ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart37a04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK120033.1| Oryza sativa (japonica cultivar-group) cDNA clon... 291 1e-75
2emb|X64621.1|OSR22CDNA O.sativa R22 mRNA 291 1e-75
3dbj|AK066128.1| Oryza sativa (japonica cultivar-group) cDNA clon... 291 1e-75
4dbj|AK062208.1| Oryza sativa (japonica cultivar-group) cDNA clon... 291 1e-75
5ref|XM_476047.1| Oryza sativa (japonica cultivar-group), predic... 278 2e-71
6gb|AF470356.1| Triticum aestivum QM mRNA, partial cds 274 3e-70
7gb|AC084817.5| Oryza sativa (japonica cultivar-group) chromosome... 220 3e-54
8dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 220 3e-54
9emb|X81692.1|OSSG12G O.sativa SG12 gene 220 3e-54
10gb|U55048.1|OSU55048 Oryza sativa QM gene, complete cds 220 3e-54
11gb|BT016528.1| Zea mays clone Contig361 mRNA sequence 194 2e-46
12gb|BT016423.1| Zea mays clone Contig256 mRNA sequence 186 5e-44
13gb|AY103671.1| Zea mays PCO135454 mRNA sequence 182 8e-43
14gb|U06108.1|ZMU06108 Zea mays B73 QM protein mRNA, complete cds 180 3e-42
15gb|AF542972.1| Triticum aestivum SC34 tumor suppressor-like mRNA... 168 1e-38
16dbj|AK102971.1| Oryza sativa (japonica cultivar-group) cDNA clon... 157 4e-35
17dbj|AK060902.1| Oryza sativa (japonica cultivar-group) cDNA clon... 157 4e-35
18gb|U55212.1|OSU55212 Oryza sativa Wilms' tumor-related protein Q... 157 4e-35
19emb|X81691.1|OSSC34MR O.sativa SC34 mRNA for tumor suppressor 151 3e-33
20dbj|AK103710.1| Oryza sativa (japonica cultivar-group) cDNA clon... 149 1e-32
21gb|BT012759.1| Lycopersicon esculentum clone 113703R, mRNA sequence 145 2e-31
22gb|DQ056435.1| Lycopersicon esculentum 60S ribosomal protein L10... 145 2e-31
23emb|Z14083.1|NTTRP N.tabacum mRNA for protein homologue to human... 123 6e-25
24gb|DQ228354.1| Solanum tuberosum clone 150H09 60S ribosomal prot... 121 2e-24
25gb|AY641430.1| Caragana jubata QM family protein (QM) mRNA, comp... 109 9e-21
26gb|AY641733.1| Camellia sinensis QM-like protein mRNA, complete cds 109 9e-21
27ref|NM_102455.1| Arabidopsis thaliana structural constituent of ... 107 4e-20
28gb|BT024605.1| Arabidopsis thaliana At1g26910 mRNA, complete cds 107 4e-20
29gb|AC147460.1| Oryza sativa (japonica cultivar-group) chromosome... 105 1e-19
30gb|AC123524.2| Oryza sativa (japonica cultivar-group) chromosome... 105 1e-19
31dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 105 1e-19
32gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 105 1e-19
33gb|AY087264.1| Arabidopsis thaliana clone 33391 mRNA, complete s... 100 9e-18
34ref|NM_101298.2| Arabidopsis thaliana structural constituent of ... 96 1e-16
35gb|BT000679.1| Arabidopsis thaliana clone RAFL07-10-D02 (R10643)... 96 1e-16
36gb|AY113989.1| Arabidopsis thaliana putative tumor suppressor pr... 96 1e-16
37gb|AY045866.1| Arabidopsis thaliana putative tumor suppressor pr... 96 1e-16
38gb|AF428470.1|AF428470 Arabidopsis thaliana At1g14320/F14L17_28 ... 96 1e-16
39gb|AF428286.1|AF428286 Arabidopsis thaliana At1g14320/F14L17_28 ... 96 1e-16
40gb|AY050482.1| Arabidopsis thaliana At1g14320/F14L17_28 mRNA, co... 96 1e-16
41gb|AF378902.1|AF378902 Arabidopsis thaliana At1g14320/F14L17_28 ... 96 1e-16
42emb|BX816389.1|CNS0AE93 Arabidopsis thaliana Full-length cDNA Co... 96 1e-16
43emb|BX816136.1|CNS0AE2V Arabidopsis thaliana Full-length cDNA Co... 96 1e-16
44emb|Z15157.1|ATWILMTSH A.thaliana mRNA for Wilm's tumor suppress... 96 1e-16
45gb|AF180758.1|AF180758 Vitis riparia 60S ribosomal protein L10 (... 96 1e-16
46gb|AC012188.2|F14L17 Sequence of BAC F14L17 from Arabidopsis tha... 84 5e-13
47gb|AC005508.1|AC005508 Arabidopsis thaliana chromosome I BAC T2P... 84 5e-13
48ref|NM_105329.1| Arabidopsis thaliana structural constituent of ... 78 3e-11
49gb|AY055103.1| Arabidopsis thaliana At1g66580/T12I7_3 mRNA, comp... 78 3e-11
50gb|AF367276.1|AF367276 Arabidopsis thaliana At1g66580/T12I7_3 mR... 78 3e-11
51emb|BX816025.1|CNS0ABON Arabidopsis thaliana Full-length cDNA Co... 78 3e-11
52emb|BX815625.1|CNS0ABEZ Arabidopsis thaliana Full-length cDNA Co... 78 3e-11
53gb|AY087426.1| Arabidopsis thaliana clone 35307 mRNA, complete s... 78 3e-11
54gb|AC140545.26| Medicago truncatula clone mth2-11g18, complete s... 76 1e-10
55dbj|AB001582.1| Solanum melongena mRNA for QM family protein, pa... 76 1e-10
56dbj|AB001891.1| Solanum melongena mRNA for QM family protein, co... 76 1e-10
57gb|AY829778.1| Lonomia obliqua ribosomal protein L10 mRNA, compl... 74 5e-10
58gb|AF368032.1|AF368032 Heliothis virescens QM protein mRNA, comp... 74 5e-10
59gb|DQ440008.1| Aedes aegypti clone AE-200A ribosomal protein L10... 72 2e-09
60emb|CR938586.1| Single read from an extremity of a full-length c... 72 2e-09
61emb|CR938540.1| Single read from an extremity of a full-length c... 72 2e-09
62emb|CR938096.1| Single read from an extremity of a full-length c... 72 2e-09
63emb|CR938095.1| Single read from an extremity of a full-length c... 72 2e-09
64emb|CR937970.1| Single read from an extremity of a full-length c... 72 2e-09
65emb|CR937222.1| Single read from an extremity of a cDNA clone ma... 72 2e-09
66gb|AY763500.1| Danio rerio QM protein (QM) mRNA, complete cds 68 3e-08
67emb|CR938702.1| Single read from an extremity of a full-length c... 68 3e-08
68ref|XM_686253.1| PREDICTED: Danio rerio similar to Ribosomal pro... 68 3e-08
69gb|AY762997.1| Ctenopharyngodon idella QM (QM) mRNA, complete cds 68 3e-08
70gb|BC045950.1| Danio rerio ribosomal protein L10, mRNA (cDNA clo... 68 3e-08
71ref|NM_200027.1| Danio rerio ribosomal protein L10 (rpl10), mRNA 68 3e-08
72gb|AF227620.1|AF227620 Euphorbia esula 60S ribosomal protein L10... 68 3e-08
73gb|AY440350.1| Armigeres subalbatus ASAP ID: 41357 cytosolic lar... 64 5e-07
74emb|AM049018.1| Curculio glandium partial mRNA for ribosomal pro... 64 5e-07
75emb|BX071681.1|CNS09RH1 Single read from an extremity of a full-... 64 5e-07
76emb|BX066414.1|CNS09NEQ Single read from an extremity of a full-... 64 5e-07
77emb|BX066294.1|CNS09NBE Single read from an extremity of a full-... 64 5e-07
78emb|BX062161.1|CNS09K4L Single read from an extremity of a full-... 64 5e-07
79emb|BX054818.1|CNS09EGM Single read from an extremity of a full-... 64 5e-07
80emb|BX054800.1|CNS09EG4 Single read from an extremity of a full-... 64 5e-07
81emb|BX054799.1|CNS09EG3 Single read from an extremity of a full-... 64 5e-07
82emb|BX046336.1|CNS097X0 Single read from an extremity of a full-... 64 5e-07
83emb|BX045752.1|CNS097GS Single read from an extremity of a full-... 64 5e-07
84emb|BX045505.1|CNS0979X Single read from an extremity of a full-... 64 5e-07
85emb|BX043067.1|CNS095E7 Single read from an extremity of a full-... 64 5e-07
86emb|BX043066.1|CNS095E6 Single read from an extremity of a full-... 64 5e-07
87emb|BX044599.1|CNS096KR Single read from an extremity of a full-... 64 5e-07
88emb|BX043398.1|CNS095NE Single read from an extremity of a full-... 64 5e-07
89emb|BX038980.1|CNS0928O Single read from an extremity of a full-... 64 5e-07
90emb|BX037545.1|CNS0914T Single read from an extremity of a full-... 64 5e-07
91emb|BX037544.1|CNS0914S Single read from an extremity of a full-... 64 5e-07
92emb|BX031114.1|CNS08W66 Single read from an extremity of a full-... 64 5e-07
93emb|BX026833.1|CNS08SV9 Single read from an extremity of a full-... 64 5e-07
94emb|BX025006.1|CNS08RGI Single read from an extremity of a full-... 64 5e-07
95emb|BX025005.1|CNS08RGH Single read from an extremity of a full-... 64 5e-07
96emb|BX024539.1|CNS08R3J Single read from an extremity of a full-... 64 5e-07
97emb|BX020659.1|CNS08O3R Single read from an extremity of a full-... 64 5e-07
98emb|BX019389.1|CNS08N4H Single read from an extremity of a full-... 64 5e-07
99emb|BX018993.1|CNS08MTH Single read from an extremity of a full-... 64 5e-07
100emb|BX017940.1|CNS08M08 Single read from an extremity of a full-... 64 5e-07
101emb|BX017939.1|CNS08M07 Single read from an extremity of a full-... 64 5e-07
102emb|BX018773.1|CNS08MND Single read from an extremity of a full-... 64 5e-07
103emb|BX018772.1|CNS08MNC Single read from an extremity of a full-... 64 5e-07
104emb|BX017778.1|CNS08LVQ Single read from an extremity of a full-... 64 5e-07
105emb|BX017777.1|CNS08LVP Single read from an extremity of a full-... 64 5e-07
106emb|BX016960.1|CNS08L90 Single read from an extremity of a full-... 64 5e-07
107emb|BX012859.1|CNS08I33 Single read from an extremity of a full-... 64 5e-07
108emb|BX012858.1|CNS08I32 Single read from an extremity of a full-... 64 5e-07
109emb|BX010419.1|CNS08G7B Single read from an extremity of a full-... 64 5e-07
110emb|BX008095.1|CNS08EER Single read from an extremity of a full-... 64 5e-07
111emb|BX008094.1|CNS08EEQ Single read from an extremity of a full-... 64 5e-07
112emb|BX005642.1|CNS08CIM Single read from an extremity of a full-... 64 5e-07
113ref|XM_312560.2| Anopheles gambiae str. PEST ENSANGP00000014921 ... 64 5e-07
114gb|AF118822.1|AF118822 Arabidopsis thaliana senescence-associate... 64 5e-07
115emb|BX026834.1|CNS08SVA Single read from an extremity of a full-... 62 2e-06
116emb|CR937221.1| Single read from an extremity of a cDNA clone ma... 62 2e-06
117gb|AC079285.1|AC079285 Arabidopsis thaliana chromosome 1 BAC T12... 62 2e-06
118gb|AF295636.1|AF295636 Elaeis guineensis QM-like protein mRNA, c... 62 2e-06
119gb|AC113107.15| Mus musculus chromosome 10, clone RP23-325G13, c... 58 3e-05
120emb|AM049016.1| Biphyllus lunatus mRNA for ribosomal protein L10... 58 3e-05
121emb|BX038979.1|CNS0928N Single read from an extremity of a full-... 58 3e-05
122gb|AC153942.8| Mus musculus 10 BAC RP24-174M19 (Roswell Park Can... 58 3e-05
123dbj|AB180439.1| Plutella xylostella mRNA for QM protein, complet... 58 3e-05
124gb|AY769278.1| Bombyx mori ribosomal protein L10 (RpL10) mRNA, c... 56 1e-04
125ref|XM_868582.1| PREDICTED: Bos taurus similar to ribosomal prot... 56 1e-04
126gb|U60651.1| Hydra vulgaris ribosomal protein L10 mRNA, complete... 56 1e-04
127gb|AC147002.20| Medicago truncatula clone mth2-151m16, complete ... 56 1e-04
128emb|BX051816.1|CNS09C58 Single read from an extremity of a full-... 56 1e-04
129dbj|AB223250.1| Aspergillus oryzae cDNA, contig sequence: AoEST0081 56 1e-04
130dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011 56 1e-04
131gb|AF395838.1|AF395838 Bombyx mori QM protein (QM) mRNA, complet... 56 1e-04
132gb|AY130416.1| Petromyzon marinus ribosomal protein L10 mRNA, pa... 56 1e-04
133gb|AY130414.1| Branchiostoma lanceolatum ribosomal protein L10 m... 56 1e-04
134emb|BX005483.3| Zebrafish DNA sequence from clone CH211-286G12 i... 56 1e-04
135gb|AY168758.1| Branchiostoma belcheri tsingtaunese ribosomal pro... 56 1e-04
136gb|AF099012.1|AF099012 Bombyx mandarina QM protein mRNA, complet... 56 1e-04
137emb|CR450723.12| Zebrafish DNA sequence from clone DKEY-47C8 in ... 56 1e-04
138gb|AF013804.1| Pinus taeda Wilm's tumor supressor homolog (lp20)... 56 1e-04
139ref|XM_658595.1| Aspergillus nidulans FGSC A4 hypothetical prote... 54 5e-04
140emb|CR734854.2|CNS0GTSL Tetraodon nigroviridis full-length cDNA 54 5e-04
141emb|CR734175.2|CNS0GT9Q Tetraodon nigroviridis full-length cDNA 54 5e-04
142emb|CR720542.2|CNS0GIX0 Tetraodon nigroviridis full-length cDNA 54 5e-04
143emb|CR728834.2|CNS0GPBC Tetraodon nigroviridis full-length cDNA 54 5e-04
144emb|CR720275.2|CNS0GIPL Tetraodon nigroviridis full-length cDNA 54 5e-04
145emb|CR722877.2|CNS0GKPV Tetraodon nigroviridis full-length cDNA 54 5e-04
146emb|CR722708.2|CNS0GKL6 Tetraodon nigroviridis full-length cDNA 54 5e-04
147emb|CR722363.2|CNS0GKBL Tetraodon nigroviridis full-length cDNA 54 5e-04
148emb|CR720772.2|CNS0GJ3E Tetraodon nigroviridis full-length cDNA 54 5e-04
149emb|CR717491.2|CNS0GGK9 Tetraodon nigroviridis full-length cDNA 54 5e-04
150emb|CR717039.2|CNS0GG7S Tetraodon nigroviridis full-length cDNA 54 5e-04
151emb|CR716839.2|CNS0GG28 Tetraodon nigroviridis full-length cDNA 54 5e-04
152emb|CR716359.2|CNS0GFOW Tetraodon nigroviridis full-length cDNA 54 5e-04
153emb|CR715715.2|CNS0GF73 Tetraodon nigroviridis full-length cDNA 54 5e-04
154emb|CR714866.2|CNS0GEJI Tetraodon nigroviridis full-length cDNA 54 5e-04
155emb|CR714125.2|CNS0GDYX Tetraodon nigroviridis full-length cDNA 54 5e-04
156emb|CR712979.2|CNS0GD33 Tetraodon nigroviridis full-length cDNA 54 5e-04
157emb|CR713339.2|CNS0GDD3 Tetraodon nigroviridis full-length cDNA 54 5e-04
158emb|CR713296.2|CNS0GDBW Tetraodon nigroviridis full-length cDNA 54 5e-04
159emb|CR712692.2|CNS0GCV4 Tetraodon nigroviridis full-length cDNA 54 5e-04
160emb|CR711229.2|CNS0GBQH Tetraodon nigroviridis full-length cDNA 54 5e-04
161emb|CR710615.2|CNS0GB9F Tetraodon nigroviridis full-length cDNA 54 5e-04
162emb|CR708839.2|CNS0G9W3 Tetraodon nigroviridis full-length cDNA 54 5e-04
163emb|CR708432.2|CNS0G9KS Tetraodon nigroviridis full-length cDNA 54 5e-04
164emb|CR706206.2|CNS0G7UY Tetraodon nigroviridis full-length cDNA 54 5e-04
165emb|CR704971.2|CNS0G6WN Tetraodon nigroviridis full-length cDNA 54 5e-04
166emb|CR704750.2|CNS0G6QI Tetraodon nigroviridis full-length cDNA 54 5e-04
167emb|CR704546.2|CNS0G6KU Tetraodon nigroviridis full-length cDNA 54 5e-04
168emb|CR703247.2|CNS0G5KR Tetraodon nigroviridis full-length cDNA 54 5e-04
169emb|CR702411.2|CNS0G4XJ Tetraodon nigroviridis full-length cDNA 54 5e-04
170emb|CR699842.2|CNS0G2Y6 Tetraodon nigroviridis full-length cDNA 54 5e-04
171emb|CR699390.2|CNS0G2LM Tetraodon nigroviridis full-length cDNA 54 5e-04
172emb|CR698890.2|CNS0G27Q Tetraodon nigroviridis full-length cDNA 54 5e-04
173emb|CR698626.2|CNS0G20E Tetraodon nigroviridis full-length cDNA 54 5e-04
174emb|CR697360.2|CNS0G118 Tetraodon nigroviridis full-length cDNA 54 5e-04
175emb|CR696503.2|CNS0G0DF Tetraodon nigroviridis full-length cDNA 54 5e-04
176emb|CR695584.2|CNS0FZNW Tetraodon nigroviridis full-length cDNA 54 5e-04
177emb|CR695012.2|CNS0FZ80 Tetraodon nigroviridis full-length cDNA 54 5e-04
178emb|CR693370.2|CNS0FXYE Tetraodon nigroviridis full-length cDNA 54 5e-04
179emb|CR692920.2|CNS0FXLW Tetraodon nigroviridis full-length cDNA 54 5e-04
180emb|CR691720.2|CNS0FWOK Tetraodon nigroviridis full-length cDNA 54 5e-04
181emb|CR690750.2|CNS0FVXM Tetraodon nigroviridis full-length cDNA 54 5e-04
182emb|CR687822.2|CNS0FTOA Tetraodon nigroviridis full-length cDNA 54 5e-04
183gb|BC058467.1| Rattus norvegicus ribosomal protein L10, mRNA (cD... 54 5e-04
184emb|CR683944.2|CNS0FQOK Tetraodon nigroviridis full-length cDNA 54 5e-04
185emb|CR683389.2|CNS0FQ95 Tetraodon nigroviridis full-length cDNA 54 5e-04
186emb|CR683865.2|CNS0FQMD Tetraodon nigroviridis full-length cDNA 54 5e-04
187emb|CR683765.2|CNS0FQJL Tetraodon nigroviridis full-length cDNA 54 5e-04
188emb|CR682972.2|CNS0FPXK Tetraodon nigroviridis full-length cDNA 54 5e-04
189emb|CR682444.2|CNS0FPIW Tetraodon nigroviridis full-length cDNA 54 5e-04
190emb|CR682415.2|CNS0FPI3 Tetraodon nigroviridis full-length cDNA 54 5e-04
191emb|CR680276.2|CNS0FNUO Tetraodon nigroviridis full-length cDNA 54 5e-04
192emb|CR679679.2|CNS0FNE3 Tetraodon nigroviridis full-length cDNA 54 5e-04
193emb|CR679292.2|CNS0FN3C Tetraodon nigroviridis full-length cDNA 54 5e-04
194emb|CR678745.2|CNS0FMO5 Tetraodon nigroviridis full-length cDNA 54 5e-04
195emb|CR677248.2|CNS0FLJ0 Tetraodon nigroviridis full-length cDNA 54 5e-04
196emb|CR677235.2|CNS0FLIN Tetraodon nigroviridis full-length cDNA 54 5e-04
197emb|CR676747.2|CNS0FL53 Tetraodon nigroviridis full-length cDNA 54 5e-04
198emb|CR675816.2|CNS0FKFI Tetraodon nigroviridis full-length cDNA 54 5e-04
199emb|CR671887.2|CNS0FHED Tetraodon nigroviridis full-length cDNA 54 5e-04
200emb|CR670190.2|CNS0FG38 Tetraodon nigroviridis full-length cDNA 54 5e-04
201emb|CR669765.2|CNS0FFRF Tetraodon nigroviridis full-length cDNA 54 5e-04
202emb|CR669547.2|CNS0FFLD Tetraodon nigroviridis full-length cDNA 54 5e-04
203emb|CR668289.2|CNS0FEMF Tetraodon nigroviridis full-length cDNA 54 5e-04
204emb|CR667800.2|CNS0FE8U Tetraodon nigroviridis full-length cDNA 54 5e-04
205emb|CR667784.2|CNS0FE8E Tetraodon nigroviridis full-length cDNA 54 5e-04
206emb|CR666481.2|CNS0FD87 Tetraodon nigroviridis full-length cDNA 54 5e-04
207emb|CR666070.2|CNS0FCWS Tetraodon nigroviridis full-length cDNA 54 5e-04
208emb|CR665292.2|CNS0FCB6 Tetraodon nigroviridis full-length cDNA 54 5e-04
209emb|CR664416.2|CNS0FBMU Tetraodon nigroviridis full-length cDNA 54 5e-04
210emb|CR664793.2|CNS0FBXB Tetraodon nigroviridis full-length cDNA 54 5e-04
211emb|CR664317.2|CNS0FBK3 Tetraodon nigroviridis full-length cDNA 54 5e-04
212emb|CR663825.2|CNS0FB6F Tetraodon nigroviridis full-length cDNA 54 5e-04
213emb|CR661995.2|CNS0F9RL Tetraodon nigroviridis full-length cDNA 54 5e-04
214emb|CR661060.1|CNS0F91M Tetraodon nigroviridis full-length cDNA 54 5e-04
215emb|CR660123.2|CNS0F8BL Tetraodon nigroviridis full-length cDNA 54 5e-04
216emb|CR658652.2|CNS0F76Q Tetraodon nigroviridis full-length cDNA 54 5e-04
217emb|CR657230.2|CNS0F638 Tetraodon nigroviridis full-length cDNA 54 5e-04
218emb|CR656598.2|CNS0F5LO Tetraodon nigroviridis full-length cDNA 54 5e-04
219emb|CR655837.2|CNS0F50J Tetraodon nigroviridis full-length cDNA 54 5e-04
220emb|CR655821.2|CNS0F503 Tetraodon nigroviridis full-length cDNA 54 5e-04
221emb|CR652829.2|CNS0F2OZ Tetraodon nigroviridis full-length cDNA 54 5e-04
222emb|CR651640.2|CNS0F1RY Tetraodon nigroviridis full-length cDNA 54 5e-04
223ref|XM_660558.1| Cryptosporidium hominis TU502 ribosomal protein... 54 5e-04
224emb|CR650120.2|CNS0F0LQ Tetraodon nigroviridis full-length cDNA 54 5e-04
225emb|CR649290.2|CNS0EZYO Tetraodon nigroviridis full-length cDNA 54 5e-04
226emb|CR647942.2|CNS0EYX8 Tetraodon nigroviridis full-length cDNA 54 5e-04
227emb|CR646246.2|CNS0EXM4 Tetraodon nigroviridis full-length cDNA 54 5e-04
228emb|CR644771.2|CNS0EWH5 Tetraodon nigroviridis full-length cDNA 54 5e-04
229emb|CR642622.2|CNS0EUTG Tetraodon nigroviridis full-length cDNA 54 5e-04
230emb|CR642404.2|CNS0EUNE Tetraodon nigroviridis full-length cDNA 54 5e-04
231emb|CR642314.2|CNS0EUKW Tetraodon nigroviridis full-length cDNA 54 5e-04
232emb|CR642260.2|CNS0EUJE Tetraodon nigroviridis full-length cDNA 54 5e-04
233emb|CR641599.2|CNS0EU11 Tetraodon nigroviridis full-length cDNA 54 5e-04
234emb|CR641870.2|CNS0EU8K Tetraodon nigroviridis full-length cDNA 54 5e-04
235emb|CR641322.2|CNS0ETTC Tetraodon nigroviridis full-length cDNA 54 5e-04
236emb|CR640947.2|CNS0ETIX Tetraodon nigroviridis full-length cDNA 54 5e-04
237emb|CR640163.2|CNS0ESX5 Tetraodon nigroviridis full-length cDNA 54 5e-04
238emb|CR639985.2|CNS0ESS7 Tetraodon nigroviridis full-length cDNA 54 5e-04
239emb|CR639593.2|CNS0ESHB Tetraodon nigroviridis full-length cDNA 54 5e-04
240emb|CR639409.2|CNS0ESC7 Tetraodon nigroviridis full-length cDNA 54 5e-04
241emb|CR635358.2|CNS0EP7O Tetraodon nigroviridis full-length cDNA 54 5e-04
242emb|CR635001.2|CNS0EOXR Tetraodon nigroviridis full-length cDNA 54 5e-04
243emb|BX538352.1| Cryptosporidium parvum chromosome 6, complete se... 54 5e-04
244ref|XM_627752.1| Cryptosporidium parvum Iowa II 60S ribosomal pr... 54 5e-04
245gb|AY909399.1| Siniperca chuatsi clone C410 ribosomal protein L1... 54 5e-04
246ref|XM_212832.3| PREDICTED: Rattus norvegicus ribosomal protein ... 54 5e-04
247dbj|AK119983.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 5e-04
248ref|XM_750162.1| Aspergillus fumigatus Af293 ribosomal protein L... 52 0.002
249emb|CR938584.1| Single read from an extremity of a full-length c... 52 0.002
250gb|AF401563.1| Ictalurus punctatus ribosomal protein L10 mRNA, c... 52 0.002
251ref|XM_574109.1| PREDICTED: Rattus norvegicus similar to ribosom... 52 0.002
252gb|BC086917.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo... 50 0.007
