ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart36h01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|DQ223971.1| Triticum aestivum flavonoid O-methyltransferase m... 307 2e-80
2gb|AY226581.1| Triticum aestivum caffeic acid O-methyltransferas... 276 6e-71
3gb|BT009383.1| Triticum aestivum clone wlm96.pk033.c5:fis, full ... 260 4e-66
4gb|AF153824.1|AF153824 Festuca arundinacea comt1b caffeic acid O... 212 8e-52
5gb|AF153826.1|AF153826 Festuca arundinacea comt3 caffeic acid O-... 196 5e-47
6gb|AF153825.1|AF153825 Festuca arundinacea comt1c caffeic acid O... 196 5e-47
7gb|AF153823.1|AF153823 Festuca arundinacea comt1a caffeic acid O... 188 1e-44
8gb|AF033538.1|AF033538 Lolium perenne caffeic acid O-methyltrans... 180 3e-42
9gb|AF010291.1|AF010291 Lolium perenne bispecific caffeic acid/5-... 172 7e-40
10gb|AF033540.1|AF033540 Lolium perenne caffeic acid O-methyltrans... 168 1e-38
11emb|AJ231133.1|SOF231133 Saccharum officinarum mRNA for caffeic ... 131 2e-27
12gb|AY365419.1| Saccharum hybrid cultivar caffeic acid 3-O-methyl... 131 2e-27
13emb|AJ586105.1| Lolium multiflorum partial mRNA for putative caf... 123 6e-25
14gb|AF502287.1| Triticum aestivum caffeic acid O-methyltransferas... 115 1e-22
15gb|AY323304.1| Zea mays inbred line Mo17 O-methyltransferase (co... 115 1e-22
16gb|AY323302.1| Zea mays inbred line Lan496 O-methyltransferase (... 115 1e-22
17gb|AY323287.1| Zea mays inbred line F564 O-methyltransferase (co... 115 1e-22
18gb|AY323284.1| Zea mays inbred line 16 O-methyltransferase (comt... 115 1e-22
19gb|AY323272.1| Zea mays inbred line MBS847 O-methyltransferase (... 115 1e-22
20emb|AJ586106.1| Festuca arundinacea partial mRNA for putative ca... 113 5e-22
21gb|AY323274.1| Zea mays inbred line F7025 O-methyltransferase (c... 109 9e-21
22gb|AY323295.1| Zea mays inbred line B73 O-methyltransferase (com... 107 3e-20
23gb|AY323282.1| Zea mays inbred line Wis93-3520 O-methyltransfera... 107 3e-20
24gb|AY323281.1| Zea mays inbred line Wis94-443 O-methyltransferas... 107 3e-20
25gb|AY323273.1| Zea mays inbred line Du101 O-methyltransferase (c... 107 3e-20
26gb|M73235.1|MZEOMTH Zea mays O-methyltransferase (OMT) gene, com... 107 3e-20
27gb|AY323289.1| Zea mays inbred line F271 O-methyltransferase (co... 101 2e-18
28gb|AY323276.1| Zea mays inbred line Quebec28 O-methyltransferase... 100 8e-18
29gb|AY323275.1| Zea mays inbred line F66 O-methyltransferase (com... 100 8e-18
30gb|AY323297.1| Zea mays inbred line F288 O-methyltransferase (co... 98 3e-17
31gb|AY323288.1| Zea mays inbred line F286 O-methyltransferase (co... 98 3e-17
32gb|AY323290.1| Zea mays inbred line F113 O-methyltransferase (co... 96 1e-16
33gb|AY323305.1| Zea mays inbred line EP1 O-methyltransferase (com... 94 5e-16
34gb|AY323303.1| Zea mays inbred line W117 O-methyltransferase (co... 94 5e-16
35gb|AY323300.1| Zea mays inbred line F7012 O-methyltransferase (c... 94 5e-16
36gb|AY323298.1| Zea mays inbred line F324 O-methyltransferase (co... 94 5e-16
37gb|AY323286.1| Zea mays inbred line F64 O-methyltransferase (com... 94 5e-16
38gb|AY323283.1| Zea mays inbred line W64A O-methyltransferase (co... 94 5e-16
39gb|AY323299.1| Zea mays inbred line F4 O-methyltransferase (comt... 90 8e-15
40gb|AY323293.1| Zea mays Rottaler Silomais O-methyltransferase (c... 90 8e-15
41gb|AY323278.1| Zea mays Sibiriaka O-methyltransferase (comt) gen... 90 8e-15
42gb|AY323296.1| Zea mays inbred line F2 O-methyltransferase (comt... 88 3e-14
43gb|AY323301.1| Zea mays inbred line 212 O-methyltransferase (com... 86 1e-13
44gb|AY323291.1| Zea mays inbred line F1 O-methyltransferase (comt... 86 1e-13
45gb|AY323285.1| Zea mays inbred line F7 O-methyltransferase (comt... 86 1e-13
46ref|XM_480185.1| Oryza sativa (japonica cultivar-group), mRNA 84 5e-13
47dbj|AK061859.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 5e-13
48dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 84 5e-13
49gb|DQ288259.1| Oryza sativa (japonica cultivar-group) O-methyltr... 84 5e-13
50dbj|AB122056.1| Oryza sativa (japonica cultivar-group) COMT mRNA... 84 5e-13
51dbj|AP004460.2| Oryza sativa (japonica cultivar-group) genomic D... 84 5e-13
52dbj|AK064768.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 5e-13
53gb|AY323279.1| Zea mays Rainbow Flint O-methyltransferase (comt)... 82 2e-12
54gb|AY323277.1| Zea mays Polar Dent O-methyltransferase (comt) ge... 82 2e-12
55gb|AY323294.1| Zea mays inbred line B14 O-methyltransferase (com... 78 3e-11
56gb|AY323292.1| Zea mays inbred line DE811 O-methyltransferase (c... 78 3e-11
57gb|AY323280.1| Zea mays Noordlander O-methyltransferase (comt) g... 78 3e-11
58gb|AY217766.1| Sorghum bicolor caffeic acid O-methyltransferase ... 68 3e-08
59gb|AF387790.1|AF387790 Sorghum bicolor O-methyltransferase mRNA,... 68 3e-08
60gb|AY098514.1| Ananas comosus caffeic acid O-methyltransferase m... 48 0.027
61gb|BT009359.1| Triticum aestivum clone wlm96.pk025.c3:fis, full ... 46 0.11
62emb|AL138831.12| Human DNA sequence from clone RP3-406P24 on chr... 44 0.42
63emb|AJ632203.2| Streptomyces antibioticus oviedomycin biosynthet... 44 0.42
64dbj|AP006107.1| Lotus japonicus genomic DNA, chromosome 1, clone... 44 0.42
65gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, compl... 42 1.7
66gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 42 1.7
67gb|AC011900.6| Homo sapiens BAC clone RP11-542L18 from 2, comple... 42 1.7
68gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome 42 1.7
69emb|AL806522.4| Mouse DNA sequence from clone RP23-167H2 on chro... 42 1.7
70gb|AY506529.1| Zea mays strain NB mitochondrion, complete genome 40 6.6
71gb|DQ490952.1| Zea mays subsp. mays genotype male-fertile NA mit... 40 6.6
72gb|DQ490951.1| Zea mays subsp. mays genotype CMS-S mitochondrion... 40 6.6
73gb|AC164098.4| Mus musculus BAC clone RP23-341D24 from chromosom... 40 6.6
74gb|AY794816.1| Galearia filiformis tRNA-Leu (trnL) gene and trnL... 40 6.6
75gb|AY794673.1| Omphalea palmata tRNA-Leu (trnL) gene and trnL-tr... 40 6.6
76gb|AY794672.1| Omphalea diandra tRNA-Leu (trnL) gene and trnL-tr... 40 6.6
77gb|DQ001169.1| Acacia mangium x Acacia auriculiformis caffeic ac... 40 6.6
78gb|DQ490953.1| Zea mays subsp. mays genotype CMS-T mitochondrion... 40 6.6
79gb|CP000352.1| Ralstonia metallidurans CH34, complete genome 40 6.6
80gb|AC138448.9| Medicago truncatula clone mth2-11n13, complete se... 40 6.6
81emb|Z83001.1|HSG0453 Human DNA sequence from clone XX-G0453 on c... 40 6.6
82emb|AL136373.21| Human DNA sequence from clone RP11-49P4 on chro... 40 6.6
83emb|AL049745.9|HSJ654H19 Human DNA sequence from clone RP4-654H1... 40 6.6
84gb|AC010282.6| Homo sapiens chromosome 5 clone CTC-555I19, compl... 40 6.6
85emb|Z00026.1|MIZMATP1 Maize mitochondrial gene for F1-ATPase alp... 40 6.6
86emb|CR925678.1| Ehrlichia ruminantium str. Welgevonden, complete... 40 6.6
87emb|CR925677.1| Ehrlichia ruminantium str. Gardel, complete genome 40 6.6
88emb|CR767821.1| Ehrlichia ruminantium strain Welgevonden, comple... 40 6.6
89emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS... 40 6.6
90emb|AJ278690.1|SBI278690 Sorghum bicolor partial mitochondrial m... 40 6.6
91emb|AJ278689.1|SBI278689 Sorghum bicolor partial mitochondrial m... 40 6.6
92emb|AL663035.8| Mouse DNA sequence from clone RP23-432G17 on chr... 40 6.6
93emb|CR387929.4| Zebrafish DNA sequence from clone DKEY-172H18 in... 40 6.6
94gb|AC011478.3| Homo sapiens chromosome 19 clone CTC-565M22, comp... 40 6.6
95gb|AE012241.1| Xanthomonas campestris pv. campestris str. ATCC 3... 40 6.6
96gb|AY094283.1| Zea mays cultivar F_7 caffeic acid 3-O-methyltran... 40 6.6
97gb|AY094282.1| Zea mays cultivar D_9 caffeic acid 3-O-methyltran... 40 6.6
98gb|AY094281.1| Zea mays cultivar D_6 caffeic acid 3-O-methyltran... 40 6.6
99gb|AY094280.1| Zea mays cultivar F_1 caffeic acid 3-O-methyltran... 40 6.6
100gb|AY094279.1| Zea mays cultivar Mo17 caffeic acid 3-O-methyltra... 40 6.6
101gb|AY094276.1| Zea mays cultivar 684 caffeic acid 3-O-methyltran... 40 6.6
102gb|AY094275.1| Zea mays cultivar I_1 caffeic acid 3-O-methyltran... 40 6.6
103gb|AY094274.1| Zea mays cultivar F_2 caffeic acid 3-O-methyltran... 40 6.6
104gb|AY094273.1| Zea mays cultivar G_1 caffeic acid 3-O-methyltran... 40 6.6
105gb|AY094271.1| Zea mays cultivar F_3 caffeic acid 3-O-methyltran... 40 6.6
106gb|AY094270.1| Zea mays cultivar F_5 caffeic acid 3-O-methyltran... 40 6.6
107gb|AY094269.1| Zea mays cultivar H_5 caffeic acid 3-O-methyltran... 40 6.6
108gb|AY094268.1| Zea mays cultivar H_3 caffeic acid 3-O-methyltran... 40 6.6
109gb|AY094267.1| Zea mays cultivar J40 caffeic acid 3-O-methyltran... 40 6.6
110gb|AY094266.1| Zea mays cultivar 647 caffeic acid 3-O-methyltran... 40 6.6
111gb|AY094265.1| Zea mays cultivar B_1 caffeic acid 3-O-methyltran... 40 6.6
112gb|AY094264.1| Zea mays cultivar F_6 caffeic acid 3-O-methyltran... 40 6.6
113gb|AY094263.1| Zea mays cultivar C_5 caffeic acid 3-O-methyltran... 40 6.6
114gb|AY094262.1| Zea mays cultivar H_1 caffeic acid 3-O-methyltran... 40 6.6
115emb|BX511101.3| Zebrafish DNA sequence from clone DKEYP-92F1 in ... 40 6.6
116gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 6.6
117gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 40 6.6
118ref|XM_395084.2| PREDICTED: Apis mellifera similar to CG5811-PA ... 40 6.6
119gb|AE004912.1| Pseudomonas aeruginosa PAO1, section 473 of 529 o... 40 6.6
120gb|AY124521.1| Luzula acuminata ATPase F1 alpha subunit (atp1) g... 40 6.6
121gb|AF130358.2|AF130358 Homo sapiens chromosome 21q11.2 PAC 90B5,... 40 6.6
122emb|AL929026.10| Mouse DNA sequence from clone RP23-332K7 on chr... 40 6.6
123emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 40 6.6
124gb|AC140483.3| Mus musculus BAC clone RP24-145A22 from 1, comple... 40 6.6
125gb|AF154918.1|AF154918 Ocimum basilicum caffeic acid O-methyltra... 40 6.6
126gb|AC006556.3|AC006556 Homo sapiens, clone hRPK.37_A_1, complete... 40 6.6
127emb|AL132709.5|CNS01DTB Human chromosome 14 DNA sequence BAC R-9... 40 6.6
128dbj|AP001660.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 6.6
129dbj|AP006736.1| Lotus japonicus genomic DNA, chromosome 1, clone... 40 6.6
130dbj|AP006694.1| Lotus japonicus genomic DNA, chromosome 2, clone... 40 6.6
131dbj|AP006667.1| Lotus japonicus genomic DNA, chromosome 5, clone... 40 6.6
132dbj|AP006652.1| Lotus japonicus genomic DNA, chromosome 6, clone... 40 6.6
133dbj|AP006634.1| Lotus japonicus genomic DNA, chromosome 5, clone... 40 6.6
134dbj|AP006366.1| Lotus japonicus genomic DNA, chromosome 3, clone... 40 6.6
135dbj|AP006093.1| Lotus japonicus genomic DNA, chromosome 1, clone... 40 6.6
136dbj|AP004976.1| Lotus japonicus genomic DNA, chromosome 3, clone... 40 6.6
137dbj|AP004965.1| Lotus japonicus genomic DNA, chromosome 1, clone... 40 6.6
138dbj|AP004533.1| Lotus japonicus genomic DNA, chromosome 3, clone... 40 6.6
139dbj|AP004516.1| Lotus japonicus genomic DNA, chromosome 4, clone... 40 6.6
140dbj|AP004509.1| Lotus japonicus genomic DNA, chromosome 6, clone... 40 6.6
141dbj|AP004487.1| Lotus japonicus genomic DNA, chromosome 5, clone... 40 6.6
142dbj|AP004470.1| Lotus japonicus genomic DNA, chromosome 4, clone... 40 6.6
143dbj|AP004467.1| Lotus japonicus genomic DNA, chromosome 1, clone... 40 6.6
144gb|M16222.1|MZEMTATP Maize mitochondrial ATP-alpha gene encoding... 40 6.6
145emb|AL078615.2|HS98L15 Homo sapiens chromosome 21 PAC RPCIP704L1... 40 6.6

