Clone Name | rbart36h02 |
---|---|
Clone Library Name | barley_pub |
No. | Definition | Score (bits) |
E Value |
1 | gb|AY857763.1| Triticum monococcum peroxidase 9 (POX9) mRNA, par... | 100 | 4e-18 | 2 | gb|AC132614.3| Mus musculus BAC clone RP23-298K1 from 6, complet... | 42 | 0.77 | 3 | gb|AC125410.4| Mus musculus BAC clone RP23-146N3 from 3, complet... | 40 | 3.0 |
---|
>gb|AY857763.1| Triticum monococcum peroxidase 9 (POX9) mRNA, partial cds Length = 760 Score = 99.6 bits (50), Expect = 4e-18 Identities = 68/74 (91%) Strand = Plus / Minus Query: 164 ctcacacgctttagcaatcacggcaactaaacaatttcttacatggcggaggcatggccc 223 ||||||||||| ||||| |||||| ||||| |||| ||||||||||||| |||||||||| Sbjct: 655 ctcacacgcttcagcaagcacggcgactaaccaatctcttacatggcggcggcatggccc 596 Query: 224 tcgtcgctggcggt 237 |||||||||||||| Sbjct: 595 tcgtcgctggcggt 582 Score = 52.0 bits (26), Expect = 8e-04 Identities = 53/62 (85%) Strand = Plus / Minus Query: 88 actcattttattacaacatcacaattataaagaaccactagtaccatgacatgatcatag 147 ||||| |||||||||||||||| |||| | ||||||||| ||||||||| |||| ||| Sbjct: 726 actcactttattacaacatcacgattacgcaaaaccactagcaccatgacacgatcgtag 667 Query: 148 cg 149 || Sbjct: 666 cg 665
>gb|AC132614.3| Mus musculus BAC clone RP23-298K1 from 6, complete sequence Length = 198160 Score = 42.1 bits (21), Expect = 0.77 Identities = 21/21 (100%) Strand = Plus / Plus Query: 41 ggtaggaagcatatatatata 61 ||||||||||||||||||||| Sbjct: 181185 ggtaggaagcatatatatata 181205
>gb|AC125410.4| Mus musculus BAC clone RP23-146N3 from 3, complete sequence Length = 213701 Score = 40.1 bits (20), Expect = 3.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atgggaacaacctcataggg 42 |||||||||||||||||||| Sbjct: 96183 atgggaacaacctcataggg 96202 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 11,151,680 Number of Sequences: 3902068 Number of extensions: 11151680 Number of successful extensions: 54034 Number of sequences better than 10.0: 3 Number of HSP's better than 10.0 without gapping: 3 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 54028 Number of HSP's gapped (non-prelim): 6 length of query: 237 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 215 effective length of database: 17,147,199,772 effective search space: 3686647950980 effective search space used: 3686647950980 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)