253gb|AC122357.4| Mus musculus BAC clone RP23-403O8 from chromosome... 50 0.007
254gb|BC083327.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo... 50 0.007
255gb|BC082293.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo... 50 0.007
256gb|AY701865.1| Gekko japonicus GekBS044P mRNA, complete cds 50 0.007
257ref|XM_585834.2| PREDICTED: Bos taurus similar to ribosomal prot... 50 0.007
258ref|XM_592251.2| PREDICTED: Bos taurus similar to ribosomal prot... 50 0.007
259gb|BC024901.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo... 50 0.007
260ref|NM_052835.1| Mus musculus ribosomal protein 10 (Rpl10), mRNA 50 0.007
261ref|NM_174760.2| Bos taurus ribosomal protein L10 (RPL10), mRNA 50 0.007
262ref|XM_862548.1| PREDICTED: Canis familiaris similar to ribosoma... 50 0.007
263ref|XM_862530.1| PREDICTED: Canis familiaris similar to ribosoma... 50 0.007
264ref|XM_862521.1| PREDICTED: Canis familiaris similar to ribosoma... 50 0.007
265ref|XM_538206.2| PREDICTED: Canis familiaris similar to ribosoma... 50 0.007
266ref|XM_848470.1| PREDICTED: Canis familiaris similar to ribosoma... 50 0.007
267ref|XM_974001.1| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.007
268ref|XM_889722.2| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.007
269ref|XM_543494.2| PREDICTED: Canis familiaris similar to ribosoma... 50 0.007
270ref|XM_542759.2| PREDICTED: Canis familiaris similar to ribosoma... 50 0.007
271emb|CR974589.6| Mouse DNA sequence from clone RP23-77B14 on chro... 50 0.007
272ref|XM_547794.2| PREDICTED: Canis familiaris similar to 60S ribo... 50 0.007
273emb|AM049019.1| Scarabaeus laticollis mRNA for ribosomal protein... 50 0.007
274gb|AC121872.2| Mus musculus BAC clone RP24-122E10 from 12, compl... 50 0.007
275ref|XM_739285.1| Plasmodium chabaudi chabaudi ribosomal protein ... 50 0.007
276ref|XM_849677.1| PREDICTED: Canis familiaris similar to ribosoma... 50 0.007
277gb|AC117679.8| Mus musculus chromosome 9, clone RP23-435I22, com... 50 0.007
278ref|XM_965782.1| PREDICTED: Tribolium castaneum similar to CG175... 50 0.007
279emb|BX054819.1|CNS09EGN Single read from an extremity of a full-... 50 0.007
280emb|BX018994.1|CNS08MTI Single read from an extremity of a full-... 50 0.007
281emb|BX014897.1|CNS08JNP Single read from an extremity of a full-... 50 0.007
282emb|BX014896.1|CNS08JNO Single read from an extremity of a full-... 50 0.007
283emb|X75312.1|MMRNAQM M.musculus (C57BL/6) QM mRNA 50 0.007
284gb|BC099437.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo... 50 0.007
285gb|AC160997.5| Mus musculus BAC clone RP23-68E4 from chromosome ... 50 0.007
286gb|BC098204.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo... 50 0.007
287dbj|AB226277.1| Aspergillus oryzae cDNA, contig sequence: AoEST3138 50 0.007
288dbj|AK146217.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 50 0.007
289dbj|AK151736.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 50 0.007
290dbj|AK144831.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-... 50 0.007
291dbj|AK152854.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 50 0.007
292dbj|AK151655.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 50 0.007
293gb|BC104528.1| Bos taurus ribosomal protein L10, mRNA (cDNA clon... 50 0.007
294dbj|AK151416.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 50 0.007
295dbj|AK153345.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 50 0.007
296dbj|AK152123.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 50 0.007
297dbj|AK168854.1| Mus musculus 17 days embryo heart cDNA, RIKEN fu... 50 0.007
298dbj|AK166610.1| Mus musculus morula whole body morula cDNA, RIKE... 50 0.007
299dbj|AK167239.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 50 0.007
300dbj|AK160618.1| Mus musculus 11 days embryo whole body cDNA, RIK... 50 0.007
301dbj|AK168250.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 50 0.007
302dbj|AK167966.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 50 0.007
303dbj|AK014054.1| Mus musculus 13 days embryo head cDNA, RIKEN ful... 50 0.007
304dbj|AK088777.1| Mus musculus 2 days neonate thymus thymic cells ... 50 0.007
305gb|AF143815.1|AF143815 Bos taurus ribosomal protein (QM) mRNA, c... 50 0.007
306dbj|AK012561.1| Mus musculus 11 days embryo whole body cDNA, RIK... 50 0.007
307ref|NG_000911.1| Homo sapiens ribosomal protein L10 pseudogene 1... 50 0.007
308dbj|AK011022.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 50 0.007
309emb|AL115669.1|CNS01CL9 Botrytis cinerea strain T4 cDNA library 50 0.007
310emb|AL117032.1|CNS01DN4 Botrytis cinerea strain T4 cDNA library 50 0.007
311emb|AL117016.1|CNS01DMO Botrytis cinerea strain T4 cDNA library 50 0.007
312emb|AL116010.1|CNS01CUQ Botrytis cinerea strain T4 cDNA library 50 0.007
313emb|AL116382.1|CNS01D52 Botrytis cinerea strain T4 cDNA library 50 0.007
314emb|AL116380.1|CNS01D50 Botrytis cinerea strain T4 cDNA library 50 0.007
315emb|AL115845.1|CNS01CQ5 Botrytis cinerea strain T4 cDNA library 50 0.007
316emb|AL115361.1|CNS01CCP Botrytis cinerea strain T4 cDNA library 50 0.007
317emb|AL114727.1|CNS01BV3 Botrytis cinerea strain T4 cDNA library 50 0.007
318emb|AL114044.1|CNS01BC4 Botrytis cinerea strain T4 cDNA library 50 0.007
319emb|AL114043.1|CNS01BC3 Botrytis cinerea strain T4 cDNA library 50 0.007
320emb|AL112807.1|CNS01ADR Botrytis cinerea strain T4 cDNA library 50 0.007
321emb|AL112775.1|CNS01ACV Botrytis cinerea strain T4 cDNA library 50 0.007
322emb|AL111608.1|CNS019GG Botrytis cinerea strain T4 cDNA library 50 0.007
323emb|AL111718.1|CNS019JI Botrytis cinerea strain T4 cDNA library 50 0.007
324emb|AL111190.1|CNS0194U Botrytis cinerea strain T4 cDNA library 50 0.007
325gb|BC092383.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo... 50 0.007
326ref|XM_578693.1| PREDICTED: Rattus norvegicus similar to ribosom... 50 0.007
327gb|AY735455.1| Sus scrofa ribosomal protein L10 mRNA, complete cds 50 0.007
328gb|AY911380.1| Bos taurus clone IMAGE:7961519 GekBS044P-like mRN... 50 0.007
329emb|AL512582.7| Mouse DNA sequence from clone RP23-290H11 on chr... 50 0.007
330dbj|BS000216.1| Pan troglodytes chromosome 22 clone:RP43-057N15,... 50 0.007
331dbj|AK110755.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.007
332gb|BC048872.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo... 50 0.007
333gb|BT021081.1| Bos taurus ribosomal protein L10 (RPL10), mRNA, c... 50 0.007
334gb|AC141642.4| Mus musculus BAC clone RP23-274K4 from chromosome... 50 0.007
335dbj|AP001699.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 50 0.007
336dbj|AP000893.5| Homo sapiens genomic DNA, chromosome 11q, clone:... 50 0.007
337dbj|AP001767.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 50 0.007
338emb|CT573034.8| Mouse DNA sequence from clone RP23-156C20 on chr... 50 0.007
339gb|AY610342.1| Sus scrofa clone rebs26c_k7.y1.abd, mRNA sequence 50 0.007
340gb|BC006068.1| Mus musculus ribosomal protein 10, mRNA (cDNA clo... 50 0.007
341gb|AC131733.3| Mus musculus BAC clone RP23-98C9 from 8, complete... 50 0.007
342gb|AC157945.2| Mus musculus BAC clone RP23-289C11 from chromosom... 50 0.007
343gb|AC161238.7| Mus musculus chromosome 19, clone RP24-288C19, co... 50 0.007
344gb|M93980.1|MUSADIPCT Mouse 24.6 kda protein mRNA, complete cds 50 0.007
345dbj|AP001605.1| Homo sapiens genomic DNA, chromosome 21, clone:K... 50 0.007
346dbj|AP001604.1| Homo sapiens genomic DNA, chromosome 21, clone:K... 50 0.007
347gb|AY822650.1| Callinectes sapidus ribosomal protein L10 mRNA, c... 48 0.029
348ref|XM_522844.1| PREDICTED: Pan troglodytes similar to ribosomal... 48 0.029
349ref|XM_360593.1| Magnaporthe grisea 70-15 hypothetical protein (... 48 0.029
350ref|XM_582414.2| PREDICTED: Bos taurus similar to ribosomal prot... 48 0.029
351gb|BC014310.1| Homo sapiens ribosomal protein L10-like, mRNA (cD... 48 0.029
352ref|NM_080746.2| Homo sapiens ribosomal protein L10-like (RPL10L... 48 0.029
353emb|CR708339.2|CNS0G9I7 Tetraodon nigroviridis full-length cDNA 48 0.029
354emb|BX071887.1|CNS09RMR Single read from an extremity of a full-... 48 0.029
355emb|BX071440.1|CNS09RAC Single read from an extremity of a full-... 48 0.029
356emb|BX071439.1|CNS09RAB Single read from an extremity of a full-... 48 0.029
357emb|BX070864.1|CNS09QUC Single read from an extremity of a full-... 48 0.029
358emb|BX070863.1|CNS09QUB Single read from an extremity of a full-... 48 0.029
359emb|BX070583.1|CNS09QMJ Single read from an extremity of a full-... 48 0.029
360emb|BX070408.1|CNS09QHO Single read from an extremity of a full-... 48 0.029
361emb|BX070407.1|CNS09QHN Single read from an extremity of a full-... 48 0.029
362emb|BX070073.1|CNS09Q8D Single read from an extremity of a full-... 48 0.029
363emb|BX070072.1|CNS09Q8C Single read from an extremity of a full-... 48 0.029
364emb|BX070039.1|CNS09Q7F Single read from an extremity of a full-... 48 0.029
365emb|BX070038.1|CNS09Q7E Single read from an extremity of a full-... 48 0.029
366emb|BX069787.1|CNS09Q0F Single read from an extremity of a full-... 48 0.029
367emb|BX066234.1|CNS09N9Q Single read from an extremity of a full-... 48 0.029
368emb|BX066200.1|CNS09N8S Single read from an extremity of a full-... 48 0.029
369emb|BX065195.1|CNS09MGV Single read from an extremity of a full-... 48 0.029
370emb|BX065194.1|CNS09MGU Single read from an extremity of a full-... 48 0.029
371emb|BX065178.1|CNS09MGE Single read from an extremity of a full-... 48 0.029
372emb|BX065177.1|CNS09MGD Single read from an extremity of a full-... 48 0.029
373emb|BX065011.1|CNS09MBR Single read from an extremity of a full-... 48 0.029
374emb|BX065010.1|CNS09MBQ Single read from an extremity of a full-... 48 0.029
375emb|BX064957.1|CNS09MA9 Single read from an extremity of a full-... 48 0.029
376emb|BX064956.1|CNS09MA8 Single read from an extremity of a full-... 48 0.029
377emb|BX064177.1|CNS09LOL Single read from an extremity of a full-... 48 0.029
378emb|BX064176.1|CNS09LOK Single read from an extremity of a full-... 48 0.029
379emb|BX063991.1|CNS09LJF Single read from an extremity of a full-... 48 0.029
380emb|BX063841.1|CNS09LF9 Single read from an extremity of a full-... 48 0.029
381emb|BX063840.1|CNS09LF8 Single read from an extremity of a full-... 48 0.029
382emb|BX063569.1|CNS09L7P Single read from an extremity of a full-... 48 0.029
383emb|BX062882.1|CNS09KOM Single read from an extremity of a full-... 48 0.029
384emb|BX062815.1|CNS09KMR Single read from an extremity of a full-... 48 0.029
385emb|BX062474.1|CNS09KDA Single read from an extremity of a full-... 48 0.029
386emb|BX062455.1|CNS09KCR Single read from an extremity of a full-... 48 0.029
387emb|BX062454.1|CNS09KCQ Single read from an extremity of a full-... 48 0.029
388emb|BX061131.1|CNS09JBZ Single read from an extremity of a full-... 48 0.029
389emb|BX060081.1|CNS09IIT Single read from an extremity of a full-... 48 0.029
390emb|BX060080.1|CNS09IIS Single read from an extremity of a full-... 48 0.029
391emb|BX059294.1|CNS09HWY Single read from an extremity of a full-... 48 0.029
392emb|BX059258.1|CNS09HVY Single read from an extremity of a full-... 48 0.029
393emb|BX058831.1|CNS09HK3 Single read from an extremity of a full-... 48 0.029
394emb|BX058215.1|CNS09H2Z Single read from an extremity of a full-... 48 0.029
395emb|BX057966.1|CNS09GW2 Single read from an extremity of a full-... 48 0.029
396emb|BX056215.1|CNS09FJF Single read from an extremity of a full-... 48 0.029
397emb|BX054398.1|CNS09E4Y Single read from an extremity of a full-... 48 0.029
398emb|BX052529.1|CNS09CP1 Single read from an extremity of a full-... 48 0.029
399emb|BX051694.1|CNS09C1U Single read from an extremity of a full-... 48 0.029
400emb|BX051693.1|CNS09C1T Single read from an extremity of a full-... 48 0.029
401emb|BX051507.1|CNS09BWN Single read from an extremity of a full-... 48 0.029
402emb|BX050768.1|CNS09BC4 Single read from an extremity of a full-... 48 0.029
403emb|BX050767.1|CNS09BC3 Single read from an extremity of a full-... 48 0.029
404emb|BX049897.1|CNS09ANX Single read from an extremity of a full-... 48 0.029
405emb|BX046497.1|CNS0981H Single read from an extremity of a full-... 48 0.029
406emb|BX048384.1|CNS099HW Single read from an extremity of a full-... 48 0.029
407emb|BX048191.1|CNS099CJ Single read from an extremity of a full-... 48 0.029
408emb|BX047773.1|CNS0990X Single read from an extremity of a full-... 48 0.029
409emb|BX047772.1|CNS0990W Single read from an extremity of a full-... 48 0.029
410emb|BX047148.1|CNS098JK Single read from an extremity of a full-... 48 0.029
411emb|BX045949.1|CNS097M9 Single read from an extremity of a full-... 48 0.029
412emb|BX045930.1|CNS097LQ Single read from an extremity of a full-... 48 0.029
413emb|BX045929.1|CNS097LP Single read from an extremity of a full-... 48 0.029
414emb|BX045069.1|CNS096XT Single read from an extremity of a full-... 48 0.029
415emb|BX045068.1|CNS096XS Single read from an extremity of a full-... 48 0.029
416emb|BX044940.1|CNS096U8 Single read from an extremity of a full-... 48 0.029
417emb|BX044939.1|CNS096U7 Single read from an extremity of a full-... 48 0.029
418emb|BX045236.1|CNS0972G Single read from an extremity of a full-... 48 0.029
419emb|BX045235.1|CNS0972F Single read from an extremity of a full-... 48 0.029
420emb|BX045210.1|CNS0971Q Single read from an extremity of a full-... 48 0.029
421emb|BX045168.1|CNS0970K Single read from an extremity of a full-... 48 0.029
422emb|BX045167.1|CNS0970J Single read from an extremity of a full-... 48 0.029
423emb|BX044818.1|CNS096QU Single read from an extremity of a full-... 48 0.029
424emb|BX044813.1|CNS096QP Single read from an extremity of a full-... 48 0.029
425emb|BX044702.1|CNS096NM Single read from an extremity of a full-... 48 0.029
426emb|BX043998.1|CNS09642 Single read from an extremity of a full-... 48 0.029
427emb|BX043345.1|CNS095LX Single read from an extremity of a full-... 48 0.029
428emb|BX043344.1|CNS095LW Single read from an extremity of a full-... 48 0.029
429emb|BX043332.1|CNS095LK Single read from an extremity of a full-... 48 0.029
430emb|BX042201.1|CNS094Q5 Single read from an extremity of a full-... 48 0.029
431emb|BX041060.1|CNS093UG Single read from an extremity of a full-... 48 0.029
432emb|BX040103.1|CNS0933V Single read from an extremity of a full-... 48 0.029
433emb|BX039792.1|CNS092V8 Single read from an extremity of a full-... 48 0.029
434emb|BX035748.1|CNS08ZQW Single read from an extremity of a full-... 48 0.029
435emb|BX035747.1|CNS08ZQV Single read from an extremity of a full-... 48 0.029
436emb|BX035295.1|CNS08ZEB Single read from an extremity of a full-... 48 0.029
437emb|BX033806.1|CNS08Y8Y Single read from an extremity of a full-... 48 0.029
438emb|BX033805.1|CNS08Y8X Single read from an extremity of a full-... 48 0.029
439emb|BX032532.1|CNS08X9K Single read from an extremity of a full-... 48 0.029
440emb|BX031115.1|CNS08W67 Single read from an extremity of a full-... 48 0.029
441emb|BX027292.1|CNS08T80 Single read from an extremity of a full-... 48 0.029
442emb|BX027291.1|CNS08T7Z Single read from an extremity of a full-... 48 0.029
443emb|BX020769.1|CNS08O6T Single read from an extremity of a full-... 48 0.029
444emb|BX019929.1|CNS08NJH Single read from an extremity of a full-... 48 0.029
445emb|BX019914.1|CNS08NJ2 Single read from an extremity of a full-... 48 0.029
446emb|BX011291.1|CNS08GVJ Single read from an extremity of a full-... 48 0.029
447emb|BX011290.1|CNS08GVI Single read from an extremity of a full-... 48 0.029
448emb|BX011211.1|CNS08GTB Single read from an extremity of a full-... 48 0.029
449emb|BX010775.1|CNS08GH7 Single read from an extremity of a full-... 48 0.029
450emb|BX010321.1|CNS08G4L Single read from an extremity of a full-... 48 0.029
451emb|BX010320.1|CNS08G4K Single read from an extremity of a full-... 48 0.029
452emb|BX010145.1|CNS08FZP Single read from an extremity of a full-... 48 0.029
453emb|BX008868.1|CNS08F08 Single read from an extremity of a full-... 48 0.029
454emb|BX008784.1|CNS08EXW Single read from an extremity of a full-... 48 0.029
455emb|BX007961.1|CNS08EB1 Single read from an extremity of a full-... 48 0.029
456emb|BX006619.1|CNS08D9R Single read from an extremity of a full-... 48 0.029
457gb|BC066312.1| Homo sapiens ribosomal protein L10-like, mRNA (cD... 48 0.029
458dbj|AB195817.1| Coprinopsis cinerea dst1 gene for hypothetical p... 48 0.029
459gb|BC109561.1| Bos taurus cDNA clone MGC:133542 IMAGE:8051598, c... 48 0.029
460dbj|AB063608.1| Homo sapiens RPL10L mRNA for ribosomal protein L... 48 0.029
461dbj|AK130863.1| Homo sapiens cDNA FLJ27353 fis, clone TST05348, ... 48 0.029
462ref|XM_309144.2| Anopheles gambiae str. PEST ENSANGP00000023750 ... 48 0.029
463ref|XM_560169.1| Anopheles gambiae str. PEST ENSANGP00000029269 ... 48 0.029
464emb|AL591769.3|CNS07EGM Human chromosome 14 DNA sequence BAC R-6... 48 0.029
465gb|AY850340.1| Magnaporthe grisea 60S ribosomal protein L10-A-li... 48 0.029
466emb|AL591768.2|CNS07EGL Human chromosome 14 DNA sequence BAC R-2... 48 0.029
467ref|XM_955693.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.11
468ref|XM_331355.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.11
469emb|Z48334.1|CEF10B5 Caenorhabditis elegans Cosmid F10B5, comple... 46 0.11
470emb|CR703469.2|CNS0G5QX Tetraodon nigroviridis full-length cDNA 46 0.11
471emb|CR703431.2|CNS0G5PV Tetraodon nigroviridis full-length cDNA 46 0.11
472emb|CR702951.2|CNS0G5CJ Tetraodon nigroviridis full-length cDNA 46 0.11
473emb|CR694810.2|CNS0FZ2E Tetraodon nigroviridis full-length cDNA 46 0.11
474emb|BX035296.1|CNS08ZEC Single read from an extremity of a full-... 46 0.11
475emb|X87106.1|RNRPL10 R.norvegicus mRNA for ribosomal protein L10 46 0.11
476gb|AC103566.1| Caenorhabditis briggsae cosmid CB024E07, complete... 46 0.11
477gb|AY857421.1| Suberites domuncula L10 mRNA, complete cds 46 0.11
478ref|NM_063306.2| Caenorhabditis elegans Ribosomal Protein, Large... 46 0.11
479ref|NM_031100.1| Rattus norvegicus ribosomal protein L10 (Rpl10)... 46 0.11
480dbj|AK210081.1| Mus musculus cDNA, clone:Y2G0117E10, strand:minu... 46 0.11
481dbj|AK187587.1| Mus musculus cDNA, clone:Y0G0142F19, strand:minu... 46 0.11
482emb|Y17222.1|SDO17222 Suberites domuncula mRNA for putative tumo... 46 0.11
483gb|U89405.1|MMU89405 Mus musculus strain BALB/c QM protein mRNA,... 46 0.11
484gb|AC094668.10| Rattus norvegicus BAC CH230-5F18 (Children's Ho... 44 0.45
485gb|AC091473.2| Mus musculus chromosome X clones RP21-114F21, RP2... 44 0.45
486ref|XM_586876.2| PREDICTED: Bos taurus similar to ribosomal prot... 44 0.45
487ref|XM_862539.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.45
488ref|XM_862492.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.45
489gb|AC126264.3| Mus musculus BAC clone RP23-376F13 from chromosom... 44 0.45
490emb|BX045950.1|CNS097MA Single read from an extremity of a full-... 44 0.45
491gb|AY927536.1| Homo sapiens mRNA sequence 44 0.45
492gb|BT021505.1| Bos taurus similar to 60S ribosomal protein L10 (... 44 0.45
493emb|AL807376.4| Mouse DNA sequence from clone RP23-436K3 on chro... 44 0.45
494gb|AY794382.1| Valeriana sorbifolia trnK gene, intron; chloroplast 42 1.8
495gb|AY794360.1| Valeriana nivalis trnK gene, intron; chloroplast 42 1.8
496gb|AY650303.1| Macaca fascicularis ribosomal protein L10 mRNA, p... 42 1.8
497ref|XM_528647.1| PREDICTED: Pan troglodytes similar to ribosomal... 42 1.8
498ref|XM_521341.1| PREDICTED: Pan troglodytes similar to ribosomal... 42 1.8
499ref|XM_524123.1| PREDICTED: Pan troglodytes similar to ribosomal... 42 1.8
500ref|XM_512043.1| PREDICTED: Pan troglodytes similar to ribosomal... 42 1.8