>gb|DQ223971.1| Triticum aestivum flavonoid O-methyltransferase mRNA, complete cds
          Length = 1233

 Score =  307 bits (155), Expect = 2e-80
 Identities = 224/247 (90%)
 Strand = Plus / Minus

                                                                        
Query: 240  catctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatgga 299
            |||||||||||| |||||||| ||||||||||| |||||||||||||| | ||| |||| 
Sbjct: 1148 catctacttagtgaactcgatggcccatgcgttggcgtagatgtaagtagtcttcatggc 1089

                                                                        
Query: 300  ggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacc 359
            |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||
Sbjct: 1088 ggcgaacccggcgcccttggccagggcctcgaactccctctcgtacctctccctgccacc 1029

                                                                        
Query: 360  tgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagc 419
             |||||||||||||||||||||||||| |  | |||||| ||||| |||||||| || ||
Sbjct: 1028 cgggttgtgcgcgagcatgatcatgtcgacatggaacaccccctgcgccttaggcgtcgc 969

                                                                        
Query: 420  ttccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgc 479
             ||||| || || ||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 968  ctccgggttcacaggcaggatgcactccacgagcaccaccttgccgtgcgccggcaacgc 909

                   
Query: 480  gtcgtag 486
            |||||||
Sbjct: 908  gtcgtag 902



to top

>gb|AY226581.1| Triticum aestivum caffeic acid O-methyltransferase (COMT1) mRNA,
            complete cds
          Length = 1371

 Score =  276 bits (139), Expect = 6e-71
 Identities = 223/251 (88%)
 Strand = Plus / Minus

                                                                        
Query: 236  catgcatctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttga 295
            |||| |||||||| || |||||||| ||  ||||||| |||||||||||||||| |||||
Sbjct: 1163 catggatctacttggtgaactcgatggcaaatgcgttggcgtagatgtaagtggtcttga 1104

                                                                        
Query: 296  tggaggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctac 355
            |||    ||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
Sbjct: 1103 tggctttgaagccggcgcccttggccagggcctcgaactccctctcgtacctctccctgc 1044

                                                                        
Query: 356  cacctgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttagggg 415
            | || |||||||||||||||||||||||||| | || |||||| ||||| ||||| || |
Sbjct: 1043 cgccggggttgtgcgcgagcatgatcatgtcgacgtggaacaccccctgcgccttgggcg 984

                                                                        
Query: 416  tagcttccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggca 475
            | || ||||| || ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 983  tggcctccgggttcaccggcaggatgcactccacgagcaccaccttgccgtgcgccggca 924

                       
Query: 476  gcgcgtcgtag 486
            |||||||||||
Sbjct: 923  gcgcgtcgtag 913



to top

>gb|BT009383.1| Triticum aestivum clone wlm96.pk033.c5:fis, full insert mRNA sequence
          Length = 1314

 Score =  260 bits (131), Expect = 4e-66
 Identities = 221/251 (88%)
 Strand = Plus / Minus

                                                                        
Query: 236  catgcatctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttga 295
            |||| |||||||| || |||||||| ||  ||||||| ||||||||||| |||| |||||
Sbjct: 1083 catggatctacttggtgaactcgatggcaaatgcgttggcgtagatgtaggtggtcttga 1024

                                                                        
Query: 296  tggaggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctac 355
            |||    ||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
Sbjct: 1023 tggctttgaagccggcgcccttggccagggcctcgaactccctctcgtacctctccctgc 964

                                                                        
Query: 356  cacctgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttagggg 415
            | || |||||||||||||||||||||||||| | || ||| || ||||| ||||| || |
Sbjct: 963  cgccggggttgtgcgcgagcatgatcatgtcgacgtggaataccccctgcgccttgggcg 904

                                                                        
Query: 416  tagcttccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggca 475
            | || ||||| || ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 903  tggcctccgggttcaccggcaggatgcactccacgagcaccaccttgccgtgcgccggca 844

                       
Query: 476  gcgcgtcgtag 486
            |||||||||||
Sbjct: 843  gcgcgtcgtag 833



to top

>gb|AF153824.1|AF153824 Festuca arundinacea comt1b caffeic acid O-methyltransferase mRNA,
            complete cds
          Length = 1440

 Score =  212 bits (107), Expect = 8e-52
 Identities = 212/247 (85%)
 Strand = Plus / Minus

                                                                        
Query: 240  catctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatgga 299
            ||||||||| || |||||||| ||||| ||||| ||||||||||| |||| ||||| |  
Sbjct: 1156 catctacttggtgaactcgatggcccacgcgtttgcgtagatgtacgtggacttgacgcc 1097

                                                                        
Query: 300  ggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacc 359
            || |||||| || ||| ||||||||||||||||||||||||| ||||||||||| || ||
Sbjct: 1096 ggtgaacccagctcccctggccagggcctcgaactccctctcgtacctctccctgccgcc 1037

                                                                        
Query: 360  tgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagc 419
             |||||||||||||||||||||||||| | || ||| || ||||| |   | ||  | ||
Sbjct: 1036 ggggttgtgcgcgagcatgatcatgtcgacgtggaagaccccctgcgagctgggcttggc 977

                                                                        
Query: 420  ttccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgc 479
             ||||| |||||||||||||||||||| |||||||| |||||||||||||||||||||||
Sbjct: 976  ctccgggttgaccggcaggatgcactcgacgagcacgaccttgccgtgcgccggcagcgc 917

                   
Query: 480  gtcgtag 486
            |||||||
Sbjct: 916  gtcgtag 910



to top

>gb|AF153826.1|AF153826 Festuca arundinacea comt3 caffeic acid O-methyltransferase mRNA,
            complete cds
          Length = 1430

 Score =  196 bits (99), Expect = 5e-47
 Identities = 210/247 (85%)
 Strand = Plus / Minus

                                                                        
Query: 240  catctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatgga 299
            ||||||||| || |||||||| ||||| ||||| ||||||||||| |||| ||||| |  
Sbjct: 1163 catctacttggtgaactcgatggcccaggcgttggcgtagatgtatgtggacttgaagcc 1104

                                                                        
Query: 300  ggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacc 359
            |||||| || || |||||||| || ||||||||||||||||| ||||||||||| |||||
Sbjct: 1103 ggcgaagccagctcccttggcgagcgcctcgaactccctctcgtacctctccctgccacc 1044

