccacgctattggccagc 696



to top

>emb|AL731591.3|OSJN00240 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0039C07,
              complete sequence
          Length = 166410

 Score =  272 bits (137), Expect = 1e-69
 Identities = 242/277 (87%)
 Strand = Plus / Minus

                                                                          
Query: 232    aggctcttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaag 291
              |||||||||||||||||| | |||||| || ||||||||||||||||| || ||||| ||
Sbjct: 146992 aggctcttagcctatgaggagcttgttctcctccaagaaactgtaggtagggacctccag 146933

                                                                          
Query: 292    gttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggca 351
              |||| | || || ||||||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 146932 gttgaatggagcggggcccttgcgaatcctgccagagatgtcgtagtgggagccatggca 146873

                                                                          
Query: 352    cgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagt 411
              ||||||||||||||| || || |||||||  ||||| || || ||||||||||| || ||
Sbjct: 146872 cgggcagaaccaacctccgaaatctccagcattggggagaggaatgcaaccaaggtgggt 146813

                                                                          
Query: 412    gcagacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgg 471
              |||||| ||||| ||||| |||||||||||||||||||||||||| ||||| ||||  ||
Sbjct: 146812 gcagacgccaatgaccactagccactctgggttcttcacacgctctgcgtcctgctgggg 146753

                                                   
Query: 472    gtggcgcagggatgcaacatccacgctgttggccagc 508
               |||||||||||  |||| |||||||| |||||||||
Sbjct: 146752 atggcgcagggacccaacgtccacgctattggccagc 146716



to top

>gb|BT018238.1| Zea mays clone EL01N0563B05.c mRNA sequence
          Length = 971

 Score =  268 bits (135), Expect = 2e-68
 Identities = 246/283 (86%)
 Strand = Plus / Minus

                                                                       
Query: 234 gctcttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaaggt 293
           ||||||| ||||||||||  ||||| || ||||||||||||||||| || ||||| ||||
Sbjct: 790 gctcttaacctatgagcagtttgttctcctccaagaaactgtaggtcgggacctcgaggt 731

                                                                       
Query: 294 tgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacg 353
           || |||| ||||||||||||||||| || || || |||||||||||||| |||||||| |
Sbjct: 730 tgaacggcgcagggcccttgcggatcctcccggatatgtcgtagtgggaaccatggcatg 671

                                                                       
Query: 354 ggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgc 413
           |||||||||| || ||||||||||| | ||| || || |||||||| || || |||||||
Sbjct: 670 ggcagaaccagccgccaaagtctccggcgttcggtagtgggatgcagccgaggtgagtgc 611

                                                                       
Query: 414 agacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgggt 473
           | || ||||| |||||||||||||| || |||||||||||||| || || ||||||||||
Sbjct: 610 acacgccaatgaccaccagccactcgggattcttcacacgctctgcatcctgctctgggt 551

                                                      
Query: 474 ggcgcagggatgcaacatccacgctgttggccagcttgatgtc 516
           ||||||||||||| |||||||| |||||||| |||||||||||
Sbjct: 550 ggcgcagggatgccacatccacactgttggcaagcttgatgtc 508



to top

>ref|XM_472343.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 837

 Score =  260 bits (131), Expect = 4e-66
 Identities = 236/271 (87%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaaggttgta 297
           |||||||||||| | |||||| || ||||||||||||||||| || ||||| |||||| |
Sbjct: 837 ttagcctatgaggagcttgttctcctccaagaaactgtaggtagggacctccaggttgaa 778

                                                                       
Query: 298 cggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggca 357
            || || ||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 777 tggagcggggcccttgcgaatcctgccagagatgtcgtagtgggagccatggcacgggca 718

                                                                       
Query: 358 gaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagac 417
           ||||||||| || || |||||||  ||||| || || ||||||||||| || ||||||||
Sbjct: 717 gaaccaacctccgaaatctccagcattggggagaggaatgcaaccaaggtgggtgcagac 658

                                                                       
Query: 418 accaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgggtggcg 477
            ||||| ||||| |||||||||||||||||||||||||| ||||| ||||  || |||||
Sbjct: 657 gccaatgaccactagccactctgggttcttcacacgctctgcgtcctgctggggatggcg 598

                                          
Query: 478 cagggatgcaacatccacgctgttggccagc 508
           ||||||  |||| |||||||| |||||||||
Sbjct: 597 cagggacccaacgtccacgctattggccagc 567



to top

>gb|AY109584.1| Zea mays CL2436_1 mRNA sequence
          Length = 1746

 Score =  260 bits (131), Expect = 4e-66
 Identities = 245/283 (86%)
 Strand = Plus / Minus

                                                                        
Query: 237  cttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaaggttgt 296
            |||||||||||||||  ||||| || ||||||||||||||||| || ||||| |||||| 
Sbjct: 1439 cttagcctatgagcagtttgttctcctccaagaaactgtaggtagggacctcgaggttga 1380

                                                                        
Query: 297  acggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggc 356
            |||| ||||||||||||||||| || || || ||||| |||||||| |||||||| ||||
Sbjct: 1379 acggcgcagggcccttgcggatcctcccggaaatgtcatagtgggaaccatggcatgggc 1320

                                                                        
Query: 357  agaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcaga 416
            ||||||| || ||||||||||| |  || || || |||||||| || || || ||||| |
Sbjct: 1319 agaaccagccgccaaagtctccggcattaggtagtgggatgcagccgaggtgcgtgcaca 1260

                                                                        
Query: 417  caccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgggtggc 476
            | ||||| |||||||||||||| ||||||||||||||||| || || |||||||||||||
Sbjct: 1259 cgccaatgaccaccagccactcagggttcttcacacgctctgcatcctgctctgggtggc 1200

                                                       
Query: 477  gcagggatgcaacatccacgctgttggccagcttgatgtcatc 519
            |||||||||| |||||||| |||||||| ||||||||||||||
Sbjct: 1199 gcagggatgccacatccacactgttggcaagcttgatgtcatc 1157



to top

>gb|M77224.1|MZERFESPA Zea mays mitochondrial Rieske Fe-S protein mRNA, complete cds
          Length = 1197

 Score =  258 bits (130), Expect = 2e-65
 Identities = 247/286 (86%)
 Strand = Plus / Minus

                                                                       
Query: 234 gctcttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaaggt 293
           |||||||||||| |||||  ||||| || ||||||||||||||||| || ||||| ||||
Sbjct: 933 gctcttagcctacgagcagtttgttctcctccaagaaactgtaggtagggacctcgaggt 874

                                                                       
Query: 294 tgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacg 353
           || |||| ||||||||||||||||| || || || ||||| |||||||| |||||||| |
Sbjct: 873 tgaacggcgcagggcccttgcggatcctcccggaaatgtcatagtgggaaccatggcatg 814

                                                                       
Query: 354 ggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgc 413
           |||||||||| || ||||||||||| |  || || || |||||||| || || || ||||
Sbjct: 813 ggcagaaccagccgccaaagtctccggcattaggtagtgggatgcagccgaggtgcgtgc 754

                                                                       
Query: 414 agacaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgggt 473
           | || ||||| |||||||||||||| ||||||||||||||||| || || ||||||||||
Sbjct: 753 acacgccaatgaccaccagccactcagggttcttcacacgctctgcatcctgctctgggt 694

                                                         
Query: 474 ggcgcagggatgcaacatccacgctgttggccagcttgatgtcatc 519
           ||||||||||||| |||||||| |||||||| ||||||||||||||
Sbjct: 693 ggcgcagggatgccacatccacactgttggcaagcttgatgtcatc 648



to top

>gb|BT017520.1| Zea mays clone EL01N0421A02.c mRNA sequence
          Length = 1172

 Score =  256 bits (129), Expect = 6e-65
 Identities = 240/277 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 tcttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaaggttg 295
           ||||| ||||||||||  ||||| || ||||||||||||||||| || ||||| ||||||
Sbjct: 900 tcttaacctatgagcagtttgttctcctccaagaaactgtaggtcgggacctcgaggttg 841

                                                                       
Query: 296 tacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacggg 355
            |||||||||||||||||||||| || || || |||| ||||||||| |||||||| |||
Sbjct: 840 aacggggcagggcccttgcggatcctcccggatatgtagtagtgggaaccatggcatggg 781

                                                                       
Query: 356 cagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcag 415
           |||||||| || ||||||||||| | ||| || || ||||||||||| || |||||||| 
Sbjct: 780 cagaaccagccgccaaagtctccggcgttcggtagtgggatgcaaccgaggtgagtgcac 721

                                                                       
Query: 416 acaccaataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgggtgg 475
           || ||||| |||||||||||||| || |||||||||||||  || || ||||||||||||
Sbjct: 720 acgccaatgaccaccagccactcgggattcttcacacgctatgcatcctgctctgggtgg 661

                                                
Query: 476 cgcagggatgcaacatccacgctgttggccagcttga 512
           ||||||||||| |||||||| |||||||| |||||||
Sbjct: 660 cgcagggatgccacatccacactgttggcaagcttga 624



to top

>gb|AY105531.1| Zea mays PCO113958 mRNA sequence
          Length = 1217

 Score =  206 bits (104), Expect = 5e-50
 Identities = 236/280 (84%)
 Strand = Plus / Minus

                                                                       
Query: 240 agcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacg 299
           |||| ||||| | |||||| ||||||||||| ||||| || ||||| || |||||| | |
Sbjct: 960 agccgatgagaagcttgttctcttccaagaagctgtatgtcggcacttccaggttgaagg 901

                                                                       
Query: 300 gggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcaga 359
           | || |||||||||||||| || ||||| ||||||||||| ||||| |||||||||||||
Sbjct: 900 gtgccgggcccttgcggatcctaccagaaatgtcgtagtgcgagccgtggcacgggcaga 841

                                                                       
Query: 360 accaaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacac 419
           |||| |||||||||||||| |  || || || |||||||| || || ||||||||||| |
Sbjct: 840 accagccaccaaagtctcctgcattagggagcgggatgcagcccaggtgagtgcagaccc 781

                                                                       
Query: 420 caataaccaccagccactctgggttcttcacacgctcagcgtcttgctctgggtggcgca 479
           |||| || |||||||| || |||||||| || ||||| || ||||||||||||||||| |
Sbjct: 780 caatgacgaccagccattcggggttcttgacgcgctctgcatcttgctctgggtggcgga 721