>dbj|AK120033.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-188-A02, full
           insert sequence
          Length = 906

 Score =  291 bits (147), Expect = 1e-75
 Identities = 261/299 (87%)
 Strand = Plus / Minus

                                                                       
Query: 217 aggcggccatggcatccgagcagcttagcattgactccatcaggcaagaccctgccctca 276
           ||||| |||||||| || || |||||||||||||| |||||||||| ||  || ||||| 
Sbjct: 676 aggcgaccatggcaaccaagtagcttagcattgacaccatcaggcatgattctaccctcg 617

                                                                       
Query: 277 ctcttgaacttgaggtagtcattgcggttgaacttggtgaaaccccacttcctgctctca 336
           ||||| | | ||| ||| |||| |||| |||||||||||||||||||||| || ||||||
Sbjct: 616 ctcttaagcctgacgtattcatcgcggctgaacttggtgaaaccccactttctactctca 557

                                                                       
Query: 337 atgatcttttggcgaccagggaacttgaacttggcacgacgaagagcctcagttgcatgg 396
           ||||||||||||||||||||||||||||||||||||||||| || || ||  | ||||||
Sbjct: 556 atgatcttttggcgaccagggaacttgaacttggcacgacggagggcttcgctggcatgg 497

                                                                       
Query: 397 atggcattgttgggcttgcaccgcacagaaaggaggacctggccaatagcaacacgggca 456
           |  ||||||||||||||||||||||||||||||||||||||||||||| | || |  |||
Sbjct: 496 acagcattgttgggcttgcaccgcacagaaaggaggacctggccaatatccaccctagca 437

                                                                      
Query: 457 cagactccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagcccc 515
           |||  |||||| |||||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 436 caggttccctgtggcttcccaaaagcacccctcattccagtctggagcctatctgcccc 378



to top

>emb|X64621.1|OSR22CDNA O.sativa R22 mRNA
          Length = 629

 Score =  291 bits (147), Expect = 1e-75
 Identities = 261/299 (87%)
 Strand = Plus / Minus

                                                                       
Query: 217 aggcggccatggcatccgagcagcttagcattgactccatcaggcaagaccctgccctca 276
           ||||| |||||||| || || |||||||||||||| |||||||||| ||  || ||||| 
Sbjct: 389 aggcgaccatggcaaccaagtagcttagcattgacaccatcaggcatgattctaccctcg 330

                                                                       
Query: 277 ctcttgaacttgaggtagtcattgcggttgaacttggtgaaaccccacttcctgctctca 336
           ||||| | | ||| ||| |||| |||| |||||||||||||||||||||| || ||||||
Sbjct: 329 ctcttaagcctgacgtattcatcgcggctgaacttggtgaaaccccactttctactctca 270

                                                                       
Query: 337 atgatcttttggcgaccagggaacttgaacttggcacgacgaagagcctcagttgcatgg 396
           ||||||||||||||||||||||||||||||||||||||||| || || ||  | ||||||
Sbjct: 269 atgatcttttggcgaccagggaacttgaacttggcacgacggagggcttcgctggcatgg 210

                                                                       
Query: 397 atggcattgttgggcttgcaccgcacagaaaggaggacctggccaatagcaacacgggca 456
           |  ||||||||||||||||||||||||||||||||||||||||||||| | || |  |||
Sbjct: 209 acagcattgttgggcttgcaccgcacagaaaggaggacctggccaatatccaccctagca 150

                                                                      
Query: 457 cagactccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagcccc 515
           |||  |||||| |||||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 149 caggttccctgtggcttcccaaaagcacccctcattccagtctggagcctatctgcccc 91



to top

>dbj|AK066128.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013052E20, full
           insert sequence
          Length = 910

 Score =  291 bits (147), Expect = 1e-75
 Identities = 261/299 (87%)
 Strand = Plus / Minus

                                                                       
Query: 217 aggcggccatggcatccgagcagcttagcattgactccatcaggcaagaccctgccctca 276
           ||||| |||||||| || || |||||||||||||| |||||||||| ||  || ||||| 
Sbjct: 680 aggcgaccatggcaaccaagtagcttagcattgacaccatcaggcatgattctaccctcg 621