                                                                        
Query: 360  tgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagc 419
             |||||||||||||||||||||||||| | || |||||| ||||| |   | ||  | ||
Sbjct: 1043 ggggttgtgcgcgagcatgatcatgtcgacgtggaacaccccctgcgagctgggcttggc 984

                                                                        
Query: 420  ttccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgc 479
             ||||| |  |||||||||||||||||||| || ||||||||||||||||| ||||||||
Sbjct: 983  ctccgggtgcaccggcaggatgcactccaccagtaccaccttgccgtgcgctggcagcgc 924

                   
Query: 480  gtcgtag 486
            |||||||
Sbjct: 923  gtcgtag 917



to top

>gb|AF153825.1|AF153825 Festuca arundinacea comt1c caffeic acid O-methyltransferase mRNA,
            complete cds
          Length = 1438

 Score =  196 bits (99), Expect = 5e-47
 Identities = 210/247 (85%)
 Strand = Plus / Minus

                                                                        
Query: 240  catctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatgga 299
            ||||||||| || |||||||| ||||| ||||| ||||||||||| |||| ||||| |  
Sbjct: 1147 catctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacgcc 1088

                                                                        
Query: 300  ggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacc 359
            || ||| ||||| ||| |||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 1087 ggtgaagccggctcccctggcgagcgcctcgaactccctttcgtacctctccctgccgcc 1028

                                                                        
Query: 360  tgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagc 419
             |||||||||||||||||||||||||| | || |||||| ||||| |   | ||  | ||
Sbjct: 1027 ggggttgtgcgcgagcatgatcatgtcgacgtggaacaccccctgcgagctgggcttggc 968

                                                                        
Query: 420  ttccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgc 479
             ||||| || ||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 967  ctccgggttcaccggcaggatgcactcgacgagcaccaccttgccgtgcgccggcagcgc 908

                   
Query: 480  gtcgtag 486
            |||||||
Sbjct: 907  gtcgtag 901



to top

>gb|AF153823.1|AF153823 Festuca arundinacea comt1a caffeic acid O-methyltransferase mRNA,
            complete cds
          Length = 1446

 Score =  188 bits (95), Expect = 1e-44
 Identities = 209/247 (84%)
 Strand = Plus / Minus

                                                                        
Query: 240  catctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatgga 299
            ||||||||| || |||||||| ||||| ||||| ||||||||||| |||| ||||| |  
Sbjct: 1130 catctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacgcc 1071

                                                                        
Query: 300  ggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacc 359
            || ||| ||||| ||| |||| || |||| |||||||||||| ||||||||||| || ||
Sbjct: 1070 ggtgaatccggctcccctggcgagagcctggaactccctctcgtacctctccctgccgcc 1011

                                                                        
Query: 360  tgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagc 419
             |||||||||||||||||||||||||| | || ||| || ||||| |   | ||  | ||
Sbjct: 1010 ggggttgtgcgcgagcatgatcatgtcgacgtggaagaccccctgcgagctgggattggc 951

                                                                        
Query: 420  ttccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgc 479
             ||||| |||||||||||||||||||| |||||||| |||||||||||||||||||||||
Sbjct: 950  ctccgggttgaccggcaggatgcactcgacgagcacgaccttgccgtgcgccggcagcgc 891

                   
Query: 480  gtcgtag 486
            |||||||
Sbjct: 890  gtcgtag 884



to top

>gb|AF033538.1|AF033538 Lolium perenne caffeic acid O-methyltransferase (OMT1) mRNA, complete
            cds
          Length = 1455

 Score =  180 bits (91), Expect = 3e-42
 Identities = 208/247 (84%)
 Strand = Plus / Minus

                                                                        
Query: 240  catctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatgga 299
            ||||||||| || |||||||| ||||| ||||| ||||||||||| |||| ||||| |  
Sbjct: 1137 catctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacgcc 1078

                                                                        
Query: 300  ggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacc 359
            || ||| ||||| ||| |||| || |||| |||||||||||| ||||||||||| || ||
Sbjct: 1077 ggtgaatccggctcccctggcgagagcctggaactccctctcgtacctctccctgccgcc 1018

                                                                        
Query: 360  tgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagc 419
             |||||||||||||||||||||||||| | || ||| || ||||| |   | ||  | ||
Sbjct: 1017 ggggttgtgcgcgagcatgatcatgtcgacgtggaagaccccctgcgagctgggattggc 958

                                                                        
Query: 420  ttccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgc 479
             ||||| |||||||||||||||||||  |||||||| |||||||||||||||||||||||
Sbjct: 957  ctccgggttgaccggcaggatgcactggacgagcacgaccttgccgtgcgccggcagcgc 898

                   
Query: 480  gtcgtag 486
            |||||||
Sbjct: 897  gtcgtag 891



to top

>gb|AF010291.1|AF010291 Lolium perenne bispecific caffeic acid/5-hydroxyferulic acid
            O-methyltransferase mRNA, complete cds
          Length = 1475

 Score =  172 bits (87), Expect = 7e-40
 Identities = 207/247 (83%)
 Strand = Plus / Minus

                                                                        
Query: 240  catctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatgga 299
            ||||||||| || |||||||| ||||| ||||| ||||||||||| |||| |||||    
Sbjct: 1156 catctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacacc 1097

                                                                        
Query: 300  ggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacc 359
            || ||| ||||| ||| |||| || |||| |||||||||||| ||||||||||| || ||
Sbjct: 1096 ggtgaatccggctcccctggcgagagcctggaactccctctcgtacctctccctgccccc 1037

                                                                        
Query: 360  tgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagc 419
             |||||||||||||||||||||||||| | || ||| || ||||| |   | ||  | ||
Sbjct: 1036 ggggttgtgcgcgagcatgatcatgtcgacgtggaagaccccctgcgagctgggattggc 977

                                                                        
Query: 420  ttccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgc 479
             ||||| |||||||||||||||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 976  ctccgggttgaccggcaggatgcactcgacgagcacgaccttgccgttcgccggcagcgc 917

                   
Query: 480  gtcgtag 486
            |||||||
Sbjct: 916  gtcgtag 910



to top

>gb|AF033540.1|AF033540 Lolium perenne caffeic acid O-methyltransferase (OMT3) mRNA, complete
            cds
          Length = 1436

 Score =  168 bits (85), Expect = 1e-38
 Identities = 205/245 (83%)
 Strand = Plus / Minus

                                                                        
Query: 242  tctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggagg 301
            ||||||| || |||||||| ||||| ||||| ||||||||||| |||| ||||| |  ||
Sbjct: 1172 tctacttggtgaactcgatggcccaggcgttggcgtagatgtatgtggacttgaagccgg 1113

                                                                        
Query: 302  cgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctg 361
            |||| || || ||| |||| || |||||| |||||||||| ||||||||||| || ||||
Sbjct: 1112 cgaagccagctcccctggcgagcgcctcgtactccctctcgtacctctccctgccgcctg 1053

                                                                        
Query: 362  ggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagctt 421
            ||||||||||||||||||||||||| | || |||||| ||||| |   | ||  | || |
Sbjct: 1052 ggttgtgcgcgagcatgatcatgtcgacgtggaacaccccctgcgagctgggcttggcct 993

                                                                        
Query: 422  ccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgt 481
            |||| || |||||||||||||||||||| ||||||||||| ||||||   ||||||||||
Sbjct: 992  ccgggttcaccggcaggatgcactccaccagcaccaccttaccgtgcattggcagcgcgt 933

                 
Query: 482  cgtag 486
            |||||
Sbjct: 932  cgtag 928



to top

>emb|AJ231133.1|SOF231133 Saccharum officinarum mRNA for caffeic acid 3-O-methyltransferase
          Length = 1486

 Score =  131 bits (66), Expect = 2e-27
 Identities = 192/234 (82%)
 Strand = Plus / Minus

                                                                        
Query: 253  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 312
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||||||||||
Sbjct: 1183 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaacccggcg 1124

                                                                        
Query: 313  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 372
            |||||||| ||| | | |||||||| ||| |||| |||||| || || ||||| ||||||
Sbjct: 1123 cccttggcgaggtcgtggaactcccgctcgtaccgctccctgccgccggggttatgcgcg 1064

                                                                        
Query: 373  agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 432
            |||||||||||||| | || |||||| ||||| ||||| |||   || || |  || |||
Sbjct: 1063 agcatgatcatgtcgacgtggaacacgccctgcgccttcgggacggcctcggtgttcacc 1004

                                                                  
Query: 433  ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||| | |||||| ||||  | ||||||||||| | |||||||||||||||||
Sbjct: 1003 ggcagcacgcactcgacgatgatcaccttgccgttctccggcagcgcgtcgtag 950



to top

>gb|AY365419.1| Saccharum hybrid cultivar caffeic acid 3-O-methyltransferase (COMT)
            gene, complete cds
          Length = 2012

 Score =  131 bits (66), Expect = 2e-27
 Identities = 192/234 (82%)
 Strand = Plus / Minus

                                                                        
Query: 253  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 312
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||||||||||
Sbjct: 2002 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaacccggcg 1943

                                                                        
Query: 313  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 372
            |||||||| ||| | | |||||||| ||| |||| |||||| || || ||||| ||||||
Sbjct: 1942 cccttggcgaggtcgtggaactcccgctcgtaccgctccctgccgccggggttatgcgcg 1883

                                                                        
Query: 373  agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 432
            |||||||||||||| | || |||||| ||||| ||||| |||   || || |  || |||
Sbjct: 1882 agcatgatcatgtcgacgtggaacacgccctgcgccttcgggacggcctcggtgttcacc 1823

                                                                  
Query: 433  ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||| | |||||| ||||  | ||||||||||| | |||||||||||||||||
Sbjct: 1822 ggcagcacgcactcgacgacgatcaccttgccgttctccggcagcgcgtcgtag 1769



to top

>emb|AJ586105.1| Lolium multiflorum partial mRNA for putative caffeate
           o-methyltransferase (comt gene)
          Length = 878

 Score =  123 bits (62), Expect = 6e-25
 Identities = 110/126 (87%)
 Strand = Plus / Minus

                                                                       
Query: 361 gggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagct 420
           |||||||||||||||||||||||||| | || |||||| ||||| |   | ||  | || 
Sbjct: 859 gggttgtgcgcgagcatgatcatgtcgacgtggaacaccccctgcgagctgggcttggcc 800

                                                                       
Query: 421 tccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcg 480
           ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 799 tccgggttcaccggcaggatgcactcgacgagcaccaccttgccgtgcgccggcagcgcg 740