                                                   
Query: 480 gggatgcaacatccacgctgttggccagcttgatgtcatc 519
           ||||||| || || || |||||||||| |||||| |||||
Sbjct: 720 gggatgcgacgtcaacactgttggccaacttgatatcatc 681



to top

>gb|DQ207870.1| Solanum tuberosum clone 087E11 rieske iron-sulfur protein-like
           mRNA, complete cds
          Length = 1098

 Score =  119 bits (60), Expect = 9e-24
 Identities = 105/120 (87%)
 Strand = Plus / Minus

                                                                       
Query: 253 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 312
           |||||| |||||||||||||||||||| |||||||| || || ||||| || || || ||
Sbjct: 841 cttgttctcttccaagaaactgtaggtaggcacctccagattatacggtgcgggtccttt 782

                                                                       
Query: 313 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 372
           ||| || || |||||||||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 781 gcgaatcctaccagagatgtcgtaatgggagccatggcatgggcaaaaccaaccaccaaa 722



to top

>gb|BT014059.1| Lycopersicon esculentum clone 133157F, mRNA sequence
          Length = 1087

 Score =  113 bits (57), Expect = 6e-22
 Identities = 156/189 (82%)
 Strand = Plus / Minus

                                                                       
Query: 253 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 312
           |||||| |||||||||||||||||||| |||||||| || || ||||| || || || ||
Sbjct: 853 cttgttctcttccaagaaactgtaggtaggcacctccagattatacggtgcgggtccttt 794

                                                                       
Query: 313 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 372
           ||| || || |||||||||||||| || ||||||||||| ||||| ||||||||||||||
Sbjct: 793 gcgaatcctaccagagatgtcgtaatgagagccatggcatgggcaaaaccaaccaccaaa 734

                                                                       
Query: 373 gtctccagagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccag 432
            || ||||  || || |  || ||||| || |||||||| || || |||| |||||| ||
Sbjct: 733 atcaccagcatttggtaaaggaatgcaccctagatgagtacataccccaacaaccacaag 674

                    
Query: 433 ccactctgg 441
           ||| |||||
Sbjct: 673 ccattctgg 665



to top

>emb|X79332.1|STFES1G S.tuberosum (Desiree) FeS1 mRNA for Rieske iron-sulfur protein
          Length = 993

 Score =  111 bits (56), Expect = 2e-21
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                       
Query: 253 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 312
           |||||| |||||||||||||| ||||| |||||||| || || ||||| || || || ||
Sbjct: 804 cttgttctcttccaagaaactataggtaggcacctccagattatacggtgcgggtccttt 745

                                                                       
Query: 313 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 372
           ||| || || |||||||||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 744 gcgaatcctaccagagatgtcgtaatgggagccatggcatgggcaaaaccaaccaccaaa 685



to top

>gb|M77225.1|TOBRFESP Nicotiana tabacum mitochondrial Rieske Fe-S protein mRNA, complete
           cds
          Length = 956

 Score =  109 bits (55), Expect = 9e-21
 Identities = 160/195 (82%)
 Strand = Plus / Minus

                                                                       
Query: 253 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 312
           |||||| || |||| |||||| || || |||||||| || || || || ||||| |||||
Sbjct: 762 cttgttctcctccaggaaactataagtaggcacctccagattatatggtgcaggtccctt 703

                                                                       
Query: 313 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 372
           |||||| || ||||||||||| || |||||||| ||||| ||||| ||||||||||||||
Sbjct: 702 gcggatcctaccagagatgtcataatgggagccgtggcaagggcaaaaccaaccaccaaa 643

                                                                       
Query: 373 gtctccagagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccag 432
            || ||||  || || |  || ||||| |||||||| ||||| || ||||||||||| ||
Sbjct: 642 atcaccagcatttggcaaaggaatgcacccaagatgggtgcataccccaataaccacaag 583

                          
Query: 433 ccactctgggttctt 447
           ||| ||||| |||||
Sbjct: 582 ccattctggattctt 568



to top

>ref|XM_466001.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1157

 Score =  107 bits (54), Expect = 4e-20
 Identities = 132/158 (83%)
 Strand = Plus / Minus

                                                                       
Query: 290 aggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatgg 349
           |||||||| || ||||||||||| |||||||| || || || || || || || ||||||
Sbjct: 857 aggttgtatggtgcagggcccttacggattctacctgatatatcataatgtgatccatgg 798

                                                                       
Query: 350 cacgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatga 409
           || || |||||||| ||||||||||| |||| ||||||||| || ||||| || ||||||
Sbjct: 797 catggacagaaccagccaccaaagtcaccagcgttgggaagtggaatgcagcccagatga 738

                                                 
Query: 410 gtgcagacaccaataaccaccagccactctgggttctt 447
           || || || ||||| || ||||||||||| ||||||||
Sbjct: 737 gtacacaccccaatcacaaccagccactcagggttctt 700



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  107 bits (54), Expect = 4e-20
 Identities = 132/158 (83%)
 Strand = Plus / Plus

                                                                            
Query: 290      aggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatgg 349
                |||||||| || ||||||||||| |||||||| || || || || || || || ||||||
Sbjct: 19000643 aggttgtatggtgcagggcccttacggattctacctgatatatcataatgtgatccatgg 19000702

                                                                            
Query: 350      cacgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatga 409
                || || |||||||| ||||||||||| |||| ||||||||| || ||||| || ||||||
Sbjct: 19000703 catggacagaaccagccaccaaagtcaccagcgttgggaagtggaatgcagcccagatga 19000762

                                                      
Query: 410      gtgcagacaccaataaccaccagccactctgggttctt 447
                || || || ||||| || ||||||||||| ||||||||
Sbjct: 19000763 gtacacaccccaatcacaaccagccactcagggttctt 19000800



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 31       aatcagtacaaagtaacttacaat 54
                ||||| ||||||||||||||||||
Sbjct: 18847869 aatcaatacaaagtaacttacaat 18847892



to top

>dbj|AP005842.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBb0003H22
          Length = 68256

 Score =  107 bits (54), Expect = 4e-20
 Identities = 132/158 (83%)
 Strand = Plus / Plus

                                                                         
Query: 290   aggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatgg 349
             |||||||| || ||||||||||| |||||||| || || || || || || || ||||||
Sbjct: 55964 aggttgtatggtgcagggcccttacggattctacctgatatatcataatgtgatccatgg 56023

                                                                         
Query: 350   cacgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatga 409
             || || |||||||| ||||||||||| |||| ||||||||| || ||||| || ||||||
Sbjct: 56024 catggacagaaccagccaccaaagtcaccagcgttgggaagtggaatgcagcccagatga 56083

                                                   
Query: 410   gtgcagacaccaataaccaccagccactctgggttctt 447
             || || || ||||| || ||||||||||| ||||||||
Sbjct: 56084 gtacacaccccaatcacaaccagccactcagggttctt 56121



to top

>dbj|AP005749.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OSJNBa0047A17
          Length = 149142

 Score =  107 bits (54), Expect = 4e-20
 Identities = 132/158 (83%)
 Strand = Plus / Plus

                                                                        
Query: 290  aggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatgg 349
            |||||||| || ||||||||||| |||||||| || || || || || || || ||||||
Sbjct: 6164 aggttgtatggtgcagggcccttacggattctacctgatatatcataatgtgatccatgg 6223

                                                                        
Query: 350  cacgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatga 409
            || || |||||||| ||||||||||| |||| ||||||||| || ||||| || ||||||
Sbjct: 6224 catggacagaaccagccaccaaagtcaccagcgttgggaagtggaatgcagcccagatga 6283

                                                  
Query: 410  gtgcagacaccaataaccaccagccactctgggttctt 447
            || || || ||||| || ||||||||||| ||||||||
Sbjct: 6284 gtacacaccccaatcacaaccagccactcagggttctt 6321



to top

>dbj|AK102815.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033108M09, full
           insert sequence
          Length = 1157

 Score =  107 bits (54), Expect = 4e-20
 Identities = 132/158 (83%)
 Strand = Plus / Minus

                                                                       
Query: 290 aggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatgg 349
           |||||||| || ||||||||||| |||||||| || || || || || || || ||||||
Sbjct: 857 aggttgtatggtgcagggcccttacggattctacctgatatatcataatgtgatccatgg 798

                                                                       
Query: 350 cacgggcagaaccaaccaccaaagtctccagagttgggaagggggatgcaaccaagatga 409
           || || |||||||| ||||||||||| |||| ||||||||| || ||||| || ||||||
Sbjct: 797 catggacagaaccagccaccaaagtcaccagcgttgggaagtggaatgcagcccagatga 738

                                                 
Query: 410 gtgcagacaccaataaccaccagccactctgggttctt 447
           || || || ||||| || ||||||||||| ||||||||
Sbjct: 737 gtacacaccccaatcacaaccagccactcagggttctt 700



to top

>gb|L16813.1|TOBFESD Nicotiana tabacum clone 32.10 Rieske iron-sulfur protein mRNA,
           complete cds; mitochondrial
          Length = 1121

 Score =  105 bits (53), Expect = 1e-19
 Identities = 155/189 (82%)
 Strand = Plus / Minus

                                                                       
Query: 253 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 312
           |||||| || |||| |||||||||||| |||||||| || || || || ||||| || ||
Sbjct: 891 cttgttctcctccatgaaactgtaggtaggcacctccagattatatggcgcaggtccttt 832

                                                                       
Query: 313 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 372
           ||| || || ||||||||||| |||||||| |||||||| ||||| ||||||||||||||
Sbjct: 831 gcgaatcctaccagagatgtcatagtgggaaccatggcatgggcaaaaccaaccaccaaa 772

                                                                       
Query: 373 gtctccagagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccag 432
            || ||||  || || |  || ||||| || ||||||||||| || || |||||||| ||
Sbjct: 771 atcaccagcatttggtaaaggtatgcaccctagatgagtgcataccccgataaccacaag 712

                    
Query: 433 ccactctgg 441
           ||| |||||
Sbjct: 711 ccattctgg 703



to top

>gb|L16812.1|TOBFESC Nicotiana tabacum clone 36.14 Rieske iron-sulfur protein mRNA,
            complete cds; mitochondrial
          Length = 1286

 Score =  105 bits (53), Expect = 1e-19
 Identities = 155/189 (82%)
 Strand = Plus / Minus

                                                                        
Query: 253  cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 312
            |||||| ||||||| |||||| || || |||||||| || || || || ||||| |||||
Sbjct: 1014 cttgttctcttccaggaaactataagtaggcacctccagattatatggtgcaggtccctt 955

                                                                        
Query: 313  gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 372
            |||||| || ||||||||||| || |||||||| ||||| ||||| ||||||||||||||
Sbjct: 954  gcggatcctaccagagatgtcataatgggagccgtggcaagggcaaaaccaaccaccaaa 895