                                                                       
Query: 277 ctcttgaacttgaggtagtcattgcggttgaacttggtgaaaccccacttcctgctctca 336
           ||||| | | ||| ||| |||| |||| |||||||||||||||||||||| || ||||||
Sbjct: 620 ctcttaagcctgacgtattcatcgcggctgaacttggtgaaaccccactttctactctca 561

                                                                       
Query: 337 atgatcttttggcgaccagggaacttgaacttggcacgacgaagagcctcagttgcatgg 396
           ||||||||||||||||||||||||||||||||||||||||| || || ||  | ||||||
Sbjct: 560 atgatcttttggcgaccagggaacttgaacttggcacgacggagggcttcgctggcatgg 501

                                                                       
Query: 397 atggcattgttgggcttgcaccgcacagaaaggaggacctggccaatagcaacacgggca 456
           |  ||||||||||||||||||||||||||||||||||||||||||||| | || |  |||
Sbjct: 500 acagcattgttgggcttgcaccgcacagaaaggaggacctggccaatatccaccctagca 441

                                                                      
Query: 457 cagactccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagcccc 515
           |||  |||||| |||||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 440 caggttccctgtggcttcccaaaagcacccctcattccagtctggagcctatctgcccc 382



to top

>dbj|AK062208.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-H08, full
           insert sequence
          Length = 555

 Score =  291 bits (147), Expect = 1e-75
 Identities = 261/299 (87%)
 Strand = Plus / Minus

                                                                       
Query: 217 aggcggccatggcatccgagcagcttagcattgactccatcaggcaagaccctgccctca 276
           ||||| |||||||| || || |||||||||||||| |||||||||| ||  || ||||| 
Sbjct: 325 aggcgaccatggcaaccaagtagcttagcattgacaccatcaggcatgattctaccctcg 266

                                                                       
Query: 277 ctcttgaacttgaggtagtcattgcggttgaacttggtgaaaccccacttcctgctctca 336
           ||||| | | ||| ||| |||| |||| |||||||||||||||||||||| || ||||||
Sbjct: 265 ctcttaagcctgacgtattcatcgcggctgaacttggtgaaaccccactttctactctca 206

                                                                       
Query: 337 atgatcttttggcgaccagggaacttgaacttggcacgacgaagagcctcagttgcatgg 396
           ||||||||||||||||||||||||||||||||||||||||| || || ||  | ||||||
Sbjct: 205 atgatcttttggcgaccagggaacttgaacttggcacgacggagggcttcgctggcatgg 146

                                                                       
Query: 397 atggcattgttgggcttgcaccgcacagaaaggaggacctggccaatagcaacacgggca 456
           |  ||||||||||||||||||||||||||||||||||||||||||||| | || |  |||
Sbjct: 145 acagcattgttgggcttgcaccgcacagaaaggaggacctggccaatatccaccctagca 86

                                                                      
Query: 457 cagactccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagcccc 515
           |||  |||||| |||||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 85  caggttccctgtggcttcccaaaagcacccctcattccagtctggagcctatctgcccc 27



to top

>ref|XM_476047.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 618

 Score =  278 bits (140), Expect = 2e-71
 Identities = 242/276 (87%)
 Strand = Plus / Minus

                                                                       
Query: 240 cttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtagtcatt 299
           |||||||||||| |||||||||| ||  || ||||| ||||| | | ||| ||| |||| 
Sbjct: 594 cttagcattgacaccatcaggcatgattctaccctcgctcttaagcctgacgtattcatc 535

                                                                       
Query: 300 gcggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaa 359
           |||| |||||||||||||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 534 gcggctgaacttggtgaaaccccactttctactctcaatgatcttttggcgaccagggaa 475

                                                                       
Query: 360 cttgaacttggcacgacgaagagcctcagttgcatggatggcattgttgggcttgcaccg 419
           |||||||||||||||||| || || ||  | |||||||  ||||||||||||||||||||
Sbjct: 474 cttgaacttggcacgacggagggcttcgctggcatggacagcattgttgggcttgcaccg 415

                                                                       
Query: 420 cacagaaaggaggacctggccaatagcaacacgggcacagactccctgcggcttcccgaa 479
           ||||||||||||||||||||||||| | || |  ||||||  |||||| |||||||| ||
Sbjct: 414 cacagaaaggaggacctggccaatatccaccctagcacaggttccctgtggcttcccaaa 355

                                               
Query: 480 agcacccctcataccagtctggagcctatcagcccc 515
           |||||||||||| ||||||||||||||||| |||||
Sbjct: 354 agcacccctcattccagtctggagcctatctgcccc 319



to top

>gb|AF470356.1| Triticum aestivum QM mRNA, partial cds
          Length = 537

 Score =  274 bits (138), Expect = 3e-70
 Identities = 172/183 (93%), Gaps = 1/183 (0%)
 Strand = Plus / Minus

                                                                       
Query: 334 tcaatgatcttttggcgaccagggaa-cttgaacttggcacgacgaagagcctcagttgc 392
           ||||| ||||| ||||| |||||||| |||||||||||||||| |||| |||||||| ||
Sbjct: 537 tcaatnatcttntggcggccagggaancttgaacttggcacgangaagggcctcagtggc 478

                                                                       
Query: 393 atggatggcattgttgggcttgcaccgcacagaaaggaggacctggccaatagcaacacg 452
           ||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||
Sbjct: 477 atggatggcattgttgggcttgcaccgcacagaaaggaggacctgcccaatggcaacacg 418

                                                                       
Query: 453 ggcacagactccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagc 512
           |||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 417 ggcacagactccatgcggcttcccaaaagcacccctcataccagtctggagcctatcagc 358

              
Query: 513 ccc 515
           |||
Sbjct: 357 ccc 355



to top

>gb|AC084817.5| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0419C04,
             complete sequence
          Length = 136713

 Score =  220 bits (111), Expect = 3e-54
 Identities = 174/195 (89%)
 Strand = Plus / Minus

                                                                         
Query: 321   ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaag 380
             |||||| || ||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 59031 ccactttctactctcaatgatcttttggcgaccagggaacttgaacttggcacgacggag 58972

                                                                         
Query: 381   agcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctggcc 440
              || ||  | |||||||  |||||||||||||||||||||||||||||||||||||||||
Sbjct: 58971 ggcttcgctggcatggacagcattgttgggcttgcaccgcacagaaaggaggacctggcc 58912

                                                                         
Query: 441   aatagcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtctg 500
             |||| | || |  ||||||  |||||| |||||||| |||||||||||||| ||||||||
Sbjct: 58911 aatatccaccctagcacaggttccctgtggcttcccaaaagcacccctcattccagtctg 58852

                            
Query: 501   gagcctatcagcccc 515
             ||||||||| |||||
Sbjct: 58851 gagcctatctgcccc 58837



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                         
Query: 240   cttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtagtcatt 299
             |||||||||||| |||||||||| ||  || ||||| ||||| | | ||| ||| |||| 
Sbjct: 59216 cttagcattgacaccatcaggcatgattctaccctcgctcttaagcctgacgtattcatc 59157

                                    
Query: 300   gcggttgaacttggtgaaacccc 322
             |||| ||||||||||||||||||
Sbjct: 59156 gcggctgaacttggtgaaacccc 59134



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score =  220 bits (111), Expect = 3e-54
 Identities = 174/195 (89%)
 Strand = Plus / Minus

                                                                           
Query: 321     ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaag 380
               |||||| || ||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 4084337 ccactttctactctcaatgatcttttggcgaccagggaacttgaacttggcacgacggag 4084278

                                                                           
Query: 381     agcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctggcc 440
                || ||  | |||||||  |||||||||||||||||||||||||||||||||||||||||
Sbjct: 4084277 ggcttcgctggcatggacagcattgttgggcttgcaccgcacagaaaggaggacctggcc 4084218

                                                                           
Query: 441     aatagcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtctg 500
               |||| | || |  ||||||  |||||| |||||||| |||||||||||||| ||||||||
Sbjct: 4084217 aatatccaccctagcacaggttccctgtggcttcccaaaagcacccctcattccagtctg 4084158

                              
Query: 501     gagcctatcagcccc 515
               ||||||||| |||||
Sbjct: 4084157 gagcctatctgcccc 4084143



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                           
Query: 240     cttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtagtcatt 299
               |||||||||||| |||||||||| ||  || ||||| ||||| | | ||| ||| |||| 
Sbjct: 4084522 cttagcattgacaccatcaggcatgattctaccctcgctcttaagcctgacgtattcatc 4084463

                                      
Query: 300     gcggttgaacttggtgaaacccc 322
               |||| ||||||||||||||||||
Sbjct: 4084462 gcggctgaacttggtgaaacccc 4084440



to top

>emb|X81692.1|OSSG12G O.sativa SG12 gene
          Length = 1734

 Score =  220 bits (111), Expect = 3e-54
 Identities = 174/195 (89%)
 Strand = Plus / Minus

                                                                        
Query: 321  ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaag 380
            |||||| || ||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 1120 ccactttctactctcaatgatcttttggcgaccagggaacttgaacttggcacgacggag 1061

                                                                        
Query: 381  agcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctggcc 440
             || ||  | |||||||  |||||||||||||||||||||||||||||||||||||||||
Sbjct: 1060 ggcttcgctggcatggacagcattgttgggcttgcaccgcacagaaaggaggacctggcc 1001

                                                                        
Query: 441  aatagcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtctg 500
            |||| | || |  ||||||  |||||| |||||||| |||||||||||||| ||||||||
Sbjct: 1000 aatatccaccctagcacaggttccctgtggcttcccaaaagcacccctcattccagtctg 941

                           
Query: 501  gagcctatcagcccc 515
            ||||||||| |||||
Sbjct: 940  gagcctatctgcccc 926



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                        
Query: 240  cttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtagtcatt 299
            |||||||||||| |||||||||| ||  || ||||| ||||| | | ||| ||| |||| 
Sbjct: 1307 cttagcattgacaccatcaggcatgattctaccctcgctcttaagcctgacgtattcatc 1248

                                   
Query: 300  gcggttgaacttggtgaaacccc 322
            |||| ||||||||||||||||||
Sbjct: 1247 gcggctgaacttggtgaaacccc 1225



to top

>gb|U55048.1|OSU55048 Oryza sativa QM gene, complete cds
          Length = 2542

 Score =  220 bits (111), Expect = 3e-54
 Identities = 174/195 (89%)
 Strand = Plus / Minus

                                                                        
Query: 321  ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaag 380
            |||||| || ||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 1862 ccactttctactctcaatgatcttttggcgaccagggaacttgaacttggcacgacggag 1803

                                                                        
Query: 381  agcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctggcc 440
             || ||  | |||||||  |||||||||||||||||||||||||||||||||||||||||
Sbjct: 1802 ggcttcgctggcatggacagcattgttgggcttgcaccgcacagaaaggaggacctggcc 1743

                                                                        
Query: 441  aatagcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtctg 500
            |||| | || |  ||||||  |||||| |||||||| |||||||||||||| ||||||||
Sbjct: 1742 aatatccaccctagcacaggttccctgtggcttcccaaaagcacccctcattccagtctg 1683

                           
Query: 501  gagcctatcagcccc 515
            ||||||||| |||||
Sbjct: 1682 gagcctatctgcccc 1668



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                        
Query: 240  cttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtagtcatt 299
            |||||||||||| |||||||||| ||  || ||||| ||||| | | ||| ||| |||| 
Sbjct: 2047 cttagcattgacaccatcaggcatgattctaccctcgctcttaagcctgacgtattcatc 1988

                                   
Query: 300  gcggttgaacttggtgaaacccc 322
            |||| ||||||||||||||||||
Sbjct: 1987 gcggctgaacttggtgaaacccc 1965



to top

>gb|BT016528.1| Zea mays clone Contig361 mRNA sequence
          Length = 814

 Score =  194 bits (98), Expect = 2e-46
 Identities = 239/286 (83%)
 Strand = Plus / Minus

                                                                       
Query: 232 ccgagcagcttagcattgactccatcaggcaagaccctgccctcactcttgaacttgagg 291
           ||||||||||| || ||||| |||||||| |  |  |||||||| |||||| |||| |||
Sbjct: 586 ccgagcagctttgcgttgacaccatcaggaacaattctgccctcgctcttgtacttcagg 527

                                                                       
Query: 292 tagtcattgcggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcga 351
           ||||||  |||| ||||||||||||| |||||||| ||||||||||||||||||||||| 
Sbjct: 526 tagtcagcgcggctgaacttggtgaagccccactttctgctctcaatgatcttttggcgg 467

                                                                       
Query: 352 ccagggaacttgaacttggcacgacgaagagcctcagttgcatggatggcattgttgggc 411
           ||||||||||||||||| || ||||| ||||| ||  | ||||||   |||||||||  |
Sbjct: 466 ccagggaacttgaacttagcgcgacgcagagcttcgctggcatgggcagcattgttgtcc 407

                                                                       
Query: 412 ttgcaccgcacagaaaggaggacctggccaatagcaacacgggcacagactccctgcggc 471
           ||||| ||||| |||||||||||||| |||||  | || |  ||||||   ||||| |||
Sbjct: 406 ttgcatcgcacggaaaggaggacctgaccaatgtccaccctagcacaggtgccctgaggc 347

                                                         
Query: 472 ttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           || || || ||||||||||| |||||||||||||| ||||||||||
Sbjct: 346 ttgccaaaggcacccctcattccagtctggagcctgtcagccccag 301



to top

>gb|BT016423.1| Zea mays clone Contig256 mRNA sequence
          Length = 959

 Score =  186 bits (94), Expect = 5e-44
 Identities = 238/286 (83%)
 Strand = Plus / Minus

                                                                       
Query: 232 ccgagcagcttagcattgactccatcaggcaagaccctgccctcactcttgaacttgagg 291
           ||||||||||| || ||||| |||||||| |  |  || |||||||||||| |||| |||
Sbjct: 656 ccgagcagctttgcgttgacaccatcaggaacaattctaccctcactcttgtacttcagg 597

                                                                       
Query: 292 tagtcattgcggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcga 351
           |||||    ||| ||||||||||||| |||||||| ||||||||||| ||||||||||| 
Sbjct: 596 tagtcggcacggctgaacttggtgaagccccactttctgctctcaataatcttttggcgg 537

                                                                       
Query: 352 ccagggaacttgaacttggcacgacgaagagcctcagttgcatggatggcattgttgggc 411
           |||||||||||||||||||| ||||| ||||| ||| | |||||    |||||||||  |
Sbjct: 536 ccagggaacttgaacttggcgcgacgcagagcttcactggcatgtgcagcattgttgtcc 477

                                                                       
Query: 412 ttgcaccgcacagaaaggaggacctggccaatagcaacacgggcacagactccctgcggc 471
           ||||| || ||||||||||||||||| |||||  | || |  ||||||   ||||| |||
Sbjct: 476 ttgcatcgaacagaaaggaggacctgaccaatgtccaccctagcacaggtgccctgaggc 417

                                                         
Query: 472 ttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           || || || ||||||||||| |||||||||||||||||||||||||
Sbjct: 416 ttgccaaaggcacccctcattccagtctggagcctatcagccccag 371



to top

>gb|AY103671.1| Zea mays PCO135454 mRNA sequence
          Length = 1044

 Score =  182 bits (92), Expect = 8e-43
 Identities = 236/284 (83%)
 Strand = Plus / Minus

                                                                       
Query: 232 ccgagcagcttagcattgactccatcaggcaagaccctgccctcactcttgaacttgagg 291
           ||||||||||| || ||||| |||||||| |  |  || |||||||||||| |||| |||
Sbjct: 700 ccgagcagctttgcgttgacaccatcaggaacaattctaccctcactcttgtacttcagg 641

                                                                       
Query: 292 tagtcattgcggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcga 351
           |||||    ||| ||||||||||||| |||||||| ||||||||||| ||||||||||| 
Sbjct: 640 tagtcggcacggctgaacttggtgaagccccactttctgctctcaataatcttttggcgg 581

                                                                       
Query: 352 ccagggaacttgaacttggcacgacgaagagcctcagttgcatggatggcattgttgggc 411
           |||||||||||||||||||| ||||| ||||| ||| | |||||    |||||||||  |
Sbjct: 580 ccagggaacttgaacttggcgcgacgcagagcttcactggcatgtgcagcattgttgtcc 521

                                                                       
Query: 412 ttgcaccgcacagaaaggaggacctggccaatagcaacacgggcacagactccctgcggc 471
           ||||| || ||||||||||||||||| |||||  | || |  ||||||   ||||| |||
Sbjct: 520 ttgcatcgaacagaaaggaggacctgaccaatgtccaccctagcacaggtgccctgaggc 461

                                                       
Query: 472 ttcccgaaagcacccctcataccagtctggagcctatcagcccc 515
           || || || ||||||||||| |||||||||||||||||||||||
Sbjct: 460 ttgccaaaggcacccctcattccagtctggagcctatcagcccc 417



to top

>gb|U06108.1|ZMU06108 Zea mays B73 QM protein mRNA, complete cds
          Length = 928

 Score =  180 bits (91), Expect = 3e-42
 Identities = 235/283 (83%)
 Strand = Plus / Minus

                                                                       
Query: 233 cgagcagcttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggt 292
           |||||||||| || ||||| |||||||| |  |  |||||||| |||||| |||| ||||
Sbjct: 634 cgagcagctttgcgttgacaccatcaggaacaattctgccctcgctcttgtacttcaggt 575

                                                                       
Query: 293 agtcattgcggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgac 352
           |||||  |||| ||||||||||||| |||||||| ||||||||||||||||| |||||  
Sbjct: 574 agtcagcgcggctgaacttggtgaagccccactttctgctctcaatgatcttctggcggg 515

                                                                       
Query: 353 cagggaacttgaacttggcacgacgaagagcctcagttgcatggatggcattgttgggct 412
           |||||||||||||||| || ||||| ||||| ||  | ||||||   |||||||||  ||
Sbjct: 514 cagggaacttgaacttagcgcgacgcagagcttcgctggcatgggcagcattgttgtcct 455