                 
Query: 481 tcgtag 486
           ||||||
Sbjct: 739 tcgtag 734



to top

>gb|AF502287.1| Triticum aestivum caffeic acid O-methyltransferase mRNA, partial
           cds
          Length = 604

 Score =  115 bits (58), Expect = 1e-22
 Identities = 109/126 (86%)
 Strand = Plus / Minus

                                                                       
Query: 361 gggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagct 420
           |||||||| || ||||||||||| || || | |||| | || ||||||||||| || |||
Sbjct: 590 gggttgtgtgctagcatgatcatatcgagatggaaccccccttgtgccttaggcgtggct 531

                                                                       
Query: 421 tccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcg 480
           ||||| || ||||||| |||||||||||||||||  ||||||||||||| ||||||||||
Sbjct: 530 tccgggttcaccggcaagatgcactccacgagcattaccttgccgtgcgtcggcagcgcg 471

                 
Query: 481 tcgtag 486
           ||||||
Sbjct: 470 tcgtag 465



to top

>gb|AY323304.1| Zea mays inbred line Mo17 O-methyltransferase (comt) gene, complete
            cds
          Length = 2955

 Score =  115 bits (58), Expect = 1e-22
 Identities = 190/234 (81%)
 Strand = Plus / Minus

                                                                        
Query: 253  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 312
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 2609 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 2550

                                                                        
Query: 313  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 372
            |||||||| ||  |   |||||| | ||| |||| |||| | || |||||||||||||||
Sbjct: 2549 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcg 2490

                                                                        
Query: 373  agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 432
            |||||||||||||| | || |||||| ||||| ||||| ||||| || ||||  ||||||
Sbjct: 2489 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 2430

                                                                  
Query: 433  ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||| | |||||| ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2429 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2376



to top

>gb|AY323302.1| Zea mays inbred line Lan496 O-methyltransferase (comt) gene, complete
            cds
          Length = 3282

 Score =  115 bits (58), Expect = 1e-22
 Identities = 190/234 (81%)
 Strand = Plus / Minus

                                                                        
Query: 253  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 312
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 2936 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 2877

                                                                        
Query: 313  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 372
            |||||||| ||  |   |||||| | ||| |||| |||| | || |||||||||||||||
Sbjct: 2876 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcg 2817

                                                                        
Query: 373  agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 432
            |||||||||||||| | || |||||| ||||| ||||| ||||| || ||||  ||||||
Sbjct: 2816 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 2757

                                                                  
Query: 433  ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||| | |||||| ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2756 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2703



to top

>gb|AY323287.1| Zea mays inbred line F564 O-methyltransferase (comt) gene, complete
            cds
          Length = 2982

 Score =  115 bits (58), Expect = 1e-22
 Identities = 190/234 (81%)
 Strand = Plus / Minus

                                                                        
Query: 253  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 312
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 2960 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 2901

                                                                        
Query: 313  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 372
            |||||||| ||  |   |||||| | ||| |||| |||| | || |||||||||||||||
Sbjct: 2900 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcg 2841

                                                                        
Query: 373  agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 432
            |||||||||||||| | || |||||| ||||| ||||| ||||| || ||||  ||||||
Sbjct: 2840 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 2781

                                                                  
Query: 433  ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||| | |||||| ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2780 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2727



to top

>gb|AY323284.1| Zea mays inbred line 16 O-methyltransferase (comt) gene, complete cds
          Length = 3190

 Score =  115 bits (58), Expect = 1e-22
 Identities = 190/234 (81%)
 Strand = Plus / Minus

                                                                        
Query: 253  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 312
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 3168 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 3109

                                                                        
Query: 313  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 372
            |||||||| ||  |   |||||| | ||| |||| |||| | || |||||||||||||||
Sbjct: 3108 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcg 3049

                                                                        
Query: 373  agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 432
            |||||||||||||| | || |||||| ||||| ||||| ||||| || ||||  ||||||
Sbjct: 3048 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 2989

                                                                  
Query: 433  ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||| | |||||| ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2988 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2935



to top

>gb|AY323272.1| Zea mays inbred line MBS847 O-methyltransferase (comt) gene, complete
            cds
          Length = 2326

 Score =  115 bits (58), Expect = 1e-22
 Identities = 190/234 (81%)
 Strand = Plus / Minus

                                                                        
Query: 253  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 312
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 1980 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 1921

                                                                        
Query: 313  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 372
            |||||||| ||  |   |||||| | ||| |||| |||| | || |||||||||||||||
Sbjct: 1920 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcg 1861

                                                                        
Query: 373  agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 432
            |||||||||||||| | || |||||| ||||| ||||| ||||| || ||||  ||||||
Sbjct: 1860 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 1801

                                                                  
Query: 433  ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||| | |||||| ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 1800 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 1747



to top

>emb|AJ586106.1| Festuca arundinacea partial mRNA for putative caffeate
           o-methyltransferase (comt gene)
          Length = 878

 Score =  113 bits (57), Expect = 5e-22
 Identities = 111/129 (86%)
 Strand = Plus / Minus

                                                                       
Query: 358 cctgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggta 417
           ||||||||||||||||||||||||||||| | || ||| || ||||| |   | ||  | 
Sbjct: 862 cctgggttgtgcgcgagcatgatcatgtcgacgtggaagaccccctgcgagctgggattg 803

                                                                       
Query: 418 gcttccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagc 477
           || ||||| |||||||||||||||||||  |||||||| |||||||||||||||||||||
Sbjct: 802 gcctccgggttgaccggcaggatgcacttgacgagcacgaccttgccgtgcgccggcagc 743

                    
Query: 478 gcgtcgtag 486
           |||||||||
Sbjct: 742 gcgtcgtag 734



to top

>gb|AY323274.1| Zea mays inbred line F7025 O-methyltransferase (comt) gene, complete
            cds
          Length = 2326

 Score =  109 bits (55), Expect = 9e-21
 Identities = 163/199 (81%)
 Strand = Plus / Minus

                                                                        
Query: 253  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 312
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 1980 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 1921

                                                                        
Query: 313  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 372
            |||||||| ||  |   |||||| | ||| |||| |||| | || |||||||||||||||
Sbjct: 1920 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcg 1861

                                                                        
Query: 373  agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 432
            |||||||||||||| | || |||||| ||||| ||||| ||||| || ||||  ||||||
Sbjct: 1860 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 1801

                               
Query: 433  ggcaggatgcactccacga 451
            ||||| | |||||| ||||
Sbjct: 1800 ggcagcacgcactcgacga 1782



to top

>gb|AY323295.1| Zea mays inbred line B73 O-methyltransferase (comt) gene, complete
            cds
          Length = 2676

 Score =  107 bits (54), Expect = 3e-20
 Identities = 189/234 (80%)
 Strand = Plus / Minus

                                                                        
Query: 253  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 312
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 2654 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 2595

                                                                        
Query: 313  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 372
            |||||||| ||  |   |||||| | ||| |||| |||| | || |||||||| ||||||
Sbjct: 2594 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttatgcgcg 2535

                                                                        
Query: 373  agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 432
            |||||||||||||| | || |||||| ||||| ||||| ||||| || ||||  ||||||
Sbjct: 2534 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 2475

                                                                  
Query: 433  ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||| | |||||| ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2474 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2421



to top

>gb|AY323282.1| Zea mays inbred line Wis93-3520 O-methyltransferase (comt) gene,
            complete cds
          Length = 3088

 Score =  107 bits (54), Expect = 3e-20
 Identities = 189/234 (80%)
 Strand = Plus / Minus

                                                                        
Query: 253  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 312
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 3066 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 3007

                                                                        
Query: 313  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 372
            |||||||| ||  |   |||||| | ||| |||| |||| | || |||||||| ||||||
Sbjct: 3006 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttatgcgcg 2947

                                                                        
Query: 373  agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 432
            |||||||||||||| | || |||||| ||||| ||||| ||||| || ||||  ||||||
Sbjct: 2946 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 2887

                                                                  
Query: 433  ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||| | |||||| ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2886 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2833



to top

>gb|AY323281.1| Zea mays inbred line Wis94-443 O-methyltransferase (comt) gene,
            complete cds
          Length = 3095

 Score =  107 bits (54), Expect = 3e-20
 Identities = 189/234 (80%)
 Strand = Plus / Minus

                                                                        
Query: 253  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 312
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 3073 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 3014

                                                                        
Query: 313  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 372
            |||||||| ||  |   |||||| | ||| |||| |||| | || || ||||||||||||
Sbjct: 3013 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcg 2954

                                                                        
Query: 373  agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 432
            |||||||||||||| | || |||||| ||||| ||||| ||||| || ||||  ||||||
Sbjct: 2953 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 2894

                                                                  
Query: 433  ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||| | |||||| ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2893 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2840



to top

>gb|AY323273.1| Zea mays inbred line Du101 O-methyltransferase (comt) gene, complete
            cds
          Length = 2074

 Score =  107 bits (54), Expect = 3e-20
 Identities = 189/234 (80%)
 Strand = Plus / Minus

                                                                        
Query: 253  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 312
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 2052 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 1993

                                                                        
Query: 313  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 372
            |||||||| ||  |   |||||| | ||| |||| |||| | || |||||||| ||||||
Sbjct: 1992 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttatgcgcg 1933

                                                                        
Query: 373  agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 432
            |||||||||||||| | || |||||| ||||| ||||| ||||| || ||||  ||||||
Sbjct: 1932 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 1873

                                                                  
Query: 433  ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||| | |||||| ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 1872 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 1819



to top

>gb|M73235.1|MZEOMTH Zea mays O-methyltransferase (OMT) gene, complete cds
          Length = 2512

 Score =  107 bits (54), Expect = 3e-20
 Identities = 189/234 (80%)
 Strand = Plus / Minus

                                                                        
Query: 253  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 312
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 2131 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 2072

                                                                        
Query: 313  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 372
            |||||||| ||  |   |||||| | ||| |||| |||| | || || ||||||||||||
Sbjct: 2071 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcg 2012

                                                                        
Query: 373  agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 432
            |||||||||||||| | || |||||| ||||| ||||| ||||| || ||||  ||||||
Sbjct: 2011 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 1952

                                                                  
Query: 433  ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||| | |||||| ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 1951 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 1898



to top

>gb|AY323289.1| Zea mays inbred line F271 O-methyltransferase (comt) gene, partial
            cds
          Length = 2892

 Score =  101 bits (51), Expect = 2e-18
 Identities = 177/219 (80%)
 Strand = Plus / Minus

                                                                        
Query: 268  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 327
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 2888 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2829

                                                                        
Query: 328  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 387
              |||||| | ||| |||| |||| | || ||||||||||||||||||||||||||||| 
Sbjct: 2828 cggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcgagcatgatcatgtcg 2769

                                                                        
Query: 388  aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 447
            | || |||||| ||||| ||||| ||||| || ||||  ||||||||||| | |||||| 
Sbjct: 2768 acgtggaacacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2709

                                                   
Query: 448  acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2708 acgacgatgaccttgccattttccggcagcgcgtcgtag 2670



to top

>gb|AY323276.1| Zea mays inbred line Quebec28 O-methyltransferase (comt) gene,
            complete cds
          Length = 3061

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 188/234 (80%)
 Strand = Plus / Minus

                                                                        
Query: 253  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 312
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 3051 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 2992

                                                                        
Query: 313  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 372
            |||||||| ||  |   |||||| | ||| |||| |||| | || || ||||||||||||
Sbjct: 2991 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcg 2932

                                                                        
Query: 373  agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 432
            |||||||||||||| | || ||| || ||||| ||||| ||||| || ||||  ||||||
Sbjct: 2931 agcatgatcatgtcgacgtggaagacgccctgcgccttgggggtggcctccgtgttgacc 2872

                                                                  
Query: 433  ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||| | |||||| ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2871 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2818



to top

>gb|AY323275.1| Zea mays inbred line F66 O-methyltransferase (comt) gene, complete
            cds
          Length = 2041

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 188/234 (80%)
 Strand = Plus / Minus

                                                                        
Query: 253  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 312
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 2031 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 1972

                                                                        
Query: 313  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 372
            |||||||| ||  |   |||||| | ||| |||| |||| | || || ||||||||||||
Sbjct: 1971 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcg 1912

                                                                        
Query: 373  agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 432
            |||||||||||||| | || ||| || ||||| ||||| ||||| || ||||  ||||||
Sbjct: 1911 agcatgatcatgtcgacgtggaagacgccctgcgccttgggggtggcctccgtgttgacc 1852

                                                                  
Query: 433  ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||| | |||||| ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 1851 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 1798



to top

>gb|AY323297.1| Zea mays inbred line F288 O-methyltransferase (comt) gene, partial
            cds
          Length = 2927

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 181/225 (80%)
 Strand = Plus / Minus

                                                                        
Query: 262  gcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcc 321
            ||||| ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| 
Sbjct: 2927 gcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcg 2868

                                                                        
Query: 322  agggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatc 381
            ||  |   |||||| | ||| |||| |||| | || || |||||||||||||||||||||
Sbjct: 2867 agctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatc 2808

                                                                        
Query: 382  atgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatg 441
            ||||| | || |||||| ||||| ||||| ||||| || ||||  ||||||||||| | |
Sbjct: 2807 atgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgaccggcagcacg 2748

                                                         
Query: 442  cactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||| ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2747 cactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2703



to top

>gb|AY323288.1| Zea mays inbred line F286 O-methyltransferase (comt) gene, partial
            cds
          Length = 2951

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 181/225 (80%)
 Strand = Plus / Minus

                                                                        
Query: 262  gcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcc 321
            ||||| ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| 
Sbjct: 2951 gcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcg 2892

                                                                        
Query: 322  agggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatc 381
            ||  |   |||||| | ||| |||| |||| | || || |||||||||||||||||||||
Sbjct: 2891 agctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatc 2832

                                                                        
Query: 382  atgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatg 441
            ||||| | || |||||| ||||| ||||| ||||| || ||||  ||||||||||| | |
Sbjct: 2831 atgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgaccggcagcacg 2772

                                                         
Query: 442  cactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||| ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2771 cactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2727



to top

>gb|AY323290.1| Zea mays inbred line F113 O-methyltransferase (comt) gene, partial
            cds
          Length = 3154

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 150/184 (81%)
 Strand = Plus / Minus

                                                                        
Query: 268  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 327
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 3150 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 3091

                                                                        
Query: 328  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 387
              |||||| | ||| |||| |||| | || ||||||||||||||||||||||||||||| 
Sbjct: 3090 cggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcgagcatgatcatgtcg 3031

                                                                        
Query: 388  aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 447
            | || |||||| ||||| ||||| ||||| || ||||  ||||||||||| | |||||| 
Sbjct: 3030 acgtggaacacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2971

                
Query: 448  acga 451
            ||||
Sbjct: 2970 acga 2967



to top

>gb|AY323305.1| Zea mays inbred line EP1 O-methyltransferase (comt) gene, partial cds
          Length = 2782

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 176/219 (80%)
 Strand = Plus / Minus

                                                                        
Query: 268  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 327
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 2778 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2719

                                                                        
Query: 328  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 387
              |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| 
Sbjct: 2718 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2659

                                                                        
Query: 388  aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 447
            | || |||||| ||||| ||||| ||||| || ||||  ||||||||||| | |||||| 
Sbjct: 2658 acgtggaacacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2599

                                                   
Query: 448  acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2598 acgacgatgaccttgccattttccggcagcgcgtcgtag 2560



to top

>gb|AY323303.1| Zea mays inbred line W117 O-methyltransferase (comt) gene, partial
            cds
          Length = 2925

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 176/219 (80%)
 Strand = Plus / Minus

                                                                        
Query: 268  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 327
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 2921 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2862

                                                                        
Query: 328  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 387
              |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| 
Sbjct: 2861 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2802

                                                                        
Query: 388  aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 447
            | || |||||| ||||| ||||| ||||| || ||||  ||||||||||| | |||||| 
Sbjct: 2801 acgtggaacacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2742

                                                   
Query: 448  acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2741 acgacgatgaccttgccattttccggcagcgcgtcgtag 2703



to top

>gb|AY323300.1| Zea mays inbred line F7012 O-methyltransferase (comt) gene, partial
            cds
          Length = 2850

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 176/219 (80%)
 Strand = Plus / Minus

                                                                        
Query: 268  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 327
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 2846 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2787

                                                                        
Query: 328  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 387
              |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| 
Sbjct: 2786 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2727

                                                                        
Query: 388  aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 447
            | || |||||| ||||| ||||| ||||| || ||||  ||||||||||| | |||||| 
Sbjct: 2726 acgtggaacacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2667

                                                   
Query: 448  acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2666 acgacgatgaccttgccattttccggcagcgcgtcgtag 2628



to top

>gb|AY323298.1| Zea mays inbred line F324 O-methyltransferase (comt) gene, partial
            cds
          Length = 2782

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 176/219 (80%)
 Strand = Plus / Minus

                                                                        
Query: 268  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 327
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 2778 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2719

                                                                        
Query: 328  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 387
              |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| 
Sbjct: 2718 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2659

                                                                        
Query: 388  aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 447
            | || |||||| ||||| ||||| ||||| || ||||  ||||||||||| | |||||| 
Sbjct: 2658 acgtggaacacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2599

                                                   
Query: 448  acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2598 acgacgatgaccttgccattttccggcagcgcgtcgtag 2560



to top

>gb|AY323286.1| Zea mays inbred line F64 O-methyltransferase (comt) gene, partial cds
          Length = 2948

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 176/219 (80%)
 Strand = Plus / Minus

                                                                        
Query: 268  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 327
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 2944 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2885

                                                                        
Query: 328  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 387
              |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| 
Sbjct: 2884 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2825

                                                                        
Query: 388  aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 447
            | || |||||| ||||| ||||| ||||| || ||||  ||||||||||| | |||||| 
Sbjct: 2824 acgtggaacacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2765

                                                   
Query: 448  acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2764 acgacgatgaccttgccattttccggcagcgcgtcgtag 2726



to top

>gb|AY323283.1| Zea mays inbred line W64A O-methyltransferase (comt) gene, partial
            cds
          Length = 2748

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 176/219 (80%)
 Strand = Plus / Minus

                                                                        
Query: 268  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 327
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 2744 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2685

                                                                        
Query: 328  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 387
              |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| 
Sbjct: 2684 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2625

                                                                        
Query: 388  aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 447
            | || |||||| ||||| ||||| ||||| || ||||  ||||||||||| | |||||| 
Sbjct: 2624 acgtggaacacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2565

                                                   
Query: 448  acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2564 acgacgatgaccttgccattttccggcagcgcgtcgtag 2526



to top

>gb|AY323299.1| Zea mays inbred line F4 O-methyltransferase (comt) gene, partial cds
          Length = 2675

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 180/225 (80%)
 Strand = Plus / Minus

                                                                        
Query: 262  gcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcc 321
            ||||| ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| 
Sbjct: 2675 gcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcg 2616

                                                                        
Query: 322  agggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatc 381
            ||  |   |||||| | ||| |||| |||| | || || |||||||||||||||||||||
Sbjct: 2615 agctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatc 2556

                                                                        
Query: 382  atgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatg 441
            ||||| | || ||| || ||||| ||||| ||||| || ||||  ||||||||||| | |
Sbjct: 2555 atgtcgacgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacg 2496

                                                         
Query: 442  cactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||| ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2495 cactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2451



to top

>gb|AY323293.1| Zea mays Rottaler Silomais O-methyltransferase (comt) gene, partial
            cds
          Length = 3151

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 180/225 (80%)
 Strand = Plus / Minus

                                                                        
Query: 262  gcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcc 321
            ||||| ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| 
Sbjct: 3151 gcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcg 3092

                                                                        
Query: 322  agggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatc 381
            ||  |   |||||| | ||| |||| |||| | || || |||||||||||||||||||||
Sbjct: 3091 agctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatc 3032

                                                                        
Query: 382  atgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatg 441
            ||||| | || ||| || ||||| ||||| ||||| || ||||  ||||||||||| | |
Sbjct: 3031 atgtcgacgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacg 2972

                                                         
Query: 442  cactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||| ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2971 cactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2927



to top

>gb|AY323278.1| Zea mays Sibiriaka O-methyltransferase (comt) gene, partial cds
          Length = 3146

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 180/225 (80%)
 Strand = Plus / Minus

                                                                        
Query: 262  gcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcc 321
            ||||| ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| 
Sbjct: 3146 gcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcg 3087

                                                                        
Query: 322  agggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatc 381
            ||  |   |||||| | ||| |||| |||| | || || |||||||||||||||||||||
Sbjct: 3086 agctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatc 3027

                                                                        
Query: 382  atgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatg 441
            ||||| | || ||| || ||||| ||||| ||||| || ||||  ||||||||||| | |
Sbjct: 3026 atgtcgacgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacg 2967

                                                         
Query: 442  cactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||| ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2966 cactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2922



to top

>gb|AY323296.1| Zea mays inbred line F2 O-methyltransferase (comt) gene, partial cds
          Length = 3206

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 179/224 (79%)
 Strand = Plus / Minus