                                                                        
Query: 373  gtctccagagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccag 432
             || || |  || || |  || ||||| |||||||| ||||| || ||||||||||| ||
Sbjct: 894  atcaccggcatttggcaaaggaatgcacccaagatgggtgcataccccaataaccacaag 835

                     
Query: 433  ccactctgg 441
            ||| |||||
Sbjct: 834  ccattctgg 826



to top

>gb|L16810.1|TOBFESA Nicotiana tabacum clone 17.12 Rieske iron-sulfur protein mRNA,
           complete cds; mitochondrial
          Length = 1210

 Score =  105 bits (53), Expect = 1e-19
 Identities = 155/189 (82%)
 Strand = Plus / Minus

                                                                       
Query: 253 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 312
           |||||| ||||||| |||||| || || |||||||| || || || || ||||| |||||
Sbjct: 954 cttgttctcttccaggaaactataagtaggcacctccagattatatggtgcaggtccctt 895

                                                                       
Query: 313 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 372
           |||||| || ||||||||||| || |||||||| ||||| ||||| ||||||||||||||
Sbjct: 894 gcggatcctaccagagatgtcataatgggagccgtggcaagggcaaaaccaaccaccaaa 835

                                                                       
Query: 373 gtctccagagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccag 432
            || || |  || || |  || ||||| |||||||| ||||| || ||||||||||| ||
Sbjct: 834 atcaccggcatttggcaaaggaatgcacccaagatgggtgcataccccaataaccacaag 775

                    
Query: 433 ccactctgg 441
           ||| |||||
Sbjct: 774 ccattctgg 766



to top

>gb|L16811.1|TOBFESB Nicotiana tabacum clone 8.8 Rieske iron-sulfur protein mRNA,
           complete cds; mitochondrial
          Length = 1202

 Score =  103 bits (52), Expect = 6e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 253 cttgttatcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggccctt 312
           |||||| || |||| |||||||||||| |||||||| || || || || ||||| || ||
Sbjct: 907 cttgttctcctccatgaaactgtaggtaggcacctccagattatatggtgcaggtccttt 848

                                                                       
Query: 313 gcggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 372
           ||| || || ||||||||||| ||||||||||||||||| ||||| ||||||||||||||
Sbjct: 847 gcgaatcctaccagagatgtcatagtgggagccatggcatgggcaaaaccaaccaccaaa 788



to top

>dbj|D21116.1|RICSS126 Oryza sativa mRNA for Rieske Fe-S protein, partial sequence
          Length = 299

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 112/135 (82%)
 Strand = Plus / Minus

                                                                       
Query: 374 tctccagagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagc 433
           |||||||  ||||| || || ||||||||||| || |||||||| | ||| ||||| |||
Sbjct: 296 tctccagcattggggagaggaatgcaaccaaggtgggtgcagacgcnaatgaccactagc 237

                                                                       
Query: 434 cactctgggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatcc 493
           |||||||||||||| |||||||| ||||| ||||  |  |||||||||||   ||| |||
Sbjct: 236 cactctgggttcttnacacgctctgcgtcctgctgggaatggcgcagggaccnaacgtcc 177

                          
Query: 494 acgctgttggccagc 508
           ||||| |||||||||
Sbjct: 176 acgctattggccagc 162



to top

>emb|AJ719669.1| Gallus gallus mRNA for hypothetical protein, clone 5b19
          Length = 1070

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 117/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 274 gtaggtgggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtc 333
           |||||| || ||||| ||||| || |||||||| || || | |||||||||||||   ||
Sbjct: 845 gtaggttggaacctccaggttatagggggcaggacctttcctgattctgccagaggcatc 786

                                                                       
Query: 334 gtagtgggagccatggcacgggcagaaccaaccaccaaagtctccagagttgggaagggg 393
            || ||||| || |||||||||||| |  |||||||||| ||||||||||| | ||  ||
Sbjct: 785 ataatgggacccgtggcacgggcagtaataaccaccaaaatctccagagttagcaattgg 726

                                   
Query: 394 gatgcaaccaagatgagtgcagac 417
            |  ||||||||||||||||||||
Sbjct: 725 tacacaaccaagatgagtgcagac 702



to top

>ref|NM_001005843.1| Gallus gallus ubiquinol-cytochrome c reductase, Rieske iron-sulfur
           polypeptide 1 (UQCRFS1), mRNA
          Length = 1070

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 117/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 274 gtaggtgggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtc 333
           |||||| || ||||| ||||| || |||||||| || || | |||||||||||||   ||
Sbjct: 845 gtaggttggaacctccaggttatagggggcaggacctttcctgattctgccagaggcatc 786

                                                                       
Query: 334 gtagtgggagccatggcacgggcagaaccaaccaccaaagtctccagagttgggaagggg 393
            || ||||| || |||||||||||| |  |||||||||| ||||||||||| | ||  ||
Sbjct: 785 ataatgggacccgtggcacgggcagtaataaccaccaaaatctccagagttagcaattgg 726

                                   
Query: 394 gatgcaaccaagatgagtgcagac 417
            |  ||||||||||||||||||||
Sbjct: 725 tacacaaccaagatgagtgcagac 702



to top

>emb|AJ250370.1|CPA250370 Cyanophora paradoxa partial mRNA for ubiquinol-cytochrome C
           reductase iron-sulfur subunit precursor (risp gene)
          Length = 836

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 281 ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgg 340
           |||||||| |||||   ||| ||||||||||| ||||| | ||| |||||||||||||||
Sbjct: 635 ggcacctccaggttaagcggcgcagggcccttccggatgcggccggagatgtcgtagtgg 576

                                  
Query: 341 gagccatggcacgggcagaacca 363
             ||| |||||||||||||||||
Sbjct: 575 ctgccgtggcacgggcagaacca 553



to top

>gb|AY085370.1| Arabidopsis thaliana clone 1482 mRNA, complete sequence
          Length = 1068

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 478 cagggatgcaacatccacgctgttggccagcttgatgtcatc 519
           ||||||| |||||||||| |||||||||||||||||||||||
Sbjct: 684 cagggatccaacatccacactgttggccagcttgatgtcatc 643



to top

>ref|NM_121346.2| Arabidopsis thaliana oxidoreductase/ ubiquinol-cytochrome-c
           reductase AT5G13430 mRNA, complete cds
          Length = 1222

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 203/260 (78%)
 Strand = Plus / Minus

                                                                       
Query: 260 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 319
           ||||||| ||| |||||||| || || || |||||||| || ||||| || || |  |||
Sbjct: 911 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 852

                                                                       
Query: 320 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 379
           || ||||| || ||||| || || || || ||||| || |||||||||||| | || |||
Sbjct: 851 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 792

                                                                       
Query: 380 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 439
           |  || || | ||||||||| || | ||||||||| || |||| |||||| | ||| |||
Sbjct: 791 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccactaaccattct 732

                                                                       
Query: 440 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 499
           || ||||| || |   | | |||||  | |||||  | ||||||| |||||||||| || 
Sbjct: 731 ggattcttgaccctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 672

                               
Query: 500 ttggccagcttgatgtcatc 519
           ||||||||||||||||||||
Sbjct: 671 ttggccagcttgatgtcatc 652



to top

>ref|XM_359684.1| Magnaporthe grisea 70-15 hypothetical protein (MG05093.4) partial
           mRNA
          Length = 711

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 329 atgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctccagagttggga 388
           ||||||||||| || || ||||| |||||||||||||| |||||||| ||||  | |  |
Sbjct: 620 atgtcgtagtgagatccgtggcaggggcagaaccaaccgccaaagtcgccagcctcgcca 561

                                           
Query: 389 agggggatgcaaccaagatgagtgcagacacc 420
           | |||||  ||||||||||| |||||||||||
Sbjct: 560 atggggacacaaccaagatgtgtgcagacacc 529



to top

>emb|AL163572.1|ATT22N19 Arabidopsis thaliana DNA chromosome 5, BAC clone T22N19 (ESSA project)
          Length = 68948

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 203/260 (78%)
 Strand = Plus / Plus

                                                                         
Query: 260   tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 319
             ||||||| ||| |||||||| || || || |||||||| || ||||| || || |  |||
Sbjct: 48600 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 48659

                                                                         
Query: 320   ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 379
             || ||||| || ||||| || || || || ||||| || |||||||||||| | || |||
Sbjct: 48660 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 48719

                                                                         
Query: 380   gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 439
             |  || || | ||||||||| || | ||||||||| || |||| |||||| | ||| |||
Sbjct: 48720 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccactaaccattct 48779

                                                                         
Query: 440   gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 499
             || ||||| || |   | | |||||  | |||||  | ||||||| |||||||||| || 
Sbjct: 48780 ggattcttgaccctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 48839

                                 
Query: 500   ttggccagcttgatgtcatc 519
             ||||||||||||||||||||
Sbjct: 48840 ttggccagcttgatgtcatc 48859



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                       
Query: 478   cagggatgcaacatccacgctgttggccagcttgatgtcatc 519
             ||||||| |||||||||| || ||||||||||||||||||||
Sbjct: 51835 cagggatccaacatccacactattggccagcttgatgtcatc 51876



to top

>gb|AF375413.1| Arabidopsis thaliana AT5g13430/T22N19_80 mRNA, complete cds
          Length = 1067

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 203/260 (78%)
 Strand = Plus / Minus

                                                                       
Query: 260 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 319
           ||||||| ||| |||||||| || || || |||||||| || ||||| || || |  |||
Sbjct: 877 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 818

                                                                       
Query: 320 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 379
           || ||||| || ||||| || || || || ||||| || |||||||||||| | || |||
Sbjct: 817 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 758

                                                                       
Query: 380 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 439
           |  || || | ||||||||| || | ||||||||| || |||| |||||| | ||| |||
Sbjct: 757 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccactaaccattct 698

                                                                       
Query: 440 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 499
           || ||||| || |   | | |||||  | |||||  | ||||||| |||||||||| || 
Sbjct: 697 ggattcttgaccctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 638

                               
Query: 500 ttggccagcttgatgtcatc 519
           ||||||||||||||||||||
Sbjct: 637 ttggccagcttgatgtcatc 618



to top

>gb|AY066055.1| Arabidopsis thaliana AT5g13430/T22N19_80 mRNA, complete cds
          Length = 819

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 203/260 (78%)
 Strand = Plus / Minus

                                                                       
Query: 260 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 319
           ||||||| ||| |||||||| || || || |||||||| || ||||| || || |  |||
Sbjct: 797 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 738