                                                                       
Query: 413 tgcaccgcacagaaaggaggacctggccaatagcaacacgggcacagactccctgcggct 472
           |||| ||||| |||||||||||||| |||||  | || |  ||||||   ||||| ||||
Sbjct: 454 tgcagcgcacggaaaggaggacctgaccaatgtccaccctagcacaggtgccctgaggct 395

                                                      
Query: 473 tcccgaaagcacccctcataccagtctggagcctatcagcccc 515
           | || || ||||||||||| |||||||||||||||||||||||
Sbjct: 394 tgccaaaggcacccctcattccagtctggagcctatcagcccc 352



to top

>gb|AF542972.1| Triticum aestivum SC34 tumor suppressor-like mRNA, complete
           sequence
          Length = 836

 Score =  168 bits (85), Expect = 1e-38
 Identities = 232/281 (82%)
 Strand = Plus / Minus

                                                                       
Query: 235 agcagcttagcattgactccatcaggcaagaccctgccctcactcttgaacttgaggtag 294
           ||||||||||||||||| |||||||||| ||  || |||||||||||| |||||| ||| 
Sbjct: 653 agcagcttagcattgacaccatcaggcacgattcttccctcactcttgtacttgatgtaa 594

                                                                       
Query: 295 tcattgcggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgacca 354
           |||     |||||||||||| || ||||||||||||||   |||||||||||| || |||
Sbjct: 593 tcagccttgttgaacttggtaaagccccacttcctgctgcgaatgatcttttgacggcca 534

                                                                       
Query: 355 gggaacttgaacttggcacgacgaagagcctcagttgcatggatggcattgttgggcttg 414
           |||||||||||||||||||| || || || |||   ||||| |  |||||| |   ||||
Sbjct: 533 gggaacttgaacttggcacggcggagggcttcatcagcatgaacagcattgctctccttg 474

                                                                       
Query: 415 caccgcacagaaaggaggacctggccaatagcaacacgggcacagactccctgcggcttc 474
           || |||||||| ||||| || ||||||||  | ||||| ||||||   ||| | ||||||
Sbjct: 473 cagcgcacagataggagtacttggccaatgtccacacgagcacaggtacccagaggcttc 414

                                                    
Query: 475 ccgaaagcacccctcataccagtctggagcctatcagcccc 515
           || |||||||||||||| |||||||||||||||||||||||
Sbjct: 413 ccaaaagcacccctcattccagtctggagcctatcagcccc 373



to top

>dbj|AK102971.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033115J23, full
           insert sequence
          Length = 995

 Score =  157 bits (79), Expect = 4e-35
 Identities = 259/319 (81%)
 Strand = Plus / Minus

                                                                       
Query: 199 ccaggggcacggttcgcaaggcggccatggcatccgagcagcttagcattgactccatca 258
           ||||||||||| |||||||| || |||||  | || ||||||| ||||||||| ||||||
Sbjct: 695 ccaggggcacgcttcgcaagacgaccatgagaaccaagcagctgagcattgacaccatca 636

                                                                       
Query: 259 ggcaagaccctgccctcactcttgaacttgaggtagtcattgcggttgaacttggtgaaa 318
           | ||  |  |||||||||  ||| ||||||| ||| || |  ||| ||||||||||||| 
Sbjct: 635 gacataattctgccctcagccttcaacttgacgtactcctcacgggtgaacttggtgaag 576

                                                                       
Query: 319 ccccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacga 378
           |||||||||||||| |  ||||||||||| || ||||||||||||||||||||||| || 
Sbjct: 575 ccccacttcctgctgtggatgatcttttgccggccagggaacttgaacttggcacggcgg 516

                                                                       
Query: 379 agagcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctgg 438
           || |||||    |||||  | |||||| |   |||||| || |||||||| || ||||| 
Sbjct: 515 agtgcctcttcagcatgtttagcattgctctccttgcaacgaacagaaagaagaacctga 456

                                                                       
Query: 439 ccaatagcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtc 498
           |||||  | || || ||||||   ||||| |||||||| |||||||||||||| ||||| 
Sbjct: 455 ccaatgtccacgcgagcacaggtaccctgaggcttcccaaaagcacccctcattccagtt 396

                              
Query: 499 tggagcctatcagccccag 517
           |||||||||||||||||||
Sbjct: 395 tggagcctatcagccccag 377



to top

>dbj|AK060902.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-D11, full
           insert sequence
          Length = 1034

 Score =  157 bits (79), Expect = 4e-35
 Identities = 259/319 (81%)
 Strand = Plus / Minus

                                                                       
Query: 199 ccaggggcacggttcgcaaggcggccatggcatccgagcagcttagcattgactccatca 258
           ||||||||||| |||||||| || |||||  | || ||||||| ||||||||| ||||||
Sbjct: 701 ccaggggcacgcttcgcaagacgaccatgagaaccaagcagctgagcattgacaccatca 642

                                                                       
Query: 259 ggcaagaccctgccctcactcttgaacttgaggtagtcattgcggttgaacttggtgaaa 318
           | ||  |  |||||||||  ||| ||||||| ||| || |  ||| ||||||||||||| 
Sbjct: 641 gacataattctgccctcagccttcaacttgacgtactcctcacgggtgaacttggtgaag 582

                                                                       
Query: 319 ccccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacga 378
           |||||||||||||| |  ||||||||||| || ||||||||||||||||||||||| || 
Sbjct: 581 ccccacttcctgctgtggatgatcttttgccggccagggaacttgaacttggcacggcgg 522

                                                                       
Query: 379 agagcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctgg 438
           || |||||    |||||  | |||||| |   |||||| || |||||||| || ||||| 
Sbjct: 521 agtgcctcttcagcatgtttagcattgctctccttgcaacgaacagaaagaagaacctga 462

                                                                       
Query: 439 ccaatagcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtc 498
           |||||  | || || ||||||   ||||| |||||||| |||||||||||||| ||||| 
Sbjct: 461 ccaatgtccacgcgagcacaggtaccctgaggcttcccaaaagcacccctcattccagtt 402

                              
Query: 499 tggagcctatcagccccag 517
           |||||||||||||||||||
Sbjct: 401 tggagcctatcagccccag 383



to top

>gb|U55212.1|OSU55212 Oryza sativa Wilms' tumor-related protein QM mRNA, partial cds
          Length = 747

 Score =  157 bits (79), Expect = 4e-35
 Identities = 259/319 (81%)
 Strand = Plus / Minus

                                                                       
Query: 199 ccaggggcacggttcgcaaggcggccatggcatccgagcagcttagcattgactccatca 258
           ||||||||||| |||||||| || |||||  | || ||||||| ||||||||| ||||||
Sbjct: 483 ccaggggcacgcttcgcaagacgaccatgagaaccaagcagctgagcattgacaccatca 424

                                                                       
Query: 259 ggcaagaccctgccctcactcttgaacttgaggtagtcattgcggttgaacttggtgaaa 318
           | ||  |  |||||||||  ||| ||||||| ||| || |  ||| ||||||||||||| 
Sbjct: 423 gacataattctgccctcagccttcaacttgacgtactcctcacgggtgaacttggtgaag 364

                                                                       
Query: 319 ccccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacga 378
           |||||||||||||| |  ||||||||||| || ||||||||||||||||||||||| || 
Sbjct: 363 ccccacttcctgctgtggatgatcttttgccggccagggaacttgaacttggcacggcgg 304

                                                                       
Query: 379 agagcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctgg 438
           || |||||    |||||  | |||||| |   |||||| || |||||||| || ||||| 
Sbjct: 303 agtgcctcttcagcatgtttagcattgctctccttgcaacgaacagaaagaagaacctga 244

                                                                       
Query: 439 ccaatagcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtc 498
           |||||  | || || ||||||   ||||| |||||||| |||||||||||||| ||||| 
Sbjct: 243 ccaatgtccacgcgagcacaggtaccctgaggcttcccaaaagcacccctcattccagtt 184

                              
Query: 499 tggagcctatcagccccag 517
           |||||||||||||||||||
Sbjct: 183 tggagcctatcagccccag 165



to top

>emb|X81691.1|OSSC34MR O.sativa SC34 mRNA for tumor suppressor
          Length = 971

 Score =  151 bits (76), Expect = 3e-33
 Identities = 261/320 (81%), Gaps = 2/320 (0%)
 Strand = Plus / Minus

                                                                       
Query: 199 ccaggggcacggttcgcaaggcggccatggcatccgagcagcttagcattgactccatca 258
           ||||||||||| |||||||| || |||||  | || ||||||||||||||||| ||||||
Sbjct: 679 ccaggggcacgcttcgcaagacgaccatgagaaccaagcagcttagcattgacaccatca 620

                                                                       
Query: 259 ggcaagaccctgccctcactcttgaacttgaggtagtcatt-gcggttgaacttggtgaa 317
           | ||  |  |||||||||  ||| |||||||| || ||    |||| |||||||||||||
Sbjct: 619 gacataattctgccctcagccttcaacttgag-tactctcacgcggctgaacttggtgaa 561

                                                                       
Query: 318 accccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacg 377
            |||||||||||||| | |||||||||||| || ||||||||||||||||||||||| ||
Sbjct: 560 gccccacttcctgctgtgaatgatcttttgccggccagggaacttgaacttggcacggcg 501

                                                                       
Query: 378 aagagcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctg 437
            || |||||    |||||  | |||||| |   |||||| || |||||||| || |||||
Sbjct: 500 gagtgcctcttcagcatgtttagcattgctctccttgcaacgaacagaaagaagaacctg 441

                                                                       
Query: 438 gccaatagcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagt 497
            |||||  | || || ||||||   ||||| |||||||| |||||||||||||| |||||
Sbjct: 440 accaatgtccacgcgagcacaggtaccctgaggcttcccaaaagcacccctcattccagt 381

                               
Query: 498 ctggagcctatcagccccag 517
            |||||||||||||||||||
Sbjct: 380 ttggagcctatcagccccag 361



to top

>dbj|AK103710.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033136P16, full
           insert sequence
          Length = 973

 Score =  149 bits (75), Expect = 1e-32
 Identities = 258/319 (80%)
 Strand = Plus / Minus

                                                                       
Query: 199 ccaggggcacggttcgcaaggcggccatggcatccgagcagcttagcattgactccatca 258
           ||||||||||| |||||||| || |||||  | || ||||||| ||||||||| ||||||
Sbjct: 695 ccaggggcacgcttcgcaagacgaccatgagaaccaagcagctgagcattgacaccatca 636

                                                                       
Query: 259 ggcaagaccctgccctcactcttgaacttgaggtagtcattgcggttgaacttggtgaaa 318
           | ||  |  |||||||||  ||| ||||||| ||| || |  ||| ||||||||||||| 
Sbjct: 635 gacataattctgccctcagccttcaacttgacgtactcctcacgggtgaacttggtgaag 576

                                                                       
Query: 319 ccccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacga 378
           |||||||||||||| |   |||||||||| || ||||||||||||||||||||||| || 
Sbjct: 575 ccccacttcctgctgtgggtgatcttttgccggccagggaacttgaacttggcacggcgg 516

                                                                       
Query: 379 agagcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctgg 438
           || |||||    |||||  | |||||| |   |||||| || |||||||| || ||||| 
Sbjct: 515 agtgcctcttcagcatgtttagcattgctctccttgcaacgaacagaaagaagaacctga 456

                                                                       
Query: 439 ccaatagcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtc 498
           |||||  | || || ||||||   ||||| |||||||| |||||||||||||| ||||| 
Sbjct: 455 ccaatgtccacgcgagcacaggtaccctgaggcttcccaaaagcacccctcattccagtt 396

                              
Query: 499 tggagcctatcagccccag 517
           |||||||||||||||||||
Sbjct: 395 tggagcctatcagccccag 377



to top

>gb|BT012759.1| Lycopersicon esculentum clone 113703R, mRNA sequence
          Length = 847

 Score =  145 bits (73), Expect = 2e-31
 Identities = 178/213 (83%)
 Strand = Plus / Minus

                                                                       
Query: 305 tgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttga 364
           ||||||| ||||| |||||||| |||||  |||| |||||||| || ||||| ||||| |
Sbjct: 565 tgaacttagtgaacccccactttctgctgacaataatcttttgtcggccaggaaacttaa 506

                                                                       
Query: 365 acttggcacgacgaagagcctcagttgcatggatggcattgttgggcttgcaccgcacag 424
           |||| ||||| |||||||||||    |||||| | ||||||      |||||||| || |
Sbjct: 505 acttagcacggcgaagagcctcttgagcatggttagcattgccatctttgcaccgaaccg 446

                                                                       
Query: 425 aaaggaggacctggccaatagcaacacgggcacagactccctgcggcttcccgaaagcac 484
           | || || ||||| ||||||||||||||||||||||||||||| ||||| |||||||| |
Sbjct: 445 agagaagaacctgaccaatagcaacacgggcacagactccctgtggcttaccgaaagctc 386

                                            
Query: 485 ccctcataccagtctggagcctatcagccccag 517
           | ||||||||||| |||||||||||||||||||
Sbjct: 385 ctctcataccagtttggagcctatcagccccag 353



to top

>gb|DQ056435.1| Lycopersicon esculentum 60S ribosomal protein L10 (ACI29) mRNA,
           complete cds
          Length = 890

 Score =  145 bits (73), Expect = 2e-31
 Identities = 178/213 (83%)
 Strand = Plus / Minus

                                                                       
Query: 305 tgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttga 364
           ||||||| ||||| |||||||| |||||  |||| |||||||| || ||||| ||||| |
Sbjct: 555 tgaacttagtgaacccccactttctgctgacaataatcttttgtcggccaggaaacttaa 496

                                                                       
Query: 365 acttggcacgacgaagagcctcagttgcatggatggcattgttgggcttgcaccgcacag 424
           |||| ||||| |||||||||||    |||||| | ||||||      |||||||| || |
Sbjct: 495 acttagcacggcgaagagcctcttgagcatggttagcattgccatctttgcaccgaaccg 436

                                                                       
Query: 425 aaaggaggacctggccaatagcaacacgggcacagactccctgcggcttcccgaaagcac 484
           | || || ||||| ||||||||||||||||||||||||||||| ||||| |||||||| |
Sbjct: 435 agagaagaacctgaccaatagcaacacgggcacagactccctgtggcttaccgaaagctc 376

                                            
Query: 485 ccctcataccagtctggagcctatcagccccag 517
           | ||||||||||| |||||||||||||||||||
Sbjct: 375 ctctcataccagtttggagcctatcagccccag 343



to top

>emb|Z14083.1|NTTRP N.tabacum mRNA for protein homologue to human Wilm's tumor-related
           protein HUMQM (partial)
          Length = 615

 Score =  123 bits (62), Expect = 6e-25
 Identities = 95/106 (89%)
 Strand = Plus / Minus

                                                                       
Query: 412 ttgcaccgcacagaaaggaggacctggccaatagcaacacgggcacagactccctgcggc 471
           ||||| || ||||| || || ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 211 ttgcagcgaacagatagaagaacctgaccaatagcaacacgggcacagactccctgtggc 152

                                                         
Query: 472 ttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           || || ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 151 ttaccaaaagctcccctcataccagtttggagcctatcagccccag 106



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 72/82 (87%)
 Strand = Plus / Minus

                                                                       
Query: 305 tgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttga 364
           ||||||| ||||| ||||||||||||||  ||||||||||||| || | |||||||||||
Sbjct: 318 tgaacttagtgaacccccacttcctgctgacaatgatcttttgacggcgagggaacttga 259

                                 
Query: 365 acttggcacgacgaagagcctc 386
           |||| ||||| || ||||||||
Sbjct: 258 actttgcacggcgcagagcctc 237



to top

>gb|DQ228354.1| Solanum tuberosum clone 150H09 60S ribosomal protein L10-like
           protein mRNA, complete cds
          Length = 841

 Score =  121 bits (61), Expect = 2e-24
 Identities = 79/85 (92%)
 Strand = Plus / Minus

                                                                       
Query: 433 acctggccaatagcaacacgggcacagactccctgcggcttcccgaaagcacccctcata 492
           ||||| ||||||||||||||||||||||||||||||||||| || ||||| || ||||||
Sbjct: 417 acctgaccaatagcaacacgggcacagactccctgcggcttaccaaaagctcctctcata 358

                                    
Query: 493 ccagtctggagcctatcagccccag 517
           ||||| |||||||||||||||||||
Sbjct: 357 ccagtttggagcctatcagccccag 333



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 72/82 (87%)
 Strand = Plus / Minus

                                                                       
Query: 305 tgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttga 364
           ||||||| ||||| |||||||| |||||  ||||||||||||| || ||||||||||| |
Sbjct: 545 tgaacttagtgaacccccactttctgctgacaatgatcttttgtcggccagggaacttaa 486

                                 
Query: 365 acttggcacgacgaagagcctc 386
           |||| ||||| |||||||||||
Sbjct: 485 acttagcacggcgaagagcctc 464



to top

>gb|AY641430.1| Caragana jubata QM family protein (QM) mRNA, complete cds
          Length = 977

 Score =  109 bits (55), Expect = 9e-21
 Identities = 76/83 (91%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           |||||| |||||||||| ||||||||||||||  ||||||||||||| ||||||||||||
Sbjct: 542 cggttgtacttggtgaatccccacttcctgctgacaatgatcttttgacgaccagggaac 483

                                  
Query: 361 ttgaacttggcacgacgaagagc 383
           |||||||| |||||||| |||||
Sbjct: 482 ttgaactttgcacgacgcagagc 460



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 84/101 (83%)
 Strand = Plus / Minus

                                                                       
Query: 412 ttgcaccgcacagaaaggaggacctggccaatagcaacacgggcacagactccctgcggc 471
           ||||| || ||||| ||||||||||| ||||| || ||||| |||||   ||| || |||
Sbjct: 431 ttgcagcggacagacaggaggacctgaccaatggccacacgtgcacatgttccttgaggc 372

                                                    
Query: 472 ttcccgaaagcacccctcataccagtctggagcctatcagc 512
           || || ||||| || | ||||||||||||||||||||||||
Sbjct: 371 ttaccaaaagctcctcgcataccagtctggagcctatcagc 331



to top

>gb|AY641733.1| Camellia sinensis QM-like protein mRNA, complete cds
          Length = 969