                                                                        
Query: 263  cccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcca 322
            |||| ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| |
Sbjct: 3204 cccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcga 3145

                                                                        
Query: 323  gggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatca 382
            |  |   |||||| | ||| |||| |||| | || || ||||||||||||||||||||||
Sbjct: 3144 gctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatca 3085

                                                                        
Query: 383  tgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgc 442
            |||| | || ||| || ||||| ||||| ||||| || ||||  ||||||||||| | ||
Sbjct: 3084 tgtcgacgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgc 3025

                                                        
Query: 443  actccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            |||| ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 3024 actcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2981



to top

>gb|AY323301.1| Zea mays inbred line 212 O-methyltransferase (comt) gene, partial cds
          Length = 2757

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 175/219 (79%)
 Strand = Plus / Minus

                                                                        
Query: 268  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 327
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 2753 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2694

                                                                        
Query: 328  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 387
              |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| 
Sbjct: 2693 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2634

                                                                        
Query: 388  aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 447
            | || ||| || ||||| ||||| ||||| || ||||  ||||||||||| | |||||| 
Sbjct: 2633 acgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2574

                                                   
Query: 448  acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2573 acgacgatgaccttgccattttccggcagcgcgtcgtag 2535



to top

>gb|AY323291.1| Zea mays inbred line F1 O-methyltransferase (comt) gene, partial cds
          Length = 3102

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 175/219 (79%)
 Strand = Plus / Minus

                                                                        
Query: 268  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 327
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 3098 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 3039

                                                                        
Query: 328  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 387
              |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| 
Sbjct: 3038 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2979

                                                                        
Query: 388  aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 447
            | || ||| || ||||| ||||| ||||| || ||||  ||||||||||| | |||||| 
Sbjct: 2978 acgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2919

                                                   
Query: 448  acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2918 acgacgatgaccttgccattttccggcagcgcgtcgtag 2880



to top

>gb|AY323285.1| Zea mays inbred line F7 O-methyltransferase (comt) gene, partial cds
          Length = 3131

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 175/219 (79%)
 Strand = Plus / Minus

                                                                        
Query: 268  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 327
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 3127 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 3068

                                                                        
Query: 328  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 387
              |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| 
Sbjct: 3067 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 3008

                                                                        
Query: 388  aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 447
            | || ||| || ||||| ||||| ||||| || ||||  ||||||||||| | |||||| 
Sbjct: 3007 acgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2948

                                                   
Query: 448  acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2947 acgacgatgaccttgccattttccggcagcgcgtcgtag 2909



to top

>ref|XM_480185.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1425

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 132/162 (81%)
 Strand = Plus / Minus

                                                                        
Query: 243  ctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggc 302
            |||||| || |||||||| ||||| ||||| ||||||||||| |||||||||| |  || 
Sbjct: 1189 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 1130

                                                                        
Query: 303  gaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctgg 362
            ||| |||||| |   ||| ||  ||  |||||||||||| ||||||||| | || || ||
Sbjct: 1129 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 1070

                                                      
Query: 363  gttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 404
            |||||| ||||||||||||||||| | || |||||| |||||
Sbjct: 1069 gttgtgggcgagcatgatcatgtcgacgtggaacaccccctg 1028



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                    
Query: 431  ccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||||| | ||||||||| | ||||||||| |||||| |||||||||||||||||
Sbjct: 1001 ccggcagcacgcactccaccaccaccaccttcccgtgctccggcagcgcgtcgtag 946



to top

>dbj|AK061859.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-G09, full
           insert sequence
          Length = 1227

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 132/162 (81%)
 Strand = Plus / Minus

                                                                       
Query: 243 ctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggc 302
           |||||| || |||||||| ||||| ||||| ||||||||||| |||||||||| |  || 
Sbjct: 987 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 928

                                                                       
Query: 303 gaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctgg 362
           ||| |||||| |   ||| ||  ||  |||||||||||| ||||||||| | || || ||
Sbjct: 927 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 868

                                                     
Query: 363 gttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 404
           |||||| ||||||||||||||||| | || |||||| |||||
Sbjct: 867 gttgtgggcgagcatgatcatgtcgacgtggaacaccccctg 826



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 431 ccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
           ||||||| | ||||||||| | ||||||||| |||||| |||||||||||||||||
Sbjct: 799 ccggcagcacgcactccaccaccaccaccttcccgtgctccggcagcgcgtcgtag 744



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 132/162 (81%)
 Strand = Plus / Plus

                                                                           
Query: 243     ctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggc 302
               |||||| || |||||||| ||||| ||||| ||||||||||| |||||||||| |  || 
Sbjct: 3331696 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 3331755

                                                                           
Query: 303     gaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctgg 362
               ||| |||||| |   ||| ||  ||  |||||||||||| ||||||||| | || || ||
Sbjct: 3331756 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 3331815

                                                         
Query: 363     gttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 404
               |||||| ||||||||||||||||| | || |||||| |||||
Sbjct: 3331816 gttgtgggcgagcatgatcatgtcgacgtggaacaccccctg 3331857



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                       
Query: 431     ccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
               ||||||| | ||||||||| | ||||||||| |||||| |||||||||||||||||
Sbjct: 3331884 ccggcagcacgcactccaccaccaccaccttcccgtgctccggcagcgcgtcgtag 3331939



to top

>gb|DQ288259.1| Oryza sativa (japonica cultivar-group) O-methyltransferase (ROMT-9)
            mRNA, complete cds
          Length = 1190

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 132/162 (81%)
 Strand = Plus / Minus

                                                                        
Query: 243  ctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggc 302
            |||||| || |||||||| ||||| ||||| ||||||||||| |||||||||| |  || 
Sbjct: 1121 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 1062

                                                                        
Query: 303  gaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctgg 362
            ||| |||||| |   ||| ||  ||  |||||||||||| ||||||||| | || || ||
Sbjct: 1061 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 1002

                                                      
Query: 363  gttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 404
            |||||| ||||||||||||||||| | || |||||| |||||
Sbjct: 1001 gttgtgggcgagcatgatcatgtcgacgtggaacaccccctg 960



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 431 ccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
           ||||||| | ||||||||| | ||||||||| |||||| |||||||||||||||||
Sbjct: 933 ccggcagcacgcactccaccaccaccaccttcccgtgctccggcagcgcgtcgtag 878



to top

>dbj|AB122056.1| Oryza sativa (japonica cultivar-group) COMT mRNA for caffeic acid
           o-methyl transferase, partial cds
          Length = 1067

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 132/162 (81%)
 Strand = Plus / Minus

                                                                       
Query: 243 ctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggc 302
           |||||| || |||||||| ||||| ||||| ||||||||||| |||||||||| |  || 
Sbjct: 807 ctactttgtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 748

                                                                       
Query: 303 gaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctgg 362
           ||| |||||| |   ||| ||  ||  |||||||||||| ||||||||| | || || ||
Sbjct: 747 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 688

                                                     
Query: 363 gttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 404
           |||||| ||||||||||||||||| | || |||||| |||||
Sbjct: 687 gttgtgggcgagcatgatcatgtcgacgtggaacaccccctg 646



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 431 ccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
           ||||||| | ||||||||| | ||||||||| |||||| |||||||||||||||||
Sbjct: 619 ccggcagcacgcactccaccaccaccaccttcccgtgctccggcagcgcgtcgtag 564



to top

>dbj|AP004460.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0438H08
          Length = 148626

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 132/162 (81%)
 Strand = Plus / Plus

                                                                          
Query: 243    ctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggc 302
              |||||| || |||||||| ||||| ||||| ||||||||||| |||||||||| |  || 
Sbjct: 109263 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 109322

                                                                          
Query: 303    gaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctgg 362
              ||| |||||| |   ||| ||  ||  |||||||||||| ||||||||| | || || ||
Sbjct: 109323 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 109382

                                                        
Query: 363    gttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 404
              |||||| ||||||||||||||||| | || |||||| |||||
Sbjct: 109383 gttgtgggcgagcatgatcatgtcgacgtggaacaccccctg 109424



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                      
Query: 431    ccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
              ||||||| | ||||||||| | ||||||||| |||||| |||||||||||||||||
Sbjct: 109451 ccggcagcacgcactccaccaccaccaccttcccgtgctccggcagcgcgtcgtag 109506



to top

>dbj|AK064768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000A05, full
            insert sequence
          Length = 1425

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 132/162 (81%)
 Strand = Plus / Minus

                                                                        
Query: 243  ctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggc 302
            |||||| || |||||||| ||||| ||||| ||||||||||| |||||||||| |  || 
Sbjct: 1189 ctactttgtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 1130

                                                                        
Query: 303  gaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctgg 362
            ||| |||||| |   ||| ||  ||  |||||||||||| ||||||||| | || || ||
Sbjct: 1129 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 1070

                                                      
Query: 363  gttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 404
            |||||| ||||||||||||||||| | || |||||| |||||
Sbjct: 1069 gttgtgggcgagcatgatcatgtcgacgtggaacaccccctg 1028



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                    
Query: 431  ccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||||| | ||||||||| | ||||||||| |||||| |||||||||||||||||
Sbjct: 1001 ccggcagcacgcactccaccaccaccaccttcccgtgctccggcagcgcgtcgtag 946



to top

>gb|AY323279.1| Zea mays Rainbow Flint O-methyltransferase (comt) gene, partial cds
          Length = 3111

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 179/225 (79%)
 Strand = Plus / Minus

                                                                        
Query: 262  gcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcc 321
            ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||||||| || 
Sbjct: 3111 gcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgccctttgcg 3052

                                                                        
Query: 322  agggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatc 381
            ||  |   |||||| | ||| |||| |||| | || || |||||||||||||||||||||
Sbjct: 3051 agctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatc 2992

                                                                        
Query: 382  atgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatg 441
            ||||| | || ||| || ||||| ||||| ||||| || ||||  ||||||||||| | |
Sbjct: 2991 atgtcgacgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacg 2932

                                                         
Query: 442  cactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||| ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2931 cactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2887



to top

>gb|AY323277.1| Zea mays Polar Dent O-methyltransferase (comt) gene, partial cds
          Length = 3073

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 179/225 (79%)
 Strand = Plus / Minus

                                                                        
Query: 262  gcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcc 321
            ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||||||| || 
Sbjct: 3073 gcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgccctttgcg 3014

                                                                        
Query: 322  agggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatc 381
            ||  |   |||||| | ||| |||| |||| | || || |||||||||||||||||||||
Sbjct: 3013 agctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatc 2954

                                                                        
Query: 382  atgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatg 441
            ||||| | || ||| || ||||| ||||| ||||| || ||||  ||||||||||| | |
Sbjct: 2953 atgtcgacgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacg 2894