                                                                       
Query: 320 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 379
           || ||||| || ||||| || || || || ||||| || |||||||||||| | || |||
Sbjct: 737 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 678

                                                                       
Query: 380 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 439
           |  || || | ||||||||| || | ||||||||| || |||| |||||| | ||| |||
Sbjct: 677 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccactaaccattct 618

                                                                       
Query: 440 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 499
           || ||||| || |   | | |||||  | |||||  | ||||||| |||||||||| || 
Sbjct: 617 ggattcttgaccctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 558

                               
Query: 500 ttggccagcttgatgtcatc 519
           ||||||||||||||||||||
Sbjct: 557 ttggccagcttgatgtcatc 538



to top

>dbj|AK221169.1| Arabidopsis thaliana mRNA for ubiquinol--cytochrome-c reductase
           -like protein, partial cds, clone: RAFL22-96-P11
          Length = 800

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 203/260 (78%)
 Strand = Plus / Minus

                                                                       
Query: 260 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 319
           ||||||||||| |||||||| || || || |||||||| || ||||| || || |  |||
Sbjct: 521 tcttccaagaagctgtaggtcggtacttccaggttgtatggtgcaggacctttcctaatt 462

                                                                       
Query: 320 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 379
           || ||||| || ||||| || || || || ||||| || |||||||||||| | || |||
Sbjct: 461 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 402

                                                                       
Query: 380 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 439
           |  || || | ||||||||| || | ||||||||| || ||||  || | || |||||||
Sbjct: 401 gcattaggcaaggggatgcaccccaaatgagtgcatactccaaccacgatcaaccactct 342

                                                                       
Query: 440 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 499
           || ||||| || |   | | |||||  | |||||  | ||||||| |||||||||| || 
Sbjct: 341 ggattcttgactctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 282

                               
Query: 500 ttggccagcttgatgtcatc 519
           ||||||||||||||||||||
Sbjct: 281 ttggccagcttgatgtcatc 262



to top

>emb|BX830387.1|CNS0A1JK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB77ZD09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1011

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 203/260 (78%)
 Strand = Plus / Minus

                                                                       
Query: 260 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 319
           ||||||| ||| |||||||| || || || |||||||| || ||||| || || |  |||
Sbjct: 829 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 770

                                                                       
Query: 320 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 379
           || ||||| || ||||| || || || || ||||| || |||||||||||| | || |||
Sbjct: 769 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 710

                                                                       
Query: 380 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 439
           |  || || | ||||||||| || | ||||||||| || |||| |||||| | ||| |||
Sbjct: 709 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccactaaccattct 650

                                                                       
Query: 440 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 499
           || ||||| || |   | | |||||  | |||||  | ||||||| |||||||||| || 
Sbjct: 649 ggattcttgaccctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 590

                               
Query: 500 ttggccagcttgatgtcatc 519
           ||||||||||||||||||||
Sbjct: 589 ttggccagcttgatgtcatc 570



to top

>emb|BX829878.1|CNS0A1B9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB42ZG11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1031

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 203/260 (78%)
 Strand = Plus / Minus

                                                                       
Query: 260 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 319
           ||||||| ||| |||||||| || || || |||||||| || ||||| || || |  |||
Sbjct: 866 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 807

                                                                       
Query: 320 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 379
           || ||||| || ||||| || || || || ||||| || |||||||||||| | || |||
Sbjct: 806 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 747

                                                                       
Query: 380 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 439
           |  || || | ||||||||| || | ||||||||| || |||| |||||| | ||| |||
Sbjct: 746 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccactaaccattct 687

                                                                       
Query: 440 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 499
           || ||||| || |   | | |||||  | |||||  | ||||||| |||||||||| || 
Sbjct: 686 ggattcttgaccctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 627

                               
Query: 500 ttggccagcttgatgtcatc 519
           ||||||||||||||||||||
Sbjct: 626 ttggccagcttgatgtcatc 607



to top

>emb|BX831700.1|CNS0A14K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH24ZF01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 542

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 203/260 (78%)
 Strand = Plus / Minus

                                                                       
Query: 260 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 319
           ||||||| ||| |||||||| || || || |||||||| || ||||| || || |  |||
Sbjct: 322 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 263

                                                                       
Query: 320 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 379
           || ||||| || ||||| || || || || ||||| || |||||||||||| | || |||
Sbjct: 262 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 203

                                                                       
Query: 380 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccaccagccactct 439
           |  || || | ||||||||| || | ||||||||| || |||| |||||| | ||| |||
Sbjct: 202 gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccactaaccattct 143

                                                                       
Query: 440 gggttcttcacacgctcagcgtcttgctctgggtggcgcagggatgcaacatccacgctg 499
           || ||||| || |   | | |||||  | |||||  | ||||||| |||||||||| || 
Sbjct: 142 ggattcttgaccctaaccgagtcttcttgtgggtccctcagggatccaacatccacacta 83

                               
Query: 500 ttggccagcttgatgtcatc 519
           ||||||||||||||||||||
Sbjct: 82  ttggccagcttgatgtcatc 63



to top

>ref|XM_499709.1| Yarrowia lipolytica CLIB122, YALI0A02915g predicted mRNA
          Length = 678

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 314 cggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaag 373
           ||||||| ||| || |||||||| ||||| || ||||| ||||||||||| || ||||||
Sbjct: 602 cggattcggccggaaatgtcgtaatgggatccgtggcaggggcagaaccagccgccaaag 543

                  
Query: 374 tctccag 380
           |||||||
Sbjct: 542 tctccag 536



to top

>emb|X91795.1|CRUCCOR C.reinhardtii mRNa for ubiquinol-cytochrome c oxidoreductase
          Length = 1447

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 281 ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgg 340
           |||||||| |||||||| ||||| |||||||  |  || | ||| |||||||||||||||
Sbjct: 869 ggcacctccaggttgtatggggcggggccctccctaatgcggcccgagatgtcgtagtgg 810

                                  
Query: 341 gagccatggcacgggcagaacca 363
             ||| |||||||||||||||||
Sbjct: 809 ctgccgtggcacgggcagaacca 787



to top

>emb|AJ320239.1|CRE320239 Chlamydomonas reinhardtii risp gene for ubiquinol-cytochrome c
            reductase, exons 1-5
          Length = 2847

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                        
Query: 281  ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgg 340
            |||||||| |||||||| ||||| |||||||  |  || | ||| |||||||||||||||
Sbjct: 2208 ggcacctccaggttgtatggggcggggccctccctaatgcggcccgagatgtcgtagtgg 2149

                                   
Query: 341  gagccatggcacgggcagaacca 363
              ||| |||||||||||||||||
Sbjct: 2148 ctgccgtggcacgggcagaacca 2126



to top

>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica
          Length = 2303261

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                          
Query: 314    cggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaag 373
              ||||||| ||| || |||||||| ||||| || ||||| ||||||||||| || ||||||
Sbjct: 346295 cggattcggccggaaatgtcgtaatgggatccgtggcaggggcagaaccagccgccaaag 346236

                     
Query: 374    tctccag 380
              |||||||
Sbjct: 346235 tctccag 346229



to top

>ref|NM_121347.3| Arabidopsis thaliana oxidoreductase/ ubiquinol-cytochrome-c
           reductase AT5G13440 mRNA, complete cds
          Length = 1286

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 478 cagggatgcaacatccacgctgttggccagcttgatgtcatc 519
           ||||||| |||||||||| || ||||||||||||||||||||
Sbjct: 744 cagggatccaacatccacactattggccagcttgatgtcatc 703



to top

>gb|AY081510.1| Arabidopsis thaliana ubiquinol--cytochrome-c reductase-like protein
           (At5g13440) mRNA, complete cds
          Length = 932

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 478 cagggatgcaacatccacgctgttggccagcttgatgtcatc 519
           ||||||| |||||||||| || ||||||||||||||||||||
Sbjct: 585 cagggatccaacatccacactattggccagcttgatgtcatc 544



to top

>gb|AF370533.1|AF370533 Arabidopsis thaliana ubiquinol--cytochrome-c reductase-like protein
           (T22N19_90) mRNA, complete cds
          Length = 1080

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 478 cagggatgcaacatccacgctgttggccagcttgatgtcatc 519
           ||||||| |||||||||| || ||||||||||||||||||||
Sbjct: 641 cagggatccaacatccacactattggccagcttgatgtcatc 600



to top

>emb|BX829960.1|CNS0A1KF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB49ZG05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1003

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 478 cagggatgcaacatccacgctgttggccagcttgatgtcatc 519
           ||||||| |||||||||| || ||||||||||||||||||||
Sbjct: 600 cagggatccaacatccacactattggccagcttgatgtcatc 559



to top

>emb|BX829847.1|CNS0A1CH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB40ZE04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1039

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 478 cagggatgcaacatccacgctgttggccagcttgatgtcatc 519
           ||||||| |||||||||| || ||||||||||||||||||||
Sbjct: 649 cagggatccaacatccacactattggccagcttgatgtcatc 608



to top

>emb|BX833733.1|CNS0A0BW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL74ZC05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 992

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 478 cagggatgcaacatccacgctgttggccagcttgatgtcatc 519
           ||||||| |||||||||| || ||||||||||||||||||||
Sbjct: 649 cagggatccaacatccacactattggccagcttgatgtcatc 608



to top

>gb|AY086148.1| Arabidopsis thaliana clone 21819 mRNA, complete sequence
          Length = 1226

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 478 cagggatgcaacatccacgctgttggccagcttgatgtcatc 519
           ||||||| |||||||||| || ||||||||||||||||||||
Sbjct: 745 cagggatccaacatccacactattggccagcttgatgtcatc 704



to top

>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete
              sequence
          Length = 1507550

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                   
Query: 314    cggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaacc 366
              ||||||| |||||| |||||||||||||| || ||||| || |||||||||||
Sbjct: 627810 cggattcggccagaaatgtcgtagtgggaaccgtggcaaggacagaaccaacc 627862



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 398    caaccaagatgagtgcagacaccaa 422
              ||||||||||| |||||||||||||
Sbjct: 627953 caaccaagatgtgtgcagacaccaa 627977



to top

>ref|XM_570926.1| Cryptococcus neoformans var. neoformans JEC21 ubiquinol-cytochrome
           c reductase iron-sulfur subunit, mitochondrial precursor
           (CNE02310) partial mRNA
          Length = 840