 Score =  109 bits (55), Expect = 9e-21
 Identities = 76/83 (91%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           |||||| |||||||||| ||||||||||||||  ||||||||||||| ||||||||||||
Sbjct: 533 cggttgtacttggtgaatccccacttcctgctgacaatgatcttttgacgaccagggaac 474

                                  
Query: 361 ttgaacttggcacgacgaagagc 383
           |||||||| |||||||| |||||
Sbjct: 473 ttgaactttgcacgacgcagagc 451



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 84/101 (83%)
 Strand = Plus / Minus

                                                                       
Query: 412 ttgcaccgcacagaaaggaggacctggccaatagcaacacgggcacagactccctgcggc 471
           ||||| || ||||| ||||||||||| ||||| || ||||| |||||   ||| || |||
Sbjct: 422 ttgcagcggacagacaggaggacctgaccaatggccacacgtgcacatgttccttgaggc 363

                                                    
Query: 472 ttcccgaaagcacccctcataccagtctggagcctatcagc 512
           || || ||||| || | ||||||||||||||||||||||||
Sbjct: 362 ttaccaaaagctcctcgcataccagtctggagcctatcagc 322



to top

>ref|NM_102455.1| Arabidopsis thaliana structural constituent of ribosome AT1G26910
           mRNA, complete cds
          Length = 872

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           ||||| ||||||||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 592 cggttaaacttggtgaacccccatttcctgctaacaatgatcttttgacgaccagggaac 533

                                     
Query: 361 ttgaacttggcacgacgaagagcctc 386
           || ||||| |||||||||||||||||
Sbjct: 532 ttaaacttagcacgacgaagagcctc 507



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| |||||||||||||| || |||||||| ||||
Sbjct: 415 aaagcacctctcataccagtctgaagtctatcagctccag 376



to top

>gb|BT024605.1| Arabidopsis thaliana At1g26910 mRNA, complete cds
          Length = 666

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           ||||| ||||||||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 533 cggttaaacttggtgaacccccatttcctgctaacaatgatcttttgacgaccagggaac 474

                                     
Query: 361 ttgaacttggcacgacgaagagcctc 386
           || ||||| |||||||||||||||||
Sbjct: 473 ttaaacttagcacgacgaagagcctc 448



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| |||||||||||||| || |||||||| ||||
Sbjct: 356 aaagcacctctcataccagtctgaagtctatcagctccag 317



to top

>gb|AC147460.1| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNAb0050G15, complete sequence
          Length = 126156

 Score =  105 bits (53), Expect = 1e-19
 Identities = 161/197 (81%)
 Strand = Plus / Minus

                                                                         
Query: 321   ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaag 380
             |||||||||||| |  ||||||||||| || ||||||||||||||||||||||| || ||
Sbjct: 94758 ccacttcctgctgtggatgatcttttgccggccagggaacttgaacttggcacggcggag 94699

                                                                         
Query: 381   agcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctggcc 440
              |||||    |||||  | |||||| |   |||||| || |||||||| || ||||| ||
Sbjct: 94698 tgcctcttcagcatgtttagcattgctctccttgcaacgaacagaaagaagaacctgacc 94639

                                                                         
Query: 441   aatagcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtctg 500
             |||  | || || ||||||   ||||| |||||||| |||||||||||||| ||||| ||
Sbjct: 94638 aatgtccacgcgagcacaggtaccctgaggcttcccaaaagcacccctcattccagtttg 94579

                              
Query: 501   gagcctatcagccccag 517
             |||||||||||||||||
Sbjct: 94578 gagcctatcagccccag 94562



to top

>gb|AC123524.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0052C03, complete sequence
          Length = 157178

 Score =  105 bits (53), Expect = 1e-19
 Identities = 161/197 (81%)
 Strand = Plus / Minus

                                                                         
Query: 321   ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaag 380
             |||||||||||| |  ||||||||||| || ||||||||||||||||||||||| || ||
Sbjct: 28602 ccacttcctgctgtggatgatcttttgccggccagggaacttgaacttggcacggcggag 28543

                                                                         
Query: 381   agcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctggcc 440
              |||||    |||||  | |||||| |   |||||| || |||||||| || ||||| ||
Sbjct: 28542 tgcctcttcagcatgtttagcattgctctccttgcaacgaacagaaagaagaacctgacc 28483

                                                                         
Query: 441   aatagcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtctg 500
             |||  | || || ||||||   ||||| |||||||| |||||||||||||| ||||| ||
Sbjct: 28482 aatgtccacgcgagcacaggtaccctgaggcttcccaaaagcacccctcattccagtttg 28423

                              
Query: 501   gagcctatcagccccag 517
             |||||||||||||||||
Sbjct: 28422 gagcctatcagccccag 28406



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  105 bits (53), Expect = 1e-19
 Identities = 161/197 (81%)
 Strand = Plus / Minus

                                                                           
Query: 321     ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaag 380
               |||||||||||| |  ||||||||||| || ||||||||||||||||||||||| || ||
Sbjct: 6245324 ccacttcctgctgtggatgatcttttgccggccagggaacttgaacttggcacggcggag 6245265

                                                                           
Query: 381     agcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctggcc 440
                |||||    |||||  | |||||| |   |||||| || |||||||| || ||||| ||
Sbjct: 6245264 tgcctcttcagcatgtttagcattgctctccttgcaacgaacagaaagaagaacctgacc 6245205

                                                                           
Query: 441     aatagcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtctg 500
               |||  | || || ||||||   ||||| |||||||| |||||||||||||| ||||| ||
Sbjct: 6245204 aatgtccacgcgagcacaggtaccctgaggcttcccaaaagcacccctcattccagtttg 6245145

                                
Query: 501     gagcctatcagccccag 517
               |||||||||||||||||
Sbjct: 6245144 gagcctatcagccccag 6245128



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  105 bits (53), Expect = 1e-19
 Identities = 161/197 (81%)
 Strand = Plus / Minus

                                                                           
Query: 321     ccacttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaag 380
               |||||||||||| |  ||||||||||| || ||||||||||||||||||||||| || ||
Sbjct: 6311791 ccacttcctgctgtggatgatcttttgccggccagggaacttgaacttggcacggcggag 6311732

                                                                           
Query: 381     agcctcagttgcatggatggcattgttgggcttgcaccgcacagaaaggaggacctggcc 440
                |||||    |||||  | |||||| |   |||||| || |||||||| || ||||| ||
Sbjct: 6311731 tgcctcttcagcatgtttagcattgctctccttgcaacgaacagaaagaagaacctgacc 6311672

                                                                           
Query: 441     aatagcaacacgggcacagactccctgcggcttcccgaaagcacccctcataccagtctg 500
               |||  | || || ||||||   ||||| |||||||| |||||||||||||| ||||| ||
Sbjct: 6311671 aatgtccacgcgagcacaggtaccctgaggcttcccaaaagcacccctcattccagtttg 6311612

                                
Query: 501     gagcctatcagccccag 517
               |||||||||||||||||
Sbjct: 6311611 gagcctatcagccccag 6311595



to top

>gb|AY087264.1| Arabidopsis thaliana clone 33391 mRNA, complete sequence
          Length = 872

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           ||||| ||||||||||| ||||| ||||||||  ||||||||||||| ||||| ||||||
Sbjct: 592 cggttaaacttggtgaacccccatttcctgctaacaatgatcttttgacgacccgggaac 533

                                     
Query: 361 ttgaacttggcacgacgaagagcctc 386
           || ||||| |||||||||||||||||
Sbjct: 532 ttaaacttagcacgacgaagagcctc 507



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| |||||||||||||| || |||||||| ||||
Sbjct: 415 aaagcacctctcataccagtctgaagtctatcagctccag 376



to top

>ref|NM_101298.2| Arabidopsis thaliana structural constituent of ribosome AT1G14320
           mRNA, complete cds
          Length = 972

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 583 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 524

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 523 ttagcacgacgaagagcctc 504



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| |||||||||||||| ||||||||||| ||||
Sbjct: 412 aaagcacctctcataccagtctgaagcctatcagctccag 373



to top

>gb|BT000679.1| Arabidopsis thaliana clone RAFL07-10-D02 (R10643) putative tumor
           suppressor (At1g14320) mRNA, complete cds
          Length = 920

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 571 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 512

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 511 ttagcacgacgaagagcctc 492



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| |||||||||||||| ||||||||||| ||||
Sbjct: 400 aaagcacctctcataccagtctgaagcctatcagctccag 361



to top

>gb|AY113989.1| Arabidopsis thaliana putative tumor suppressor protein (At1g14320)
           mRNA, complete cds
          Length = 694

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 527 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 468

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 467 ttagcacgacgaagagcctc 448



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| |||||||||||||| ||||||||||| ||||
Sbjct: 356 aaagcacctctcataccagtctgaagcctatcagctccag 317



to top

>gb|AY045866.1| Arabidopsis thaliana putative tumor suppressor protein (At1g14320)
           mRNA, complete cds
          Length = 966

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 574 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 515

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 514 ttagcacgacgaagagcctc 495



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| |||||||||||||| ||||||||||| ||||
Sbjct: 403 aaagcacctctcataccagtctgaagcctatcagctccag 364



to top

>gb|AF428470.1|AF428470 Arabidopsis thaliana At1g14320/F14L17_28 mRNA, complete cds
          Length = 923

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 574 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 515

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 514 ttagcacgacgaagagcctc 495



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| |||||||||||||| ||||||||||| ||||
Sbjct: 403 aaagcacctctcataccagtctgaagcctatcagctccag 364



to top

>gb|AF428286.1|AF428286 Arabidopsis thaliana At1g14320/F14L17_28 mRNA, complete cds
          Length = 882

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 574 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 515

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 514 ttagcacgacgaagagcctc 495



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| |||||||||||||| ||||||||||| ||||
Sbjct: 403 aaagcacctctcataccagtctgaagcctatcagctccag 364



to top

>gb|AY050482.1| Arabidopsis thaliana At1g14320/F14L17_28 mRNA, complete cds
          Length = 360

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 224 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 165

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 164 ttagcacgacgaagagcctc 145



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| |||||||||||||| ||||||||||| ||||
Sbjct: 53  aaagcacctctcataccagtctgaagcctatcagctccag 14



to top

>gb|AF378902.1|AF378902 Arabidopsis thaliana At1g14320/F14L17_28 mRNA, complete cds
          Length = 542

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 233 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 174

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 173 ttagcacgacgaagagcctc 154



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| |||||||||||||| ||||||||||| ||||
Sbjct: 62  aaagcacctctcataccagtctgaagcctatcagctccag 23



to top

>emb|BX816389.1|CNS0AE93 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH45ZB11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 465

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 157 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 98

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 97  ttagcacgacgaagagcctc 78



to top

>emb|BX816136.1|CNS0AE2V Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH2ZH02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 869

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 561 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 502

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 501 ttagcacgacgaagagcctc 482



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| |||||||||||||  ||||||||||| ||||
Sbjct: 390 aaagcacctctcataccagtcttaagcctatcagctccag 351



to top

>emb|Z15157.1|ATWILMTSH A.thaliana mRNA for Wilm's tumor suppressor homologue
          Length = 880

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 aacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttgaac 366
           ||||| ||||| ||||| ||||||||  |||| |||||||| ||||||||||||||||||
Sbjct: 554 aacttcgtgaagccccatttcctgctgacaataatcttttgacgaccagggaacttgaac 495

                               
Query: 367 ttggcacgacgaagagcctc 386
           || |||||||||||||||||
Sbjct: 494 ttagcacgacgaagagcctc 475



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| |||||||||||||| ||||||||||| ||||
Sbjct: 383 aaagcacctctcataccagtctgaagcctatcagctccag 344



to top

>gb|AF180758.1|AF180758 Vitis riparia 60S ribosomal protein L10 (QM) mRNA, complete cds
          Length = 980

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 75/84 (89%)
 Strand = Plus / Minus

                                                                       
Query: 303 gttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaactt 362
           ||||||||| ||||||||||||||||||||  ||||||||||||| ||  ||||||||||
Sbjct: 564 gttgaactttgtgaaaccccacttcctgctgacaatgatcttttgacgggcagggaactt 505

                                   
Query: 363 gaacttggcacgacgaagagcctc 386
           ||| || |||||||| ||||||||
Sbjct: 504 gaattttgcacgacggagagcctc 481



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 223 ccatggcatccgagcagcttagcattgactccatcagg 260
           |||||||||||||| ||||| |||||||| ||||||||
Sbjct: 644 ccatggcatccgagaagcttggcattgacaccatcagg 607



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 469 ggcttcccgaaagcacccctcataccagtctggagcctatc 509
           ||||| || |||||||||||||| ||||| || ||||||||
Sbjct: 398 ggcttaccaaaagcacccctcattccagtttgaagcctatc 358



to top

>gb|AC012188.2|F14L17 Sequence of BAC F14L17 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 111686

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                         
Query: 325   ttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaagagcc 384
             ||||||||  |||| |||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 20126 ttcctgctgacaataatcttttgacgaccagggaacttgaacttagcacgacgaagagcc 20067

               
Query: 385   tc 386
             ||
Sbjct: 20066 tc 20065



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                     
Query: 478   aaagcacccctcataccagtctggagcctatcagccccag 517
             |||||||| |||||||||||||| ||||||||||| ||||
Sbjct: 19973 aaagcacctctcataccagtctgaagcctatcagctccag 19934



to top

>gb|AC005508.1|AC005508 Arabidopsis thaliana chromosome I BAC T2P11 genomic sequence, complete
             sequence
          Length = 85372

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                         
Query: 325   ttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaagagcc 384
             ||||||||  ||||||||||||| |||||||||||||| ||||| |||||||||||||||
Sbjct: 30483 ttcctgctaacaatgatcttttgacgaccagggaacttaaacttagcacgacgaagagcc 30424

               
Query: 385   tc 386
             ||
Sbjct: 30423 tc 30422



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                     
Query: 478   aaagcacccctcataccagtctggagcctatcagccccag 517
             |||||||| |||||||||||||| || |||||||| ||||
Sbjct: 30330 aaagcacctctcataccagtctgaagtctatcagctccag 30291



to top

>ref|NM_105329.1| Arabidopsis thaliana structural constituent of ribosome AT1G66580
           mRNA, complete cds
          Length = 882

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           |||||||| || ||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 576 cggttgaatttagtgaatccccatttcctgctaacaatgatcttttgacgaccagggaac 517

                                  
Query: 361 ttgaacttggcacgacgaagagc 383
           || ||||| || | |||||||||
Sbjct: 516 ttaaacttagctctacgaagagc 494



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 399 aaagcacctctcattccagtctgaagcctatcagctccag 360



to top

>gb|AY055103.1| Arabidopsis thaliana At1g66580/T12I7_3 mRNA, complete cds
          Length = 666

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           |||||||| || ||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 533 cggttgaatttagtgaatccccatttcctgctaacaatgatcttttgacgaccagggaac 474

                                  
Query: 361 ttgaacttggcacgacgaagagc 383
           || ||||| || | |||||||||
Sbjct: 473 ttaaacttagctctacgaagagc 451



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 356 aaagcacctctcattccagtctgaagcctatcagctccag 317



to top

>gb|AF367276.1|AF367276 Arabidopsis thaliana At1g66580/T12I7_3 mRNA, complete cds
          Length = 835

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           |||||||| || ||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 576 cggttgaatttagtgaatccccatttcctgctaacaatgatcttttgacgaccagggaac 517

                                  
Query: 361 ttgaacttggcacgacgaagagc 383
           || ||||| || | |||||||||
Sbjct: 516 ttaaacttagctctacgaagagc 494



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 399 aaagcacctctcattccagtctgaagcctatcagctccag 360



to top

>emb|BX816025.1|CNS0ABON Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH23ZE11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 839

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           |||||||| || ||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 557 cggttgaatttagtgaatccccatttcctgctaacaatgatcttttgacgaccagggaac 498

                                  
Query: 361 ttgaacttggcacgacgaagagc 383
           || ||||| || | |||||||||
Sbjct: 497 ttaaacttagctctacgaagagc 475



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 380 aaagcacctctcattccagtctgaagcctatcagctccag 341



to top

>emb|BX815625.1|CNS0ABEZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS78ZG01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 854

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           |||||||| || ||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 549 cggttgaatttagtgaatccccatttcctgctaacaatgatcttttgacgaccagggaac 490

                                  
Query: 361 ttgaacttggcacgacgaagagc 383
           || ||||| || | |||||||||
Sbjct: 489 ttaaacttagctctacgaagagc 467



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 372 aaagcacctctcattccagtctgaagcctatcagctccag 333



to top

>gb|AY087426.1| Arabidopsis thaliana clone 35307 mRNA, complete sequence
          Length = 882

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           |||||||| || ||||| ||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 576 cggttgaatttagtgaatccccatttcctgctaacaatgatcttttgacgaccagggaac 517

                                  
Query: 361 ttgaacttggcacgacgaagagc 383
           || ||||| || | |||||||||
Sbjct: 516 ttaaacttagctctacgaagagc 494



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 399 aaagcacctctcattccagtctgaagcctatcagctccag 360



to top

>gb|AC140545.26| Medicago truncatula clone mth2-11g18, complete sequence
          Length = 129414

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 148/182 (81%), Gaps = 2/182 (1%)
 Strand = Plus / Plus

                                                                          
Query: 337    atgatcttttggcgaccagggaacttgaacttggcacgacgaagagcctcagttgcatgg 396
              ||||||||||| || ||||||||||| ||||| |||||||| || |||||    ||||||
Sbjct: 106479 atgatcttttgacggccagggaacttaaacttagcacgacggagggcctcctgagcatgg 106538

                                                                          
Query: 397    atggca-ttgttgggcttgcaccgcacagaaaggaggacctggccaatagcaacacgggc 455
               ||||  ||||||   ||||| || |||||||| || ||||| |||||||| || |  ||
Sbjct: 106539 -tggctgttgttgtctttgcaacggacagaaagaagcacctgcccaatagccactctagc 106597