                                                         
Query: 442  cactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||| ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2893 cactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2849



to top

>gb|AY323294.1| Zea mays inbred line B14 O-methyltransferase (comt) gene, partial cds
          Length = 2643

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 174/219 (79%)
 Strand = Plus / Minus

                                                                        
Query: 268  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 327
            ||||| ||||||||||| ||||||||||    || ||| ||||||||||| || ||  | 
Sbjct: 2639 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgccctttgcgagctcg 2580

                                                                        
Query: 328  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 387
              |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| 
Sbjct: 2579 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2520

                                                                        
Query: 388  aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 447
            | || ||| || ||||| ||||| ||||| || ||||  ||||||||||| | |||||| 
Sbjct: 2519 acgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2460

                                                   
Query: 448  acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2459 acgacgatgaccttgccattttccggcagcgcgtcgtag 2421



to top

>gb|AY323292.1| Zea mays inbred line DE811 O-methyltransferase (comt) gene, partial
            cds
          Length = 2639

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 174/219 (79%)
 Strand = Plus / Minus

                                                                        
Query: 268  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 327
            ||||| ||||||||||| ||||||||||    || ||| ||||||||||| || ||  | 
Sbjct: 2635 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgccctttgcgagctcg 2576

                                                                        
Query: 328  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 387
              |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| 
Sbjct: 2575 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2516

                                                                        
Query: 388  aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 447
            | || ||| || ||||| ||||| ||||| || ||||  ||||||||||| | |||||| 
Sbjct: 2515 acgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2456

                                                   
Query: 448  acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2455 acgacgatgaccttgccattttccggcagcgcgtcgtag 2417



to top

>gb|AY323280.1| Zea mays Noordlander O-methyltransferase (comt) gene, partial cds
          Length = 3105

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 174/219 (79%)
 Strand = Plus / Minus

                                                                        
Query: 268  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 327
            ||||| ||||||||||| ||||||||||    || ||| ||||||||||| || ||  | 
Sbjct: 3101 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgccctttgcgagctcg 3042

                                                                        
Query: 328  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 387
              |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| 
Sbjct: 3041 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2982

                                                                        
Query: 388  aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 447
            | || ||| || ||||| ||||| ||||| || ||||  ||||||||||| | |||||| 
Sbjct: 2981 acgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2922

                                                   
Query: 448  acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 486
            ||||  |  |||||||| |   |||||||||||||||||
Sbjct: 2921 acgacgatgaccttgccattttccggcagcgcgtcgtag 2883



to top

>gb|AY217766.1| Sorghum bicolor caffeic acid O-methyltransferase gene, complete cds
          Length = 3312

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 109/134 (81%)
 Strand = Plus / Minus

                                                                        
Query: 253  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 312
            |||||||| ||||| ||||| ||||||||||| ||||||||||     | ||| || |||
Sbjct: 2769 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccagagaagccagcg 2710

                                                                        
Query: 313  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 372
             ||||||| ||| |   |||||||| ||| |||| |||||| || || ||||| ||||||
Sbjct: 2709 gccttggcgaggtcacggaactcccgctcgtaccgctccctgccgccggggttatgcgcg 2650

                          
Query: 373  agcatgatcatgtc 386
            ||||||||||||||
Sbjct: 2649 agcatgatcatgtc 2636



to top

>gb|AF387790.1|AF387790 Sorghum bicolor O-methyltransferase mRNA, complete cds
          Length = 1458

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 109/134 (81%)
 Strand = Plus / Minus

                                                                        
Query: 253  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 312
            |||||||| ||||| ||||| ||||||||||| ||||||||||     | ||| || |||
Sbjct: 1188 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccagagaagccagcg 1129

                                                                        
Query: 313  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 372
             ||||||| ||| |   |||||||| ||| |||| |||||| || || ||||| ||||||
Sbjct: 1128 gccttggcgaggtcacggaactcccgctcgtaccgctccctgccgccggggttatgcgcg 1069

                          
Query: 373  agcatgatcatgtc 386
            ||||||||||||||
Sbjct: 1068 agcatgatcatgtc 1055



to top

>gb|AY098514.1| Ananas comosus caffeic acid O-methyltransferase mRNA, partial cds
          Length = 460

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 361 gggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 404
           ||||||||||| |||||||||||||| | || |||||| |||||
Sbjct: 108 gggttgtgcgccagcatgatcatgtcgacgtggaacacgccctg 65



to top

>gb|BT009359.1| Triticum aestivum clone wlm96.pk025.c3:fis, full insert mRNA
           sequence
          Length = 1308

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 430 accggcaggatgcactccacgagcaccaccttgcc 464
           ||||||||||||| ||||||||  |||||||||||
Sbjct: 994 accggcaggatgccctccacgatgaccaccttgcc 960



to top

>emb|AL138831.12| Human DNA sequence from clone RP3-406P24 on chromosome 6 Contains a
             thioredoxin-like pseudogene, the gene for thioredoxin-like
             2 (TXNL2), a novel gene and the 5' end of the gene for
             serine/threonine-protein kinase PRP4 homolog (PRP4),(PR4H,
             PRP4H, KIAA0536). Contains 2 CpG islands, complete
             sequence
          Length = 49600

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 197   ggagcagcaatgagcatgcaag 218
             ||||||||||||||||||||||
Sbjct: 20280 ggagcagcaatgagcatgcaag 20301



to top

>emb|AJ632203.2| Streptomyces antibioticus oviedomycin biosynthetic gene cluster, strain
             ATCC 11891
          Length = 24720

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 462   gccgtgcgccggcagcgcgtcg 483
             ||||||||||||||||||||||
Sbjct: 19739 gccgtgcgccggcagcgcgtcg 19760



to top

>dbj|AP006107.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT29P11, TM0193,
             complete sequence
          Length = 102354

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 1     aatgtaacatcaaatcatatat 22
             ||||||||||||||||||||||
Sbjct: 74638 aatgtaacatcaaatcatatat 74659



to top

>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence
          Length = 4895836

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 458     ccttgccgtgcgccggcagcg 478
               |||||||||||||||||||||
Sbjct: 3430054 ccttgccgtgcgccggcagcg 3430034



to top

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 311     cgcccttggccagggcctcga 331
               |||||||||||||||||||||
Sbjct: 4318826 cgcccttggccagggcctcga 4318846



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 462     gccgtgcgccggcagcgcgtc 482
               |||||||||||||||||||||
Sbjct: 3816881 gccgtgcgccggcagcgcgtc 3816901



to top

>gb|AC011900.6| Homo sapiens BAC clone RP11-542L18 from 2, complete sequence
          Length = 184053

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 2      atgtaacatcaaatcatatat 22
              |||||||||||||||||||||
Sbjct: 104322 atgtaacatcaaatcatatat 104302



to top

>gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome
          Length = 2256640

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 448     acgagcaccaccttgccgtgc 468
               |||||||||||||||||||||
Sbjct: 1436360 acgagcaccaccttgccgtgc 1436380



to top

>emb|AL806522.4| Mouse DNA sequence from clone RP23-167H2 on chromosome 2, complete
              sequence
          Length = 189104

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 140    aaattaagggaaaacataggg 160
              |||||||||||||||||||||
Sbjct: 170272 aaattaagggaaaacataggg 170252



to top

>gb|AY506529.1| Zea mays strain NB mitochondrion, complete genome
          Length = 569630

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 35     catcatatataattaatgca 54
              ||||||||||||||||||||
Sbjct: 523998 catcatatataattaatgca 524017



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 35     catcatatataattaatgca 54
              ||||||||||||||||||||
Sbjct: 455061 catcatatataattaatgca 455080



to top

>gb|DQ490952.1| Zea mays subsp. mays genotype male-fertile NA mitochondrion, complete
              genome
          Length = 701046

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 35     catcatatataattaatgca 54
              ||||||||||||||||||||
Sbjct: 643780 catcatatataattaatgca 643799



to top

>gb|DQ490951.1| Zea mays subsp. mays genotype CMS-S mitochondrion, complete genome
          Length = 569553

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 35     catcatatataattaatgca 54
              ||||||||||||||||||||
Sbjct: 556187 catcatatataattaatgca 556206



to top

>gb|AC164098.4| Mus musculus BAC clone RP23-341D24 from chromosome 1, complete sequence
          Length = 221754

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 5      taacatcaaatcatatatcatgaa 28
              |||||||||||||||| |||||||
Sbjct: 104628 taacatcaaatcatatctcatgaa 104605



to top

>gb|AY794816.1| Galearia filiformis tRNA-Leu (trnL) gene and trnL-trnF intergenic
           spacer, partial sequence; chloroplast
          Length = 1013

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 108 aattagaaattggaatgatt 127
           ||||||||||||||||||||
Sbjct: 781 aattagaaattggaatgatt 800



to top

>gb|AY794673.1| Omphalea palmata tRNA-Leu (trnL) gene and trnL-trnF intergenic
           spacer, partial sequence; chloroplast
          Length = 1088

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 108 aattagaaattggaatgatt 127
           ||||||||||||||||||||
Sbjct: 817 aattagaaattggaatgatt 836



to top

>gb|AY794672.1| Omphalea diandra tRNA-Leu (trnL) gene and trnL-trnF intergenic
           spacer, partial sequence; chloroplast
          Length = 1077

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 108 aattagaaattggaatgatt 127
           ||||||||||||||||||||
Sbjct: 811 aattagaaattggaatgatt 830



to top

>gb|DQ001169.1| Acacia mangium x Acacia auriculiformis caffeic acid
            O-methyltransferase mRNA, complete cds
          Length = 1408

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 56/68 (82%)
 Strand = Plus / Minus

                                                                        
Query: 313  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 372
            ||||||||||| ||||| |||||  |||||  ||||||  | ||||||||||| || || 
Sbjct: 1093 cccttggccagagcctcaaactctttctcagtcctctctttgccacctgggttatgagcc 1034

                    
Query: 373  agcatgat 380
            ||||||||
Sbjct: 1033 agcatgat 1026



to top

>gb|DQ490953.1| Zea mays subsp. mays genotype CMS-T mitochondrion, complete genome
          Length = 535825

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 35    catcatatataattaatgca 54
             ||||||||||||||||||||
Sbjct: 54575 catcatatataattaatgca 54594



to top

>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome
          Length = 3928089

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 417     agcttccggattgaccggca 436
               ||||||||||||||||||||
Sbjct: 2977957 agcttccggattgaccggca 2977976



to top

>gb|AC138448.9| Medicago truncatula clone mth2-11n13, complete sequence
          Length = 112155