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 314 cggattctgccagagatgtcgtagtgggagccatggcacgggcagaaccaacc 366
           ||||||| |||||| |||||||||||||| || ||||| || |||||||||||
Sbjct: 761 cggattcggccagaaatgtcgtagtgggaaccgtggcaaggacagaaccaacc 709



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 398 caaccaagatgagtgcagacaccaa 422
           ||||||||||| |||||||||||||
Sbjct: 677 caaccaagatgtgtgcagacaccaa 653



to top

>dbj|AP007175.1| Aspergillus oryzae RIB40 genomic DNA, SC010
          Length = 2039961

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                           
Query: 299     ggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 358
               |||||||| ||||| | ||| | ||| |||||||||||||| || || ||||| ||||||
Sbjct: 1276830 ggggcaggacccttcctgatacggccggagatgtcgtagtgagaaccgtggcaggggcag 1276771

                                
Query: 359     aaccaaccaccaaagtc 375
               ||||| || ||||||||
Sbjct: 1276770 aaccagccgccaaagtc 1276754



to top

>gb|CP000081.1| Leishmania major chromosome 35, complete sequence
          Length = 2090491

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                          
Query: 281    ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgg 340
              ||||||||||||||   |||||||||||| | |||||| | ||| |||  ||||||||||
Sbjct: 666939 ggcacctcaaggttcagcggggcagggccttggcggatacggccggaggggtcgtagtgg 666998

                                  
Query: 341    gagccatggcacgggcagaa 360
                ||| ||||||||||||||
Sbjct: 666999 ctgccgtggcacgggcagaa 667018



to top

>ref|XM_460873.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0F12771g)
           partial mRNA
          Length = 477

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 317 attctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 372
           ||||| |||||||| |||||||| || ||||| || || |||||||||||||||||
Sbjct: 398 attctaccagagatatcgtagtgagaaccatgacaaggacagaaccaaccaccaaa 343



to top

>ref|XM_838166.1| Leishmania major strain Friedlin reiske iron-sulfur protein
           precursor (LMJ_1083) partial mRNA
          Length = 894

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgg 340
           ||||||||||||||   |||||||||||| | |||||| | ||| |||  ||||||||||
Sbjct: 845 ggcacctcaaggttcagcggggcagggccttggcggatacggccggaggggtcgtagtgg 786

                               
Query: 341 gagccatggcacgggcagaa 360
             ||| ||||||||||||||
Sbjct: 785 ctgccgtggcacgggcagaa 766



to top

>emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces
               hansenii
          Length = 2336804

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317     attctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaa 372
               ||||| |||||||| |||||||| || ||||| || || |||||||||||||||||
Sbjct: 1023322 attctaccagagatatcgtagtgagaaccatgacaaggacagaaccaaccaccaaa 1023267



to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                       
Query: 308     cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaacca 363
               ||||||||||| | ||| ||| | |||||||| || ||||||||||||||||||||
Sbjct: 4489680 cccttgcggatgcggccggaggtatcgtagtgcgatccatggcacgggcagaacca 4489625



to top

>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V,
              complete sequence
          Length = 1519138

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                          
Query: 332    tcgtagtgggagccatggcacgggcagaaccaaccaccaaagtc 375
              ||||||||||| || ||||| ||||||||||| |||||||||||
Sbjct: 508718 tcgtagtgggaaccgtggcatgggcagaaccagccaccaaagtc 508675



to top

>ref|NM_210148.1| Eremothecium gossypii AEL067Wp (AEL067W), mRNA
          Length = 639

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 332 tcgtagtgggagccatggcacgggcagaaccaaccaccaaagtc 375
           ||||||||||| || ||||| ||||||||||| |||||||||||
Sbjct: 548 tcgtagtgggaaccgtggcatgggcagaaccagccaccaaagtc 505



to top

>ref|XM_447387.1| Candida glabrata CBS138 hypothetical protein (CAGL0I03190g) partial
           mRNA
          Length = 642

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 317 attctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtc 375
           ||||| |||||||| |||||||| || || || || ||||||||||||||||| |||||
Sbjct: 566 attctaccagagatatcgtagtgagaaccgtgacaagggcagaaccaaccaccgaagtc 508



to top

>emb|CR380955.1| Candida glabrata strain CBS138 chromosome I complete sequence
          Length = 1089401

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                         
Query: 317    attctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtc 375
              ||||| |||||||| |||||||| || || || || ||||||||||||||||| |||||
Sbjct: 274057 attctaccagagatatcgtagtgagaaccgtgacaagggcagaaccaaccaccgaagtc 274115



to top

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                          
Query: 305     gggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaacca 363
               ||||| |||||||| | ||| | | ||||||| || |||||||||||||||||||||||
Sbjct: 2177333 gggcctttgcggatgcggccggcggtgtcgtactgcgagccatggcacgggcagaacca 2177391



to top

>gb|AE005720.1| Caulobacter crescentus CB15 section 46 of 359 of the complete genome
          Length = 11816

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                        
Query: 302  gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 361
            ||||||||||| ||||| |  || ||| |||||||||| ||||| ||||| |||||||||
Sbjct: 5564 gcagggcccttacggatacgacccgaggtgtcgtagtgcgagccgtggcaggggcagaac 5505

              
Query: 362  ca 363
            ||
Sbjct: 5504 ca 5503



to top

>emb|BX829679.1|CNS0A1GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB29ZG10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1095

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 478 cagggatgcaacatccacgctgttggccagcttgatgt 515
           ||||||| |||||||||| || ||||||||||||||||
Sbjct: 649 cagggatccaacatccacactattggccagcttgatgt 612



to top

>emb|BX830982.1|CNS0A0P7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS45ZG07 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1231

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 486 caacatccacgctgttggccagcttgatgtcatc 519
           |||||||||| || ||||||||||||||||||||
Sbjct: 681 caacatccacactattggccagcttgatgtcatc 648



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 89/111 (80%)
 Strand = Plus / Minus

                                                                       
Query: 260 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 319
           ||||||||||| |||||||| || || || |||||||| || ||||| || || |  |||
Sbjct: 907 tcttccaagaagctgtaggtcggtacttccaggttgtatggtgcaggacctttcctaatt 848

                                                              
Query: 320 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccacca 370
           || ||||| || ||||| || || || || ||||| || ||||||||||||
Sbjct: 847 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacca 797



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                   
Query: 311    ttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaacca 363
              |||||||| | ||||||| | |||||||| ||||| ||||| |||||||||||
Sbjct: 288687 ttgcggatccggccagaggtatcgtagtgcgagccgtggcaggggcagaacca 288635



to top

>ref|XM_748490.1| Aspergillus fumigatus Af293 ubiquinol-cytochrome c reductase
           iron-sulfur subunit precursor (Afu5g10610) partial mRNA
          Length = 897

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 299 ggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 358
           |||||||| ||||| ||||| | ||| ||||| || |||||||| || ||||| ||||||
Sbjct: 836 ggggcaggacccttccggatacggccggagatatcatagtgggaaccgtggcaggggcag 777

                
Query: 359 aacca 363
           |||||
Sbjct: 776 aacca 772



to top

>ref|XM_957255.1| Neurospora crassa OR74A hypothetical protein (NCU06606.1) partial
           mRNA
          Length = 696

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 322 gccagagatgtcgtagtgggagccatggcacgggcagaaccaaccacc 369
           ||||||||| |||||||| || || ||||| ||||||||||| |||||
Sbjct: 612 gccagagatatcgtagtgagaaccgtggcaagggcagaaccagccacc 565



to top

>ref|XM_326460.1| Neurospora crassa OR74A hypothetical protein (NCU06606.1) partial
           mRNA
          Length = 696

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 322 gccagagatgtcgtagtgggagccatggcacgggcagaaccaaccacc 369
           ||||||||| |||||||| || || ||||| ||||||||||| |||||
Sbjct: 612 gccagagatatcgtagtgagaaccgtggcaagggcagaaccagccacc 565



to top

>gb|AC110374.3| Mus musculus BAC clone RP23-293P18 from 15, complete sequence
          Length = 199869

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 203    agaatatatgttggtaggtactgg 226
              ||||||||||||||||||||||||
Sbjct: 143079 agaatatatgttggtaggtactgg 143056



to top

>emb|X02472.1|NCCYRFES Neurospora gene for mitochondrial ubiquinol-cytochrome c reductase
            iron-sulfur subunit
          Length = 1790

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 322  gccagagatgtcgtagtgggagccatggcacgggcagaaccaaccacc 369
            ||||||||| |||||||| || || ||||| ||||||||||| |||||
Sbjct: 1401 gccagagatatcgtagtgagaaccgtggcaagggcagaaccagccacc 1354



to top

>gb|BC019934.1| Mus musculus ubiquinol-cytochrome c reductase, Rieske iron-sulfur
           polypeptide 1, mRNA (cDNA clone MGC:30985
           IMAGE:5249225), complete cds
          Length = 1194

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 302 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 361
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 837 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 778

                                                                      
Query: 362 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 420
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 777 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 719



to top

>gb|BT010222.1| Drosophila melanogaster RH01528 full insert cDNA
          Length = 931

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 308 cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 358
           ||||||||||| || || |||  ||||||||||||||| ||||| ||||||
Sbjct: 767 cccttgcggatccttccggaggcgtcgtagtgggagccgtggcaggggcag 717



to top

>gb|DQ445508.1| Graphocephala atropunctata isolate WHGA0169 Rieske iron-sulfur
           protein 1 mRNA, complete cds
          Length = 819

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 65/79 (82%)
 Strand = Plus / Minus

                                                                       
Query: 302 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 361
           ||||| |||||||||||||  |||||    |||||||||||||||||||| || ||| | 
Sbjct: 755 gcaggtcccttgcggattcgaccagaagcatcgtagtgggagccatggcaaggacagtaa 696

                              
Query: 362 caaccaccaaagtctccag 380
            | ||||||||||| ||||
Sbjct: 695 tatccaccaaagtcaccag 677



to top

>emb|AL611944.10| Mouse DNA sequence from clone RP23-279E14 on chromosome 13 Contains the
             gene for the ortholog of rat and human
             ubiquinol-cytochrome c reductase, Rieske iron-sulfur
             polypeptide 1 UQCRFS1, a novel gene and a CpG island,
             complete sequence
          Length = 194065

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 95/119 (79%)
 Strand = Plus / Plus

                                                                         
Query: 302   gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 361
             ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 77295 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 77354

                                                                        
Query: 362   caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 420
              | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 77355 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 77413



to top

>gb|DQ122922.1| Chlamydomonas incerta mitochondrial ubiquinol-cytochrome c
           oxidoreductase (RisP) mRNA, partial cds; nuclear gene
           for mitochondrial product
          Length = 921