                                                                          
Query: 456    acagactccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagcccc 515
              ||| || ||||| ||||| || |||||||||||||||||||| || || |||||||| ||
Sbjct: 106598 acaaacaccctggggctttccaaaagcacccctcataccagtttgaagtctatcagcacc 106657

                
Query: 516    ag 517
              ||
Sbjct: 106658 ag 106659



to top

>dbj|AB001582.1| Solanum melongena mRNA for QM family protein, partial cds
          Length = 413

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                       
Query: 305 tgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttga 364
           ||||||||||||| |||||||| |||||  ||||||||||||| || ||||| ||||| |
Sbjct: 317 tgaacttggtgaatccccactttctgctgacaatgatcttttgacggccaggaaacttaa 258

                                 
Query: 365 acttggcacgacgaagagcctc 386
           |||| ||||| || ||||||||
Sbjct: 257 acttagcacggcgcagagcctc 236



to top

>dbj|AB001891.1| Solanum melongena mRNA for QM family protein, complete cds
          Length = 820

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                       
Query: 305 tgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaacttga 364
           ||||||||||||| |||||||| |||||  ||||||||||||| || ||||| ||||| |
Sbjct: 565 tgaacttggtgaatccccactttctgctgacaatgatcttttgacggccaggaaacttaa 506

                                 
Query: 365 acttggcacgacgaagagcctc 386
           |||| ||||| || ||||||||
Sbjct: 505 acttagcacggcgcagagcctc 484



to top

>gb|AY829778.1| Lonomia obliqua ribosomal protein L10 mRNA, complete cds
          Length = 396

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                            
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctca 387
           |||||| || ||||||||||||||||||||||||||||| |||||||||
Sbjct: 231 gatcttctgacgaccagggaacttgaacttggcacgacgcagagcctca 183



to top

>gb|AF368032.1|AF368032 Heliothis virescens QM protein mRNA, complete cds
          Length = 711

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                        
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagc 383
           |||||| |||||||||||||||||||||||||||||||| |||||
Sbjct: 495 gatcttctggcgaccagggaacttgaacttggcacgacgcagagc 451



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| | ||| |||||||||||||||||||| ||||
Sbjct: 356 aaagcaccacgcattccagtctggagcctatcagctccag 317



to top

>gb|DQ440008.1| Aedes aegypti clone AE-200A ribosomal protein L10 mRNA, complete
           cds
          Length = 660

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 495 gatcttctggcgaccggggaacttgaacttggcacgacgcagagcctc 448



to top

>emb|CR938586.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YF21AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 768

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 561 gatcttctggcgaccggggaacttgaacttggcacgacgcagagcctc 514



to top

>emb|CR938540.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YI18AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 700

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 565 gatcttctggcgaccggggaacttgaacttggcacgacgcagagcctc 518



to top

>emb|CR938096.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YK16AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 944

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 568 gatcttctggcgaccggggaacttgaacttggcacgacgcagagcctc 521



to top

>emb|CR938095.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 3-prime end of clone
           KW0AAA2YK16BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 813

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 361 gatcttctggcgaccggggaacttgaacttggcacgacgcagagcctc 408



to top

>emb|CR937970.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YO19AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 932

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 561 gatcttctggcgaccggggaacttgaacttggcacgacgcagagcctc 514



to top

>emb|CR937222.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 5-prime end of clone
           KW0AAB2YJ23AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 812

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 567 gatcttctggcgaccggggaacttgaacttggcacgacgcagagcctc 520



to top

>gb|AY763500.1| Danio rerio QM protein (QM) mRNA, complete cds
          Length = 769

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagc 512
           ||||| ||||||||||| ||||| | ||||||||||||||||||||||||
Sbjct: 396 ccctgaggcttcccgaacgcaccacgcataccagtctggagcctatcagc 347



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 339 gatcttttggcgaccagggaacttgaacttggc 371
           |||||| || || ||||||||||||||||||||
Sbjct: 520 gatcttctgacggccagggaacttgaacttggc 488



to top

>emb|CR938702.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YA10AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 705

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 341 tcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||| |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 563 tcttctggcgaccggggaacttgaacttggcacgacgcagagcctc 518



to top

>ref|XM_686253.1| PREDICTED: Danio rerio similar to Ribosomal protein L10
           (LOC573236), mRNA
          Length = 687

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagc 512
           ||||| ||||||||||| ||||| | ||||||||||||||||||||||||
Sbjct: 491 ccctgaggcttcccgaacgcaccacgcataccagtctggagcctatcagc 442



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 339 gatcttttggcgaccagggaacttgaacttggc 371
           |||||| || || ||||||||||||||||||||
Sbjct: 615 gatcttctgacggccagggaacttgaacttggc 583



to top

>gb|AY762997.1| Ctenopharyngodon idella QM (QM) mRNA, complete cds
          Length = 759

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagc 512
           ||||| ||||| ||||||||||| | ||||||||||||||||||||||||
Sbjct: 393 ccctgaggcttaccgaaagcaccacgcataccagtctggagcctatcagc 344



to top

>gb|BC045950.1| Danio rerio ribosomal protein L10, mRNA (cDNA clone MGC:56154
           IMAGE:5412436), complete cds
          Length = 768

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagc 512
           ||||| ||||||||||| ||||| | ||||||||||||||||||||||||
Sbjct: 394 ccctgaggcttcccgaacgcaccacgcataccagtctggagcctatcagc 345



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 339 gatcttttggcgaccagggaacttgaacttggc 371
           |||||| || || ||||||||||||||||||||
Sbjct: 518 gatcttctgacggccagggaacttgaacttggc 486



to top

>ref|NM_200027.1| Danio rerio ribosomal protein L10 (rpl10), mRNA
          Length = 768

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagc 512
           ||||| ||||||||||| ||||| | ||||||||||||||||||||||||
Sbjct: 394 ccctgaggcttcccgaacgcaccacgcataccagtctggagcctatcagc 345



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 339 gatcttttggcgaccagggaacttgaacttggc 371
           |||||| || || ||||||||||||||||||||
Sbjct: 518 gatcttctgacggccagggaacttgaacttggc 486



to top

>gb|AF227620.1|AF227620 Euphorbia esula 60S ribosomal protein L10 mRNA, complete cds
          Length = 852

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           |||||||  ||||||||||||||||| |||||  |||| |||||||||||||| || |||
Sbjct: 557 cggttgattttggtgaaaccccactttctgctgacaataatcttttggcgaccgggaaac 498

                         
Query: 361 ttgaacttggcacg 374
           || ||||| |||||
Sbjct: 497 ttaaacttagcacg 484



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 433 acctggccaatagcaacacgggcacagactccctgcggcttcccgaaagcacccctcata 492
           ||||| ||||||||||| |  ||||| || ||||| ||||| || |||||||| ||||||
Sbjct: 425 acctgtccaatagcaactctagcacaaacaccctgaggctttccaaaagcacctctcata 366

                               
Query: 493 ccagtctggagcctatcagc 512
           ||||| || |||||||||||
Sbjct: 365 ccagtttgaagcctatcagc 346



to top

>gb|AY440350.1| Armigeres subalbatus ASAP ID: 41357 cytosolic large ribosomal
           subunit L10 mRNA sequence
          Length = 927

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| || ||||| ||||||||||||||||||||||| ||||||||
Sbjct: 535 gatcttctgacgaccggggaacttgaacttggcacgacgcagagcctc 488



to top

>emb|AM049018.1| Curculio glandium partial mRNA for ribosomal protein L10e (rpL10e
           gene)
          Length = 321

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           ||||||||| || || ||||||||||||||||||||||| ||||||||
Sbjct: 156 gatcttttgacgtccggggaacttgaacttggcacgacggagagcctc 109



to top

>emb|BX071681.1|CNS09RH1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 541 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 494



to top

>emb|BX066414.1|CNS09NEQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 543 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 496



to top

>emb|BX066294.1|CNS09NBE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 534

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 205 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 158



to top

>emb|BX062161.1|CNS09K4L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 608

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 518 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 471



to top

>emb|BX054818.1|CNS09EGM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 554 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 507



to top

>emb|BX054800.1|CNS09EG4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 747

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 240 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 287



to top

>emb|BX054799.1|CNS09EG3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 865

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 556 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 509



to top

>emb|BX046336.1|CNS097X0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 264 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 311



to top

>emb|BX045752.1|CNS097GS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 529 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 482



to top

>emb|BX045505.1|CNS0979X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 599 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 552



to top

>emb|BX043067.1|CNS095E7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15BF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 263 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 310



to top

>emb|BX043066.1|CNS095E6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15BF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1022

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 704 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 657



to top

>emb|BX044599.1|CNS096KR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 618

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 550 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 503



to top

>emb|BX043398.1|CNS095NE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 740

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 514 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 467



to top

>emb|BX038980.1|CNS0928O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 586

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 297 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 344



to top

>emb|BX037545.1|CNS0914T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 690

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 299 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 346



to top

>emb|BX037544.1|CNS0914S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 747

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 559 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 512



to top

>emb|BX031114.1|CNS08W66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1046

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 955 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 908



to top

>emb|BX026833.1|CNS08SV9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 661

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 547 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 500



to top

>emb|BX025006.1|CNS08RGI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 567

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 251 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 298



to top

>emb|BX025005.1|CNS08RGH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 540 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 493



to top

>emb|BX024539.1|CNS08R3J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 541 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 494



to top

>emb|BX020659.1|CNS08O3R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 542

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 149 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 196



to top

>emb|BX019389.1|CNS08N4H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 531 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 484



to top

>emb|BX018993.1|CNS08MTH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 536 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 489



to top

>emb|BX017940.1|CNS08M08 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 266 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 313



to top

>emb|BX017939.1|CNS08M07 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 535 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 488



to top

>emb|BX018773.1|CNS08MND Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 226

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 82  gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 129



to top

>emb|BX018772.1|CNS08MNC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 553 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 506



to top

>emb|BX017778.1|CNS08LVQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 788

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 228 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 275



to top

>emb|BX017777.1|CNS08LVP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA26DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 962 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 915



to top

>emb|BX016960.1|CNS08L90 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 576 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 529



to top

>emb|BX012859.1|CNS08I33 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2BD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 595

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 266 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 313



to top

>emb|BX012858.1|CNS08I32 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2BD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 836

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 529 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 482



to top

>emb|BX010419.1|CNS08G7B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 538 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 491



to top

>emb|BX008095.1|CNS08EER Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 802

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 281 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 328



to top

>emb|BX008094.1|CNS08EEQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 692

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 362 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 315



to top

>emb|BX005642.1|CNS08CIM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA1AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 429

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 130 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 83



to top

>ref|XM_312560.2| Anopheles gambiae str. PEST ENSANGP00000014921
           (ENSANGG00000012432), partial mRNA
          Length = 757

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 598 gatcttctggcgacccgggaacttgaacttggcacgacgcagcgcctc 551



to top

>gb|AF118822.1|AF118822 Arabidopsis thaliana senescence-associated protein (SAG24) mRNA,
           partial cds
          Length = 169

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 301 cggttgaacttggtgaaaccccacttcctgctctcaatgatcttttggcgaccagggaac 360
           |||| ||| || ||||| ||||| ||| ||||  ||||||||||||| ||||||||||||
Sbjct: 161 cggtngaatttagtgaatccccatttcgtgctaacaatgatcttttgacgaccagggaac 102

                                  
Query: 361 ttgaacttggcacgacgaagagc 383
           || ||||| || | |||||||||
Sbjct: 101 ttaaacttagctctacgaagagc 79



to top

>emb|BX026834.1|CNS08SVA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 379

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                  
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacg 377
           |||||| |||||||| |||||||||||||||||||||||
Sbjct: 263 gatcttctggcgacccgggaacttgaacttggcacgacg 301



to top

>emb|CR937221.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 3-prime end of clone
           KW0AAB2YJ23BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 527

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 340 atcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           ||||| |||||||| ||||||||||||||||||||||| | ||||||
Sbjct: 364 atcttctggcgaccggggaacttgaacttggcacgacgcaaagcctc 410



to top

>gb|AC079285.1|AC079285 Arabidopsis thaliana chromosome 1 BAC T12I7 genomic sequence,
            complete sequence
          Length = 35308

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 325  ttcctgctctcaatgatcttttggcgaccagggaacttgaacttggcacgacgaagagc 383
            ||||||||  ||||||||||||| |||||||||||||| ||||| || | |||||||||
Sbjct: 9480 ttcctgctaacaatgatcttttgacgaccagggaacttaaacttagctctacgaagagc 9422



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 478  aaagcacccctcataccagtctggagcctatcagccccag 517
            |||||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 9327 aaagcacctctcattccagtctgaagcctatcagctccag 9288



to top

>gb|AF295636.1|AF295636 Elaeis guineensis QM-like protein mRNA, complete cds
          Length = 974

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 337 atgatcttttggcgaccagggaacttgaacttggcacgacgaagagc 383
           ||||||||||| || ||||||||||||||||||||||| || |||||
Sbjct: 530 atgatcttttgacggccagggaacttgaacttggcacggcgcagagc 484



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 469 ggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| || ||||||||||| |||||||| ||||||||||| ||||
Sbjct: 398 ggcttcccaaaggcacccctcattccagtctgaagcctatcagctccag 350



to top

>gb|AC113107.15| Mus musculus chromosome 10, clone RP23-325G13, complete sequence
          Length = 207239

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                              
Query: 339   gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctca 387
             |||||| ||||| |||||||||||||||||||| | | |||||||||||
Sbjct: 45628 gatcttctggcggccagggaacttgaacttggctctatgaagagcctca 45580



to top

>emb|AM049016.1| Biphyllus lunatus mRNA for ribosomal protein L10e (rpL10e gene)
          Length = 657

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagc 383
           ||||||||| || || ||||||||||| |||||||||||||||||
Sbjct: 495 gatcttttgacgtccggggaacttgaatttggcacgacgaagagc 451



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| | ||| || ||||||||||||||||| ||||
Sbjct: 356 aaagcaccacgcattccggtctggagcctatcagctccag 317



to top

>emb|BX038979.1|CNS0928N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 554

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 346 tggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 553 tggcgacccgggaacttgaacttggcacgacgcagcgcctc 513



to top

>gb|AC153942.8| Mus musculus 10 BAC RP24-174M19 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 146201

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                              
Query: 339   gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctca 387
             |||||| ||||| |||||||||||||||||||| | | |||||||||||
Sbjct: 11542 gatcttctggcggccagggaacttgaacttggctctatgaagagcctca 11590



to top

>dbj|AB180439.1| Plutella xylostella mRNA for QM protein, complete cds
          Length = 705

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 355 gggaacttgaacttggcacgacgaagagcctca 387
           ||||||||||||||||||||||| |||||||||
Sbjct: 508 gggaacttgaacttggcacgacgcagagcctca 476



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 466 tgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           |||||||| ||||| ||||| | ||| |||||||||||||||||||| ||||
Sbjct: 397 tgcggcttgccgaacgcaccacgcatcccagtctggagcctatcagctccag 346



to top

>gb|AY769278.1| Bombyx mori ribosomal protein L10 (RpL10) mRNA, complete cds
          Length = 726

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           ||||||||| || || |||||||||||||||||||| || ||||||||
Sbjct: 513 gatcttttgacgtccggggaacttgaacttggcacggcgcagagcctc 466



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || || ||||| | ||| |||||||||||||||||||| ||||
Sbjct: 389 ccctgaggcttgccaaacgcaccacgcatcccagtctggagcctatcagctccag 335



to top

>ref|XM_868582.1| PREDICTED: Bos taurus similar to ribosomal protein L10 (LOC616541),
           mRNA
          Length = 489

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 340 atcttttggcgaccagggaacttgaacttggc 371
           ||||| ||||||||||||||||||||||||||
Sbjct: 338 atcttctggcgaccagggaacttgaacttggc 307



to top

>gb|U60651.1| Hydra vulgaris ribosomal protein L10 mRNA, complete cds
          Length = 709

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 340 atcttttggcgaccagggaacttgaacttggc 371
           |||||||| |||||||||||||||||||||||
Sbjct: 511 atcttttgacgaccagggaacttgaacttggc 480



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 478 aaagcacccctcataccagtctggagcctatcagcccc 515
           |||||||| ||||| ||||| |||||||||||||||||
Sbjct: 373 aaagcacctctcattccagtttggagcctatcagcccc 336



to top

>gb|AC147002.20| Medicago truncatula clone mth2-151m16, complete sequence
          Length = 128621

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                 
Query: 335   caatgatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
             |||| ||||| || || ||||||||||| ||||| |||||||||||||||||
Sbjct: 63185 caataatcttctgacgcccagggaacttaaacttagcacgacgaagagcctc 63134



to top

>emb|BX051816.1|CNS09C58 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 339 gatcttttggcgaccagggaacttgaacttggcacg 374
           |||||||||||| || ||||||||||||||||||||
Sbjct: 545 gatcttttggcggccggggaacttgaacttggcacg 510



to top

>dbj|AB223250.1| Aspergillus oryzae cDNA, contig sequence: AoEST0081
          Length = 802

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           ||||||||||||||||||||||||| || ||| ||| || ||||||||
Sbjct: 520 gatcttttggcgaccagggaacttgtacatggaacggcggagagcctc 473



to top

>dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011
          Length = 2505489

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                               
Query: 339     gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
               ||||||||||||||||||||||||| || ||| ||| || ||||||||
Sbjct: 1970364 gatcttttggcgaccagggaacttgtacatggaacggcggagagcctc 1970411



to top

>gb|AF395838.1|AF395838 Bombyx mori QM protein (QM) mRNA, complete cds
          Length = 751

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           ||||||||| || || |||||||||||||||||||| || ||||||||
Sbjct: 512 gatcttttgacgtccggggaacttgaacttggcacggcgcagagcctc 465



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 493 ccagtctggagcctatcagccccag 517
           |||||||||||||||||||| ||||
Sbjct: 358 ccagtctggagcctatcagctccag 334



to top

>gb|AY130416.1| Petromyzon marinus ribosomal protein L10 mRNA, partial cds
          Length = 642