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 281 ggcacctcaaggttgtacggggcagggcccttgcggattctgccagagatgtcgtagtgg 340
           ||||| || |||||||| ||||| |||||||  || || | ||| || ||||||||||||
Sbjct: 593 ggcacttccaggttgtagggggcggggccctcccgaatgcggcccgaaatgtcgtagtgg 534

                                  
Query: 341 gagccatggcacgggcagaacca 363
             ||| ||||| |||||||||||
Sbjct: 533 ctgccgtggcaggggcagaacca 511



to top

>ref|NM_164426.1| Drosophila melanogaster Rieske iron-sulfur protein CG7361-RB,
           transcript variant B (RFeSP), mRNA
          Length = 883

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 308 cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 358
           ||||||||||| || || |||  ||||||||||||||| ||||| ||||||
Sbjct: 729 cccttgcggatccttccggaggcgtcgtagtgggagccgtggcaggggcag 679



to top

>ref|NM_080009.2| Drosophila melanogaster Rieske iron-sulfur protein CG7361-RA,
           transcript variant A (RFeSP), mRNA
          Length = 938

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 308 cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 358
           ||||||||||| || || |||  ||||||||||||||| ||||| ||||||
Sbjct: 784 cccttgcggatccttccggaggcgtcgtagtgggagccgtggcaggggcag 734



to top

>dbj|AK152391.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830067N02
           product:ubiquinol-cytochrome c reductase, Rieske
           iron-sulfur polypeptide 1, full insert sequence
          Length = 1200

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 302 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 361
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 842 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 783

                                                                      
Query: 362 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 420
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 782 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 724



to top

>gb|AC104630.1| Drosophila melanogaster, chromosome 2L, region 22B-22C, BAC clone
              BACR19B15, complete sequence
          Length = 180088

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                                 
Query: 308    cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 358
              ||||||||||| || || |||  ||||||||||||||| ||||| ||||||
Sbjct: 142560 cccttgcggatccttccggaggcgtcgtagtgggagccgtggcaggggcag 142510



to top

>gb|CP000264.1| Jannaschia sp. CCS1, complete genome
          Length = 4317977

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                                 
Query: 330    tgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctccag 380
              |||| ||||| ||||| ||||| ||||||||||| ||||| ||||| ||||
Sbjct: 331091 tgtcatagtgagagccgtggcaggggcagaaccagccaccgaagtcaccag 331041



to top

>dbj|AK153139.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830124H22
           product:ubiquinol-cytochrome c reductase, Rieske
           iron-sulfur polypeptide 1, full insert sequence
          Length = 1084

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 302 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 361
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 817 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 758

                                                                      
Query: 362 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 420
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 757 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 699



to top

>gb|AC092188.1|AC092188 Drosophila melanogaster, chromosome 2L, region 22B-22C, BAC clone
             BACR28O09, complete sequence
          Length = 177326

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                                
Query: 308   cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 358
             ||||||||||| || || |||  ||||||||||||||| ||||| ||||||
Sbjct: 32613 cccttgcggatccttccggaggcgtcgtagtgggagccgtggcaggggcag 32563



to top

>dbj|AK012180.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610528M22
           product:UBIQUINOL-CYTOCHROME C REDUCTASE IRON-SULFUR
           SUBUNIT, MITOCHONDRIAL PRECURSOR (EC 1.10.2.2) (RIESKE
           IRON-SULFUR PROTEIN) (RISP) [CONTAINS:
           UBIQUINOL-CYTOCHROME C REDUCTASE 8 KDA PROTEIN (COMPLEX
           III SUBUNIT IX)] homolog [Bos taurus], full insert
           sequence
          Length = 1048

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 302 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 361
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 781 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 722

                                                                      
Query: 362 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 420
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 721 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 663



to top

>dbj|AK014470.1| Mus musculus 14 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:4430402G14 product:UBIQUINOL-CYTOCHROME C
           REDUCTASE IRON-SULFUR SUBUNIT, MITOCHONDRIAL PRECURSOR
           (EC 1.10.2.2) (RIESKE IRON-SULFUR PROTEIN) (RISP)
           [CONTAINS: UBIQUINOL-CYTOCHROME C REDUCTASE 8 KDA
           PROTEIN (COMPLEX III SUBUNIT IX)] homolog [Bos taurus],
           full insert sequence
          Length = 1316

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 302 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 361
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 833 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 774

                                                                      
Query: 362 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 420
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 773 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 715



to top

>dbj|AK003966.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1110030B05
           product:ubiquinol-cytochrome c reductase, Rieske
           iron-sulfur polypeptide 1, full insert sequence
          Length = 1060

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 302 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 361
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 793 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 734

                                                                      
Query: 362 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 420
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 733 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 675



to top

>ref|NM_025710.1| Mus musculus ubiquinol-cytochrome c reductase, Rieske iron-sulfur
           polypeptide 1 (Uqcrfs1), mRNA
          Length = 1316

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 302 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 361
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 833 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 774

                                                                      
Query: 362 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 420
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 773 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 715



to top

>dbj|AK217705.1| Mus musculus cDNA, clone:Y2G0142L01, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000042834, based on BLAT search
          Length = 378

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 302 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 361
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 327 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 268

                                                                      
Query: 362 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 420
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 267 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 209



to top

>dbj|AK212564.1| Mus musculus cDNA, clone:Y2G0125G04, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000042834, based on BLAT search
          Length = 336

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 302 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 361
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 327 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 268

                                                                      
Query: 362 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 420
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 267 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 209



to top

>dbj|AK210928.1| Mus musculus cDNA, clone:Y2G0120B13, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000042834, based on BLAT search
          Length = 384

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 302 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 361
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 315 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 256

                                                                      
Query: 362 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 420
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 255 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 197



to top

>dbj|AK180820.1| Mus musculus cDNA, clone:Y0G0116A06, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000042834, based on BLAT search
          Length = 435

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 302 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 361
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 366 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 307

                                                                      
Query: 362 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 420
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 306 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 248



to top

>gb|AE003585.5| Drosophila melanogaster chromosome 2L, section 6 of 83 of the complete
             sequence
          Length = 343161

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                
Query: 308   cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 358
             ||||||||||| || || |||  ||||||||||||||| ||||| ||||||
Sbjct: 71472 cccttgcggatccttccggaggcgtcgtagtgggagccgtggcaggggcag 71522



to top

>gb|AC004445.1|AC004445 Drosophila melanogaster DNA sequence (P1 DS00445 (D93)), complete
             sequence
          Length = 61852

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                
Query: 308   cccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 358
             ||||||||||| || || |||  ||||||||||||||| ||||| ||||||
Sbjct: 27766 cccttgcggatccttccggaggcgtcgtagtgggagccgtggcaggggcag 27816



to top

>gb|BC047125.1| Mus musculus ubiquinol-cytochrome c reductase, Rieske iron-sulfur
           polypeptide 1, mRNA (cDNA clone IMAGE:5009388)
          Length = 1194

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 302 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaac 361
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||  | 
Sbjct: 837 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggcaataa 778

                                                                      
Query: 362 caaccaccaaagtctccagagttgggaagggggatgcaaccaagatgagtgcagacacc 420
            | |||||||| ||||| | ||| | || ||| |  |||||||||||||| ||||||||
Sbjct: 777 tagccaccaaaatctcctgcgtttgcaatgggtacacaaccaagatgagtacagacacc 719



to top

>ref|XM_654818.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN2306.2), mRNA
          Length = 717

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 326 gagatgtcgtagtgggagccatggcacgggcagaacca 363
           ||||| |||||||| || |||||||| |||||||||||
Sbjct: 629 gagatatcgtagtgcgaaccatggcaggggcagaacca 592



to top

>gb|AY558341.1| Saccharomyces cerevisiae clone FLH111526.01X YEL024W gene, complete
           cds
          Length = 648

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                       
Query: 299 ggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 358
           |||||||| ||||| | |||||| || || || || || || || |||||||| || |||
Sbjct: 590 ggggcaggtccctttctgattctaccggaaatatcataatgtgaaccatggcaaggacag 531

                         
Query: 359 aaccaaccaccaaa 372
           ||||||||||||||
Sbjct: 530 aaccaaccaccaaa 517



to top

>ref|XM_754879.1| Ustilago maydis 521 hypothetical protein (UM03825.1) partial mRNA
          Length = 1236

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                              
Query: 326  gagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtc 375
            |||||||||||||| || || ||||| |||||| |||| || ||||||||
Sbjct: 1145 gagatgtcgtagtgcgaaccgtggcaagggcagtaccagccgccaaagtc 1096



to top

>ref|XM_385427.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG05251.1)
           partial mRNA
          Length = 708

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 317 attctgccagagatgtcgtagtgggagccatggcacgggcagaaccaacc 366
           |||| ||| ||||| |||||||| || || ||||| ||||||||||||||
Sbjct: 629 attcggccggagatatcgtagtgagaaccgtggcaagggcagaaccaacc 580



to top

>emb|AL022104.2|SPBC16H5 S.pombe chromosome II cosmid c16H5
          Length = 35660

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 398   caaccaagatgagtgcagacaccaat 423
             |||||||||||||| |||||||||||
Sbjct: 20415 caaccaagatgagtacagacaccaat 20440



to top

>dbj|AK221073.1| Arabidopsis thaliana mRNA for ubiquinol--cytochrome-c reductase
           -like protein, partial cds, clone: RAFL22-79-D17
          Length = 414

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 133/170 (78%)
 Strand = Plus / Minus

                                                                       
Query: 260 tcttccaagaaactgtaggtgggcacctcaaggttgtacggggcagggcccttgcggatt 319
           ||||||| ||| |||||||| || || || |||||||| || ||||| || || |  |||
Sbjct: 217 tcttccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaatt 158

                                                                       
Query: 320 ctgccagagatgtcgtagtgggagccatggcacgggcagaaccaaccaccaaagtctcca 379
           || ||||| || ||||| || || || || ||||| || |||||||||||| | || |||
Sbjct: 157 cttccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccaccataatcacca 98

                                                             
Query: 380 gagttgggaagggggatgcaaccaagatgagtgcagacaccaataaccac 429
           |  || || | ||||||||| || | ||||||||| || |||| ||||||
Sbjct: 97  gcattaggcaaggggatgcaccccaaatgagtgcacactccaacaaccac 48



to top

>ref|NM_001021849.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPBC16H5.06),
           partial mRNA
          Length = 687

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 398 caaccaagatgagtgcagacaccaat 423
           |||||||||||||| |||||||||||
Sbjct: 530 caaccaagatgagtacagacaccaat 505



to top

>emb|AL116266.1|CNS01D1U Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 401 ccaagatgagtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcg 460
           |||||||| |||||||||||||  |  |||| ||| ||||| ||||| ||||| ||||||
Sbjct: 260 ccaagatgtgtgcagacaccaaccatgaccaaccattctggcttcttaacacggtcagcg 201

             
Query: 461 tc 462
           ||
Sbjct: 200 tc 199



to top

>emb|AL114037.1|CNS01BBX Botrytis cinerea strain T4 cDNA library
          Length = 480

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 401 ccaagatgagtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcg 460
           |||||||| |||||||||||||  |  |||| ||| ||||| ||||| ||||| ||||||
Sbjct: 164 ccaagatgtgtgcagacaccaaccatgaccaaccattctggcttcttaacacggtcagcg 105

             
Query: 461 tc 462
           ||
Sbjct: 104 tc 103



to top

>emb|AL113155.1|CNS01ANF Botrytis cinerea strain T4 cDNA library
          Length = 780

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 401 ccaagatgagtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcg 460
           |||||||| |||||||||||||  |  |||| ||| ||||| ||||| ||||| ||||||
Sbjct: 273 ccaagatgtgtgcagacaccaaccatgaccaaccattctggcttcttaacacggtcagcg 214

             
Query: 461 tc 462
           ||
Sbjct: 213 tc 212



to top

>emb|AL111908.1|CNS019OS Botrytis cinerea strain T4 cDNA library
          Length = 480

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 401 ccaagatgagtgcagacaccaataaccaccagccactctgggttcttcacacgctcagcg 460
           |||||||| |||||||||||||  |  |||| ||| ||||| ||||| ||||| ||||||
Sbjct: 151 ccaagatgtgtgcagacaccaaccatgaccaaccattctggcttcttaacacggtcagcg 92

             
Query: 461 tc 462
           ||
Sbjct: 91  tc 90



to top

>gb|U18530.1|SCE9871 Saccharomyces cerevisiae chromosome V cosmids 9871, 8199, 9867, 9495
             and lambda clones 6693 and 5898
          Length = 62643

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                         
Query: 299   ggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 358
             |||||||| ||||| | |||||| || || || || || || || |||||||| || |||
Sbjct: 18255 ggggcaggtccctttctgattctaccggaaatatcataatgtgaaccatggcaaggacag 18196

                           
Query: 359   aaccaaccaccaaa 372
             ||||||||||||||
Sbjct: 18195 aaccaaccaccaaa 18182



to top

>gb|AE004857.1| Pseudomonas aeruginosa PAO1, section 418 of 529 of the complete
            genome
          Length = 10948

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 331  gtcgtagtgggagccatggcacgggcagaa 360
            ||||||||||||||| ||||| ||||||||
Sbjct: 8029 gtcgtagtgggagccgtggcaagggcagaa 8058



to top

>gb|U40480.1|SPU40480 Schizosaccharomyces pombe Rieske iron-sulfur protein (Rip1) mRNA,
           complete cds
          Length = 746

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 398 caaccaagatgagtgcagacaccaat 423
           |||||||||||||| |||||||||||
Sbjct: 584 caaccaagatgagtacagacaccaat 559



to top

>gb|M24500.1|YSCRIP1A S.cerevisiae Rieske iron-sulfur protein (RIP1) gene, complete cds
          Length = 1238

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                       
Query: 299 ggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 358
           |||||||| ||||| | |||||| || || || || || || || |||||||| || |||
Sbjct: 912 ggggcaggtccctttctgattctaccggaaatatcataatgtgaaccatggcaaggacag 853

                         
Query: 359 aaccaaccaccaaa 372
           ||||||||||||||
Sbjct: 852 aaccaaccaccaaa 839



to top

>gb|M23316.1|YSCRIP1 Yeast (S.cerevisiae; DC5) Rieske iron-sulfur protein gene, complete
           cds
          Length = 1238

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                       
Query: 299 ggggcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 358
           |||||||| ||||| | |||||| || || || || || || || |||||||| || |||
Sbjct: 912 ggggcaggtccctttctgattctaccggaaatatcataatgtgaaccatggcaaggacag 853

                         
Query: 359 aaccaaccaccaaa 372
           ||||||||||||||
Sbjct: 852 aaccaaccaccaaa 839



to top

>gb|DQ213880.1| Taeniopygia guttata clone 0058P0044G07 ubiquinol-cytochrome c
           reductase variant 2-like mRNA, complete sequence
          Length = 1028

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 302 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggcag 358
           |||||||| || | ||| |||||||||  ||| ||||||||||| ||||| ||||||
Sbjct: 776 gcagggcctttcctgatcctgccagaggcgtcatagtgggagccgtggcaggggcag 720



to top

>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence
          Length = 2107794

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 341     gagccatggcacgggcagaaccaaccaccaaag 373
               ||||||||||| ||||||||||| || ||||||
Sbjct: 1492402 gagccatggcaagggcagaaccagccgccaaag 1492434



to top

>emb|AL365215.23| Human DNA sequence from clone RP11-416D8 on chromosome 10 Contains
            the 5' end of the RSU1 gene for Ras suppressor protein 1,
            the 3' end of the CUBN gene for cubilin (intrinsic
            factor-cobalamin receptor) and a CpG island, complete
            sequence
          Length = 184703

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 130  gatagtcctgaaacaaaaact 150
            |||||||||||||||||||||
Sbjct: 8605 gatagtcctgaaacaaaaact 8625



to top

>emb|AL162455.14| Human DNA sequence from clone RP11-62D23 on chromosome 13 Contains part
             of the GPC6 gene for glypican 6 and a novel gene, complete
             sequence
          Length = 173736

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 257   ttatcttccaagaaactgtag 277
             |||||||||||||||||||||
Sbjct: 64421 ttatcttccaagaaactgtag 64401



to top

>emb|AL626770.9| Mouse DNA sequence from clone RP23-379J18 on chromosome 11 Contains a
             novel gene and a serine/arginine repetitive matrix 1
             (Srrm1) pseudogene, complete sequence
          Length = 188854

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 183   acaggaattcactcctgtgga 203
             |||||||||||||||||||||
Sbjct: 42009 acaggaattcactcctgtgga 42029



to top

>gb|AC160031.8| Mus musculus 10 BAC RP24-395H7 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 191028

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 184    caggaattcactcctgtggag 204
              |||||||||||||||||||||
Sbjct: 129345 caggaattcactcctgtggag 129325



to top

>gb|AE009490.1| Brucella melitensis 16M chromosome I, section 47 of 195 of the
           complete sequence
          Length = 11036

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 341 gagccatggcacgggcagaaccaaccaccaaag 373
           ||||||||||| ||||||||||| || ||||||
Sbjct: 626 gagccatggcaagggcagaaccagccgccaaag 594



to top

>gb|AF035964.1|AF035964 Brucella abortus tRNA/rRNA methyltransferase (yibK), ATP-binding
            protein A (bapA), ATP-binding protein B (bapB), and
            Rieske Fe-S protein genes, complete cds; and cytochrome b
            gene, partial cds
          Length = 5692

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 341  gagccatggcacgggcagaaccaaccaccaaag 373
            ||||||||||| ||||||||||| || ||||||
Sbjct: 5224 gagccatggcaagggcagaaccagccgccaaag 5192



to top

>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence
          Length = 2124241

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 341     gagccatggcacgggcagaaccaaccaccaaag 373
               ||||||||||| ||||||||||| || ||||||
Sbjct: 1510465 gagccatggcaagggcagaaccagccgccaaag 1510497



to top

>emb|CT033644.1| Platynereis dumerilii EST IB0AAA16DC02EM1
          Length = 957

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 299 ggggcagggcccttgcggattctgccaga 327
           ||||| || ||||||||||||||||||||
Sbjct: 804 ggggcgggtcccttgcggattctgccaga 776



to top

>emb|CT033533.1| Platynereis dumerilii EST IB0AAA18DC05EM1
          Length = 864

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 299 ggggcagggcccttgcggattctgccaga 327
           ||||| || ||||||||||||||||||||
Sbjct: 826 ggggcgggtcccttgcggattctgccaga 798



to top

>emb|CT033153.1| Platynereis dumerilii EST IB0AAA25DC05EM1
          Length = 915

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 299 ggggcagggcccttgcggattctgccaga 327
           ||||| || ||||||||||||||||||||
Sbjct: 793 ggggcgggtcccttgcggattctgccaga 765



to top

>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence, strain
               2308
          Length = 2121359

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 341     gagccatggcacgggcagaaccaaccaccaaag 373
               ||||||||||| ||||||||||| || ||||||
Sbjct: 1507619 gagccatggcaagggcagaaccagccgccaaag 1507651



to top

>gb|AC005591.1| Homo sapiens chromosome 16, P1 clone 94-10H (LANL), complete sequence
          Length = 78941

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 339   gggagccatggcacgggcag 358
             ||||||||||||||||||||
Sbjct: 11633 gggagccatggcacgggcag 11652



to top

>gb|BC020241.1| Homo sapiens cDNA clone IMAGE:4661475, with apparent retained
           intron
          Length = 1928

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 339 gggagccatggcacgggcag 358
           ||||||||||||||||||||
Sbjct: 770 gggagccatggcacgggcag 751



to top

>emb|CR769784.10| Zebrafish DNA sequence from clone DKEY-3N10 in linkage group 1, complete
              sequence
          Length = 230420

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 62     caacataggagaaacaatta 81
              ||||||||||||||||||||
Sbjct: 131528 caacataggagaaacaatta 131547



to top

>gb|AC092117.4| Homo sapiens chromosome 16 clone CTD-2270P14, complete sequence
          Length = 211606

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 339   gggagccatggcacgggcag 358
             ||||||||||||||||||||
Sbjct: 33751 gggagccatggcacgggcag 33732



to top

>gb|AC141586.2| Homo sapiens chromosome 16 clone CTD-3126B10, complete sequence
          Length = 127397

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 339    gggagccatggcacgggcag 358
              ||||||||||||||||||||
Sbjct: 108203 gggagccatggcacgggcag 108184



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 339   gggagccatggcacgggcag 358
             ||||||||||||||||||||
Sbjct: 23035 gggagccatggcacgggcag 23054



to top

>emb|CR752649.9| Zebrafish DNA sequence from clone DKEY-238J13, complete sequence
          Length = 164233