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| |||||||| ||||||||||||||||| ||||| | ||||||
Sbjct: 495 gatcttctggcgacccgggaacttgaacttggcgcgacggaaagcctc 448



to top

>gb|AY130414.1| Branchiostoma lanceolatum ribosomal protein L10 mRNA, partial cds
          Length = 581

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| ||||| |||||||||||||||||||| || || ||||||||
Sbjct: 463 gatcttctggcgtccagggaacttgaacttggctcggcgcagagcctc 416



to top

>emb|BX005483.3| Zebrafish DNA sequence from clone CH211-286G12 in linkage group 23,
             complete sequence
          Length = 182479

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                         
Query: 463   ccctgcggcttcccgaaagcacccctcataccagtctggagcct 506
             ||||| ||||||||||| ||||| | ||||||||||||||||||
Sbjct: 13800 ccctgaggcttcccgaacgcaccacgcataccagtctggagcct 13757



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 352   ccagggaacttgaacttggc 371
             ||||||||||||||||||||
Sbjct: 13911 ccagggaacttgaacttggc 13892



to top

>gb|AY168758.1| Branchiostoma belcheri tsingtaunese ribosomal protein L10 mRNA,
           complete cds
          Length = 763

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||| ||||| |||||||||||||||||||| || || ||||||||
Sbjct: 512 gatcttctggcggccagggaacttgaacttggctcggcgcagagcctc 465



to top

>gb|AF099012.1|AF099012 Bombyx mandarina QM protein mRNA, complete cds
          Length = 735

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 339 gatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           ||||||||| || || |||||||||||||||||||| || ||||||||
Sbjct: 527 gatcttttgacgtccggggaacttgaacttggcacggcgcagagcctc 480



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || || ||||| | ||| |||||||||||||||||||| ||||
Sbjct: 403 ccctgaggcttgccaaacgcaccacgcatcccagtctggagcctatcagctccag 349



to top

>emb|CR450723.12| Zebrafish DNA sequence from clone DKEY-47C8 in linkage group 23,
             complete sequence
          Length = 234987

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                         
Query: 463   ccctgcggcttcccgaaagcacccctcataccagtctggagcct 506
             ||||| ||||||||||| ||||| | ||||||||||||||||||
Sbjct: 28609 ccctgaggcttcccgaacgcaccacgcataccagtctggagcct 28566



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 352   ccagggaacttgaacttggc 371
             ||||||||||||||||||||
Sbjct: 28720 ccagggaacttgaacttggc 28701



to top

>gb|AF013804.1| Pinus taeda Wilm's tumor supressor homolog (lp20) mRNA, complete
           cds
          Length = 1055

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 82/100 (82%)
 Strand = Plus / Minus

                                                                       
Query: 418 cgcacagaaaggaggacctggccaatagcaacacgggcacagactccctgcggcttcccg 477
           ||||| ||||||||||| || || || |||||||| |||||   |||||| || || || 
Sbjct: 639 cgcactgaaaggaggacttgacctatggcaacacgtgcacatgttccctgaggttttcca 580

                                                   
Query: 478 aaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| || ||||| ||||| ||||||||||| |||||||
Sbjct: 579 aaagctcctctcattccagtttggagcctatcggccccag 540



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 352 ccagggaacttgaacttggcacgacg 377
           ||||||||||||||||||||||||||
Sbjct: 705 ccagggaacttgaacttggcacgacg 680



to top

>ref|XM_658595.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN6083.2), mRNA
          Length = 753

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 337 atgatcttttggcgaccagggaacttg 363
           |||||||||||||||||||||||||||
Sbjct: 584 atgatcttttggcgaccagggaacttg 558



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggag 503
           ||||| ||||| ||||||||||| | |||||| ||||||||
Sbjct: 458 ccctggggctttccgaaagcaccacgcataccggtctggag 418



to top

>emb|CR734854.2|CNS0GTSL Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 318 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 372



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 207 ccagggaacttgaacttggc 226



to top

>emb|CR734175.2|CNS0GT9Q Tetraodon nigroviridis full-length cDNA
          Length = 697

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR720542.2|CNS0GIX0 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR728834.2|CNS0GPBC Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR720275.2|CNS0GIPL Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR722877.2|CNS0GKPV Tetraodon nigroviridis full-length cDNA
          Length = 696

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 383 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 329



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 494 ccagggaacttgaacttggc 475



to top

>emb|CR722708.2|CNS0GKL6 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR722363.2|CNS0GKBL Tetraodon nigroviridis full-length cDNA
          Length = 667

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 350 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 296



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 461 ccagggaacttgaacttggc 442



to top

>emb|CR720772.2|CNS0GJ3E Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR717491.2|CNS0GGK9 Tetraodon nigroviridis full-length cDNA
          Length = 820

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| |||||||| | ||| |||||||||||||  ||||||||||
Sbjct: 503 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccag 449



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 614 ccagggaacttgaacttggc 595



to top

>emb|CR717039.2|CNS0GG7S Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| |||||||| | ||| |||||||||||||  ||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR716839.2|CNS0GG28 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| |||||||| | ||| |||||||||||||  ||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR716359.2|CNS0GFOW Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| |||||||| | ||| |||||||||||||  ||||||||||
Sbjct: 438 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccag 384



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 549 ccagggaacttgaacttggc 530



to top

>emb|CR715715.2|CNS0GF73 Tetraodon nigroviridis full-length cDNA
          Length = 666

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| |||||||| | ||| |||||||||||||  ||||||||||
Sbjct: 349 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccag 295



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 460 ccagggaacttgaacttggc 441



to top

>emb|CR714866.2|CNS0GEJI Tetraodon nigroviridis full-length cDNA
          Length = 726

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| |||||||| | ||| |||||||||||||  ||||||||||
Sbjct: 409 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccag 355



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 520 ccagggaacttgaacttggc 501



to top

>emb|CR714125.2|CNS0GDYX Tetraodon nigroviridis full-length cDNA
          Length = 818

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| |||||||| | ||| |||||||||||||  ||||||||||
Sbjct: 504 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccag 450



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 615 ccagggaacttgaacttggc 596



to top

>emb|CR712979.2|CNS0GD33 Tetraodon nigroviridis full-length cDNA
          Length = 461

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| |||||||| | ||| |||||||||||||  ||||||||||
Sbjct: 144 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccag 90



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 255 ccagggaacttgaacttggc 236



to top

>emb|CR713339.2|CNS0GDD3 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| |||||||| | ||| |||||||||||||  ||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR713296.2|CNS0GDBW Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| |||||||| | ||| |||||||||||||  ||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR712692.2|CNS0GCV4 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| |||||||| | ||| |||||||||||||  ||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR711229.2|CNS0GBQH Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| |||||||| | ||| |||||||||||||  ||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR710615.2|CNS0GB9F Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| |||||||| | ||| |||||||||||||  ||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR708839.2|CNS0G9W3 Tetraodon nigroviridis full-length cDNA
          Length = 726

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| |||||||| | ||| |||||||||||||  ||||||||||
Sbjct: 409 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccag 355



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 520 ccagggaacttgaacttggc 501



to top

>emb|CR708432.2|CNS0G9KS Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| |||||||| | ||| |||||||||||||  ||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR706206.2|CNS0G7UY Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| |||||||| | ||| |||||||||||||  ||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR704971.2|CNS0G6WN Tetraodon nigroviridis full-length cDNA
          Length = 820

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| |||||||| | ||| |||||||||||||  ||||||||||
Sbjct: 503 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccag 449



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 614 ccagggaacttgaacttggc 595



to top

>emb|CR704750.2|CNS0G6QI Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| |||||||| | ||| |||||||||||||  ||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR704546.2|CNS0G6KU Tetraodon nigroviridis full-length cDNA
          Length = 865

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 544 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 490



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 657 ccagggaacttgaacttggc 638



to top

>emb|CR703247.2|CNS0G5KR Tetraodon nigroviridis full-length cDNA
          Length = 916

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| |||||||| | ||| |||||||||||||  ||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR702411.2|CNS0G4XJ Tetraodon nigroviridis full-length cDNA
          Length = 918

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 383 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 329



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 494 ccagggaacttgaacttggc 475



to top

>emb|CR699842.2|CNS0G2Y6 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR699390.2|CNS0G2LM Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR698890.2|CNS0G27Q Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR698626.2|CNS0G20E Tetraodon nigroviridis full-length cDNA
          Length = 696

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR697360.2|CNS0G118 Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



to top

>emb|CR696503.2|CNS0G0DF Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR695584.2|CNS0FZNW Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR695012.2|CNS0FZ80 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR693370.2|CNS0FXYE Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR692920.2|CNS0FXLW Tetraodon nigroviridis full-length cDNA
          Length = 956

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 381 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 327



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 492 ccagggaacttgaacttggc 473



to top

>emb|CR691720.2|CNS0FWOK Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR690750.2|CNS0FVXM Tetraodon nigroviridis full-length cDNA
          Length = 690

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 373 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 319



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 484 ccagggaacttgaacttggc 465



to top

>emb|CR687822.2|CNS0FTOA Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>gb|BC058467.1| Rattus norvegicus ribosomal protein L10, mRNA (cDNA clone MGC:72797
           IMAGE:6918973), complete cds
          Length = 788

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| || ||||| | |||||| ||||||||||| ||||||||||
Sbjct: 418 ccctggggcttcccaaaggcaccacgcatacctgtctggagcctgtcagccccag 364



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 339 gatcttttggcgaccagggaacttgaacttggc 371
           |||||| ||||| ||||||||||||||||||||
Sbjct: 542 gatcttctggcggccagggaacttgaacttggc 510



to top

>emb|CR683944.2|CNS0FQOK Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR683389.2|CNS0FQ95 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR683865.2|CNS0FQMD Tetraodon nigroviridis full-length cDNA
          Length = 418

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 101 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 47



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 212 ccagggaacttgaacttggc 193



to top

>emb|CR683765.2|CNS0FQJL Tetraodon nigroviridis full-length cDNA
          Length = 700

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 383 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 329



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 494 ccagggaacttgaacttggc 475



to top

>emb|CR682972.2|CNS0FPXK Tetraodon nigroviridis full-length cDNA
          Length = 727

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 410 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 356



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 521 ccagggaacttgaacttggc 502



to top

>emb|CR682444.2|CNS0FPIW Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| |||||||| | ||| |||||||||||||  ||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR682415.2|CNS0FPI3 Tetraodon nigroviridis full-length cDNA
          Length = 915

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| |||||||| | ||| |||||||||||||  ||||||||||
Sbjct: 382 ccctgaggcttcccaaaagcaccacgcattccagtctggagccggtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR680276.2|CNS0FNUO Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR679679.2|CNS0FNE3 Tetraodon nigroviridis full-length cDNA
          Length = 668

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 351 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 297



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 462 ccagggaacttgaacttggc 443



to top

>emb|CR679292.2|CNS0FN3C Tetraodon nigroviridis full-length cDNA
          Length = 665

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 350 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 296



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 461 ccagggaacttgaacttggc 442



to top

>emb|CR678745.2|CNS0FMO5 Tetraodon nigroviridis full-length cDNA
          Length = 667

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 349 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 295



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 460 ccagggaacttgaacttggc 441



to top

>emb|CR677248.2|CNS0FLJ0 Tetraodon nigroviridis full-length cDNA
          Length = 694

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR677235.2|CNS0FLIN Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR676747.2|CNS0FL53 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR675816.2|CNS0FKFI Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR671887.2|CNS0FHED Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR670190.2|CNS0FG38 Tetraodon nigroviridis full-length cDNA
          Length = 696

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR669765.2|CNS0FFRF Tetraodon nigroviridis full-length cDNA
          Length = 697

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR669547.2|CNS0FFLD Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR668289.2|CNS0FEMF Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR667800.2|CNS0FE8U Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR667784.2|CNS0FE8E Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR666481.2|CNS0FD87 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR666070.2|CNS0FCWS Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR665292.2|CNS0FCB6 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR664416.2|CNS0FBMU Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR664793.2|CNS0FBXB Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR664317.2|CNS0FBK3 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR663825.2|CNS0FB6F Tetraodon nigroviridis full-length cDNA
          Length = 696

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR661995.2|CNS0F9RL Tetraodon nigroviridis full-length cDNA
          Length = 691

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 374 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 320



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 485 ccagggaacttgaacttggc 466



to top

>emb|CR661060.1|CNS0F91M Tetraodon nigroviridis full-length cDNA
          Length = 690

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 379 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 325



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 490 ccagggaacttgaacttggc 471



to top

>emb|CR660123.2|CNS0F8BL Tetraodon nigroviridis full-length cDNA
          Length = 676

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 384 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 330



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 495 ccagggaacttgaacttggc 476



to top

>emb|CR658652.2|CNS0F76Q Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR657230.2|CNS0F638 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR656598.2|CNS0F5LO Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR655837.2|CNS0F50J Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR655821.2|CNS0F503 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR652829.2|CNS0F2OZ Tetraodon nigroviridis full-length cDNA
          Length = 490

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



to top

>emb|CR651640.2|CNS0F1RY Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>ref|XM_660558.1| Cryptosporidium hominis TU502 ribosomal protein L10 (Chro.60480)
           partial mRNA
          Length = 669

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 479 aagcacccctcataccagtctggagcctatc 509
           ||||||| |||||||||||||||||||||||
Sbjct: 355 aagcacctctcataccagtctggagcctatc 325



to top

>emb|CR650120.2|CNS0F0LQ Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR649290.2|CNS0EZYO Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR647942.2|CNS0EYX8 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR646246.2|CNS0EXM4 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR644771.2|CNS0EWH5 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR642622.2|CNS0EUTG Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR642404.2|CNS0EUNE Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR642314.2|CNS0EUKW Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR642260.2|CNS0EUJE Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR641599.2|CNS0EU11 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR641870.2|CNS0EU8K Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR641322.2|CNS0ETTC Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR640947.2|CNS0ETIX Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR640163.2|CNS0ESX5 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR639985.2|CNS0ESS7 Tetraodon nigroviridis full-length cDNA
          Length = 490

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



to top

>emb|CR639593.2|CNS0ESHB Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR639409.2|CNS0ESC7 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR635358.2|CNS0EP7O Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|CR635001.2|CNS0EOXR Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| ||||| || |||||||| | ||| |||||||||||||| ||||||||||
Sbjct: 382 ccctgtggctttccaaaagcaccacgcattccagtctggagcctgtcagccccag 328



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ccagggaacttgaacttggc 371
           ||||||||||||||||||||
Sbjct: 493 ccagggaacttgaacttggc 474



to top

>emb|BX538352.1| Cryptosporidium parvum chromosome 6, complete sequence; segment 3/4
          Length = 293050

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                             
Query: 479    aagcacccctcataccagtctggagcctatc 509
              ||||||| |||||||||||||||||||||||
Sbjct: 240148 aagcacctctcataccagtctggagcctatc 240118



to top

>ref|XM_627752.1| Cryptosporidium parvum Iowa II 60S ribosomal protein L10
           (cgd6_4190), partial mRNA
          Length = 669

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 479 aagcacccctcataccagtctggagcctatc 509
           ||||||| |||||||||||||||||||||||
Sbjct: 355 aagcacctctcataccagtctggagcctatc 325



to top

>gb|AY909399.1| Siniperca chuatsi clone C410 ribosomal protein L10 mRNA, partial
           cds
          Length = 194

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 475 ccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||||||||| | ||| |||||||||||||||||||| ||||
Sbjct: 136 ccgaaagcaccacgcattccagtctggagcctatcagctccag 94



to top

>ref|XM_212832.3| PREDICTED: Rattus norvegicus ribosomal protein L10 (Rpl10), mRNA
          Length = 761

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagccccag 517
           ||||| |||||||| || ||||| | |||||| ||||||||||| ||||||||||
Sbjct: 428 ccctggggcttcccaaaggcaccacgcatacctgtctggagcctgtcagccccag 374



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 339 gatcttttggcgaccagggaacttgaacttggc 371
           |||||| ||||| ||||||||||||||||||||
Sbjct: 552 gatcttctggcggccagggaacttgaacttggc 520



to top

>dbj|AK119983.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-184-F09, full
           insert sequence
          Length = 928

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 337 atgatcttttggcgaccagggaacttgaacttggcacgacgaagagcctca 387
           ||||||||||||||||| ||||||||| ||| ||  ||||| |||||||||
Sbjct: 606 atgatcttttggcgaccggggaacttgtactgggagcgacggagagcctca 556



to top

>ref|XM_750162.1| Aspergillus fumigatus Af293 ribosomal protein L10.e (Afu2g09210)
           partial mRNA
          Length = 672

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 337 atgatcttttggcgaccagggaacttgaacttggcacgacgaagagcctc 386
           |||||||||||||| || ||||||||| || ||||||| || ||||||||
Sbjct: 497 atgatcttttggcggccggggaacttgtacatggcacggcgcagagcctc 448



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggag 503
           ||||| ||||| ||||| ||||| | |||||||||||||||
Sbjct: 371 ccctggggcttaccgaaggcaccacgcataccagtctggag 331



to top

>emb|CR938584.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YF24AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 547

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 357 gaacttgaacttggcacgacgaagagcctc 386
           ||||||||||||||||||||| ||||||||
Sbjct: 547 gaacttgaacttggcacgacgcagagcctc 518



to top

>gb|AF401563.1| Ictalurus punctatus ribosomal protein L10 mRNA, complete cds
          Length = 738

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 463 ccctgcggcttcccgaaagcacccctcataccagtctggagcctatcagc 512
           ||||| ||||| || |||||||| | ||| ||||||||||||||||||||
Sbjct: 380 ccctgtggctttccaaaagcaccacgcattccagtctggagcctatcagc 331


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,495,056
Number of Sequences: 3902068
Number of extensions: 4495056
Number of successful extensions: 81374
Number of sequences better than 10.0: 721
Number of HSP's better than 10.0 without gapping: 720
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 79705
Number of HSP's gapped (non-prelim): 1656
length of query: 517
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 494
effective length of database: 17,143,297,704
effective search space: 8468789065776
effective search space used: 8468789065776
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top