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 257   ttatcttccaagaaactgta 276
             ||||||||||||||||||||
Sbjct: 25582 ttatcttccaagaaactgta 25601



to top

>emb|AL607026.11| Human DNA sequence from clone RP11-498G22 on chromosome 10, complete
              sequence
          Length = 172911

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                          
Query: 142    acaaaaactcctagccacattgagaaca 169
              |||||||||||||| |||||||||||||
Sbjct: 165704 acaaaaactcctag-cacattgagaaca 165678



to top

>emb|CR388002.6| Zebrafish DNA sequence from clone DKEY-75M8 in linkage group 1, complete
              sequence
          Length = 228120

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 62     caacataggagaaacaatta 81
              ||||||||||||||||||||
Sbjct: 162277 caacataggagaaacaatta 162258



to top

>gb|CP000087.1| Rickettsia bellii RML369-C, complete genome
          Length = 1522076

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 344    ccatggcacgggcagaacca 363
              ||||||||||||||||||||
Sbjct: 913996 ccatggcacgggcagaacca 913977



to top

>emb|X05630.1|RCPETG Rhodopseudomonas capsulata petABC operon
          Length = 4007

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 332  tcgtagtgggagccatggcacgggcagaacca 363
            |||||||| ||||| ||||| |||||||||||
Sbjct: 1213 tcgtagtgcgagccgtggcaggggcagaacca 1182



to top

>emb|X05799.1|PDBC1 P. denitrificans bc1 gene for cytochrome bc1 complex (EC 1.10.2.2)
          Length = 3840

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 312 tgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaacca 363
           ||||||| | ||| ||| ||||||| || || || |||||||||||||||||
Sbjct: 746 tgcggatgcggcccgaggtgtcgtaatgcgacccgtggcacgggcagaacca 695



to top

>emb|X03476.1|RCFBC Rhodopseudomonas sphaeroides fbc operon (fbcF, fbcB, fbcC genes)
          Length = 3874

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 332  tcgtagtgggagccatggcacgggcagaacca 363
            |||||||| ||||| ||||| |||||||||||
Sbjct: 1324 tcgtagtgcgagccgtggcaggggcagaacca 1293



to top

>emb|AL645564.6| Mouse DNA sequence from clone RP23-35N22 on chromosome 11 Contains part
              of a novel gene and two CpG islands, complete sequence
          Length = 205101

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 354    ggcagaaccaaccaccaaag 373
              ||||||||||||||||||||
Sbjct: 157990 ggcagaaccaaccaccaaag 157971



to top

>emb|BX511162.8| Zebrafish DNA sequence from clone DKEY-240B22 in linkage group 1,
             complete sequence
          Length = 119612

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 62    caacataggagaaacaatta 81
             ||||||||||||||||||||
Sbjct: 16850 caacataggagaaacaatta 16869



to top

>emb|BX323017.6| Zebrafish DNA sequence from clone DKEYP-41F9, complete sequence
          Length = 141192

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 62    caacataggagaaacaatta 81
             ||||||||||||||||||||
Sbjct: 33822 caacataggagaaacaatta 33841



to top

>emb|AJ785968.1| Homo sapiens mRNA for PDPK2 protein
          Length = 2387

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 339 gggagccatggcacgggcag 358
           ||||||||||||||||||||
Sbjct: 617 gggagccatggcacgggcag 636



to top

>gb|AC068308.12| Homo sapiens 3 BAC RP11-275H4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 154495

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 45    aacttacaatccagtagcaacata 68
             ||||||||||||||||||| ||||
Sbjct: 38798 aacttacaatccagtagcaccata 38775



to top

>gb|AC068892.7| Homo sapiens chromosome 10 clone RP11-116D21, complete sequence
          Length = 161178

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                          
Query: 142    acaaaaactcctagccacattgagaaca 169
              |||||||||||||| |||||||||||||
Sbjct: 131607 acaaaaactcctag-cacattgagaaca 131633



to top

>ref|XM_496112.2| PREDICTED: Homo sapiens similar to 3-phosphoinositide dependent
           protein kinase 1 (hPDK1), transcript variant 1
           (LOC653650), mRNA
          Length = 2396

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 339 gggagccatggcacgggcag 358
           ||||||||||||||||||||
Sbjct: 632 gggagccatggcacgggcag 651



to top

>ref|XM_935349.1| PREDICTED: Homo sapiens similar to 3-phosphoinositide dependent
           protein kinase 1 (hPDK1), transcript variant 5
           (LOC653650), mRNA
          Length = 2595

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 339 gggagccatggcacgggcag 358
           ||||||||||||||||||||
Sbjct: 632 gggagccatggcacgggcag 651



to top

>ref|XM_935348.1| PREDICTED: Homo sapiens similar to 3-phosphoinositide dependent
           protein kinase 1 (hPDK1), transcript variant 4
           (LOC653650), mRNA
          Length = 1786

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 339 gggagccatggcacgggcag 358
           ||||||||||||||||||||
Sbjct: 632 gggagccatggcacgggcag 651



to top

>gb|BC002659.1|BC002659 Homo sapiens, clone IMAGE:3609437, mRNA
          Length = 1254

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 339 gggagccatggcacgggcag 358
           ||||||||||||||||||||
Sbjct: 81  gggagccatggcacgggcag 62



to top

>ref|XM_394267.2| PREDICTED: Apis mellifera similar to ENSANGP00000026211 (LOC410791),
            mRNA
          Length = 2127

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 167  acaaaataacagcgcaacag 186
            ||||||||||||||||||||
Sbjct: 2088 acaaaataacagcgcaacag 2069



to top

>gb|AC092577.3| Homo sapiens BAC clone RP11-12E5 from 4, complete sequence
          Length = 73928

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 39    caaagtaacttacaatccagtagc 62
             |||||||||||| |||||||||||
Sbjct: 11132 caaagtaacttataatccagtagc 11109



to top

>gb|AC093517.3| Homo sapiens chromosome 16 clone CTD-2593F12, complete sequence
          Length = 160606

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 339   gggagccatggcacgggcag 358
             ||||||||||||||||||||
Sbjct: 27171 gggagccatggcacgggcag 27152



to top

>gb|AC093525.3| Homo sapiens chromosome 16 clone RP11-20I23, complete sequence
          Length = 157518

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 339   gggagccatggcacgggcag 358
             ||||||||||||||||||||
Sbjct: 35728 gggagccatggcacgggcag 35709



to top

>dbj|AK197173.1| Mus musculus cDNA, clone:Y1G0124E03, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000042834, based on BLAT search
          Length = 382

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 302 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggca 357
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||
Sbjct: 313 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggca 258



to top

>dbj|AK191429.1| Mus musculus cDNA, clone:Y1G0105N20, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000042834, based on BLAT search
          Length = 408

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 302 gcagggcccttgcggattctgccagagatgtcgtagtgggagccatggcacgggca 357
           ||||||||||| | ||| |||||||||  ||| ||||| || |||||||| |||||
Sbjct: 339 gcagggcccttcctgatcctgccagaggcgtcatagtgtgacccatggcaggggca 284



to top

>dbj|AP006850.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2,
             fosmid clone:OSJNOa257A21
          Length = 34833

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 31    aatcagtacaaagtaacttacaat 54
             ||||| ||||||||||||||||||
Sbjct: 32111 aatcaatacaaagtaacttacaat 32134



to top

>dbj|AP005845.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0461D06
          Length = 112895

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 31    aatcagtacaaagtaacttacaat 54
             ||||| ||||||||||||||||||
Sbjct: 11402 aatcaatacaaagtaacttacaat 11425



to top

>gb|AC150478.3| Monodelphis domestica clone VMRC6-508P4, complete sequence
          Length = 81497

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 363   aaccaccaaagtctccagag 382
             ||||||||||||||||||||
Sbjct: 13995 aaccaccaaagtctccagag 13976



to top

>gb|AC147872.3| Monodelphis domestica clone VMRC6-555H19, complete sequence
          Length = 139145

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 363    aaccaccaaagtctccagag 382
              ||||||||||||||||||||
Sbjct: 130009 aaccaccaaagtctccagag 129990



to top

>emb|BX323453.7| Zebrafish DNA sequence from clone CH211-212G2 in linkage group 22,
              complete sequence
          Length = 212160

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 62     caacataggagaaacaatta 81
              ||||||||||||||||||||
Sbjct: 153279 caacataggagaaacaatta 153298



to top

>emb|AL138478.3|CNS01DWR Human chromosome 14 DNA sequence BAC R-681H18 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 188717

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 374    tctccagagttgggaagggg 393
              ||||||||||||||||||||
Sbjct: 152301 tctccagagttgggaagggg 152320



to top

>emb|CR812957.13| Zebrafish DNA sequence from clone DKEY-41L5 in linkage group 1, complete
              sequence
          Length = 220462

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 62     caacataggagaaacaatta 81
              ||||||||||||||||||||
Sbjct: 170932 caacataggagaaacaatta 170913



to top

>emb|AL954329.7| Zebrafish DNA sequence from clone CH211-226C11 in linkage group 23,
             complete sequence
          Length = 194284

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 62    caacataggagaaacaatta 81
             ||||||||||||||||||||
Sbjct: 11111 caacataggagaaacaatta 11092



to top

>gb|DP000021.1| Monodelphis domestica target 1 genomic scaffold
          Length = 1833844

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 363     aaccaccaaagtctccagag 382
               ||||||||||||||||||||
Sbjct: 1766342 aaccaccaaagtctccagag 1766323



to top

>emb|AL137785.6|CNS01DWN Human chromosome 14 DNA sequence BAC R-151G14 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 155729

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 374   tctccagagttgggaagggg 393
             ||||||||||||||||||||
Sbjct: 77128 tctccagagttgggaagggg 77109



to top

>gb|M17522.1|PDEBC1 P.denitrificans bc1 operon genes encoding three subunits (FeS, b
           and c1) of the cytochrome bc1 complex, complete cds
          Length = 3840

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 312 tgcggattctgccagagatgtcgtagtgggagccatggcacgggcagaacca 363
           ||||||| | ||| ||| ||||||| || || || |||||||||||||||||
Sbjct: 746 tgcggatgcggcccgaggtgtcgtaatgcgacccgtggcacgggcagaacca 695


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,707,365
Number of Sequences: 3902068
Number of extensions: 4707365
Number of successful extensions: 78812
Number of sequences better than 10.0: 161
Number of HSP's better than 10.0 without gapping: 155
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 78358
Number of HSP's gapped (non-prelim): 454
length of query: 519
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 496
effective length of database: 17,143,297,704
effective search space: 8503075661184
effective search space used: 8503075661184
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top