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 82    catatggaatggaccaatgg 101
             ||||||||||||||||||||
Sbjct: 46376 catatggaatggaccaatgg 46357



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 82    catatggaatggaccaatgg 101
             ||||||||||||||||||||
Sbjct: 39072 catatggaatggaccaatgg 39053



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 82    catatggaatggaccaatgg 101
             ||||||||||||||||||||
Sbjct: 32824 catatggaatggaccaatgg 32805



to top

>emb|Z83001.1|HSG0453 Human DNA sequence from clone XX-G0453 on chromosome 11, complete
             sequence
          Length = 32246

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 127   tcaaaggatgcaaaaattaa 146
             ||||||||||||||||||||
Sbjct: 26735 tcaaaggatgcaaaaattaa 26716



to top

>emb|AL136373.21| Human DNA sequence from clone RP11-49P4 on chromosome 1p32.2-33
             Contains two novel genes (FLJ40412, FLJ32011), the MKNK1
             gene for MAP kinase-interacting serine/threonine kinase 1,
             the gene for MOB3C protein (MOB3C) and the 3' end of the
             ATPAF1 gene for ATP synthase mitochondrial F1 complex
             assembly factor 1, complete sequence
          Length = 121112

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 346   ctctccctaccacctgggtt 365
             ||||||||||||||||||||
Sbjct: 90353 ctctccctaccacctgggtt 90372



to top

>emb|AL049745.9|HSJ654H19 Human DNA sequence from clone RP4-654H19 on chromosome 1p31.1-33
             Contains the 5' end of the gene for likely ortholog of
             mouse Gli-similar 1 Kruppel-like zinc finger (Glia1)
             (FLJ36155), a novel gene (FLJ10407), a ribosomal protein
             L37 (RPL37) pseudogene and a CpG island, complete sequence
          Length = 117493

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 98    atggcacaacaattagaaat 117
             ||||||||||||||||||||
Sbjct: 77238 atggcacaacaattagaaat 77257



to top

>gb|AC010282.6| Homo sapiens chromosome 5 clone CTC-555I19, complete sequence
          Length = 191131

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   caacaattagaaattggaat 123
             ||||||||||||||||||||
Sbjct: 85981 caacaattagaaattggaat 86000



to top

>emb|Z00026.1|MIZMATP1 Maize mitochondrial gene for F1-ATPase alpha-subunit
          Length = 1620

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  catcatatataattaatgca 54
           ||||||||||||||||||||
Sbjct: 907 catcatatataattaatgca 888



to top

>emb|CR925678.1| Ehrlichia ruminantium str. Welgevonden, complete genome
          Length = 1512977

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 14     atcatatatcatgaatgatt 33
              ||||||||||||||||||||
Sbjct: 465737 atcatatatcatgaatgatt 465718



to top

>emb|CR925677.1| Ehrlichia ruminantium str. Gardel, complete genome
          Length = 1499920

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 14     atcatatatcatgaatgatt 33
              ||||||||||||||||||||
Sbjct: 462965 atcatatatcatgaatgatt 462946



to top

>emb|CR767821.1| Ehrlichia ruminantium strain Welgevonden, complete genome
          Length = 1516355

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 14     atcatatatcatgaatgatt 33
              ||||||||||||||||||||
Sbjct: 485880 atcatatatcatgaatgatt 485861



to top

>emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS767 of Debaryomyces
               hansenii
          Length = 2051428

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 28      atgattgcatcatatataattaatgcaa 55
               ||||| ||||||||||||||| ||||||
Sbjct: 1986287 atgatggcatcatatataattcatgcaa 1986260



to top

>emb|AJ278690.1|SBI278690 Sorghum bicolor partial mitochondrial mRNA for F0-F1 ATPase alpha
           subunit (atpA gene), cultivar 2077A
          Length = 1324

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  catcatatataattaatgca 54
           ||||||||||||||||||||
Sbjct: 784 catcatatataattaatgca 765



to top

>emb|AJ278689.1|SBI278689 Sorghum bicolor partial mitochondrial mRNA for F0-F1 ATPase alpha
           subunit (atpA gene), cultivar CS3541
          Length = 1324

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  catcatatataattaatgca 54
           ||||||||||||||||||||
Sbjct: 784 catcatatataattaatgca 765



to top

>emb|AL663035.8| Mouse DNA sequence from clone RP23-432G17 on chromosome 11 Contains a
              novel pseudogene, complete sequence
          Length = 203319

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 127    tcaaaggatgcaaaaattaa 146
              ||||||||||||||||||||
Sbjct: 147829 tcaaaggatgcaaaaattaa 147810



to top

>emb|CR387929.4| Zebrafish DNA sequence from clone DKEY-172H18 in linkage group 5,
              complete sequence
          Length = 245364

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 6      aacatcaaatcatatatcat 25
              ||||||||||||||||||||
Sbjct: 222321 aacatcaaatcatatatcat 222302



to top

>gb|AC011478.3| Homo sapiens chromosome 19 clone CTC-565M22, complete sequence
          Length = 100147

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 48    taatgcaacatttaagagaa 67
             ||||||||||||||||||||
Sbjct: 60624 taatgcaacatttaagagaa 60643



to top

>gb|AE012241.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 149
            of 460 of the complete genome
          Length = 10029

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 446  ccacgagcaccaccttgccg 465
            ||||||||||||||||||||
Sbjct: 2604 ccacgagcaccaccttgccg 2585



to top

>gb|AY094283.1| Zea mays cultivar F_7 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 320

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 253 aactcgattgcccatgcgttagcgtagatgta 284
           |||||||| ||||| ||||| |||||||||||
Sbjct: 273 aactcgatggcccaggcgttggcgtagatgta 304



to top

>gb|AY094282.1| Zea mays cultivar D_9 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 337

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 253 aactcgattgcccatgcgttagcgtagatgta 284
           |||||||| ||||| ||||| |||||||||||
Sbjct: 290 aactcgatggcccaggcgttggcgtagatgta 321



to top

>gb|AY094281.1| Zea mays cultivar D_6 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 321

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 253 aactcgattgcccatgcgttagcgtagatgta 284
           |||||||| ||||| ||||| |||||||||||
Sbjct: 274 aactcgatggcccaggcgttggcgtagatgta 305



to top

>gb|AY094280.1| Zea mays cultivar F_1 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 320

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 253 aactcgattgcccatgcgttagcgtagatgta 284
           |||||||| ||||| ||||| |||||||||||
Sbjct: 273 aactcgatggcccaggcgttggcgtagatgta 304



to top

>gb|AY094279.1| Zea mays cultivar Mo17 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 337

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 253 aactcgattgcccatgcgttagcgtagatgta 284
           |||||||| ||||| ||||| |||||||||||
Sbjct: 290 aactcgatggcccaggcgttggcgtagatgta 321



to top

>gb|AY094276.1| Zea mays cultivar 684 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 328

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 253 aactcgattgcccatgcgttagcgtagatgta 284
           |||||||| ||||| ||||| |||||||||||
Sbjct: 281 aactcgatggcccaggcgttggcgtagatgta 312



to top

>gb|AY094275.1| Zea mays cultivar I_1 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 304

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 253 aactcgattgcccatgcgttagcgtagatgta 284
           |||||||| ||||| ||||| |||||||||||
Sbjct: 257 aactcgatggcccaggcgttggcgtagatgta 288



to top

>gb|AY094274.1| Zea mays cultivar F_2 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 286

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 253 aactcgattgcccatgcgttagcgtagatgta 284
           |||||||| ||||| ||||| |||||||||||
Sbjct: 239 aactcgatggcccaggcgttggcgtagatgta 270



to top

>gb|AY094273.1| Zea mays cultivar G_1 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 308

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 253 aactcgattgcccatgcgttagcgtagatgta 284
           |||||||| ||||| ||||| |||||||||||
Sbjct: 261 aactcgatggcccaggcgttggcgtagatgta 292



to top

>gb|AY094271.1| Zea mays cultivar F_3 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 296

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 253 aactcgattgcccatgcgttagcgtagatgta 284
           |||||||| ||||| ||||| |||||||||||
Sbjct: 249 aactcgatggcccaggcgttggcgtagatgta 280



to top

>gb|AY094270.1| Zea mays cultivar F_5 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 308

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 253 aactcgattgcccatgcgttagcgtagatgta 284
           |||||||| ||||| ||||| |||||||||||
Sbjct: 261 aactcgatggcccaggcgttggcgtagatgta 292



to top

>gb|AY094269.1| Zea mays cultivar H_5 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 320

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 253 aactcgattgcccatgcgttagcgtagatgta 284
           |||||||| ||||| ||||| |||||||||||
Sbjct: 273 aactcgatggcccaggcgttggcgtagatgta 304



to top

>gb|AY094268.1| Zea mays cultivar H_3 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 320

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 253 aactcgattgcccatgcgttagcgtagatgta 284
           |||||||| ||||| ||||| |||||||||||
Sbjct: 273 aactcgatggcccaggcgttggcgtagatgta 304



to top

>gb|AY094267.1| Zea mays cultivar J40 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 307

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 253 aactcgattgcccatgcgttagcgtagatgta 284
           |||||||| ||||| ||||| |||||||||||
Sbjct: 260 aactcgatggcccaggcgttggcgtagatgta 291



to top

>gb|AY094266.1| Zea mays cultivar 647 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 345

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 253 aactcgattgcccatgcgttagcgtagatgta 284
           |||||||| ||||| ||||| |||||||||||
Sbjct: 298 aactcgatggcccaggcgttggcgtagatgta 329



to top

>gb|AY094265.1| Zea mays cultivar B_1 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 324

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 253 aactcgattgcccatgcgttagcgtagatgta 284
           |||||||| ||||| ||||| |||||||||||
Sbjct: 277 aactcgatggcccaggcgttggcgtagatgta 308



to top

>gb|AY094264.1| Zea mays cultivar F_6 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 324

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 253 aactcgattgcccatgcgttagcgtagatgta 284
           |||||||| ||||| ||||| |||||||||||
Sbjct: 277 aactcgatggcccaggcgttggcgtagatgta 308



to top

>gb|AY094263.1| Zea mays cultivar C_5 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 324

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 253 aactcgattgcccatgcgttagcgtagatgta 284
           |||||||| ||||| ||||| |||||||||||
Sbjct: 277 aactcgatggcccaggcgttggcgtagatgta 308



to top

>gb|AY094262.1| Zea mays cultivar H_1 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 322

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 253 aactcgattgcccatgcgttagcgtagatgta 284
           |||||||| ||||| ||||| |||||||||||
Sbjct: 275 aactcgatggcccaggcgttggcgtagatgta 306



to top

>emb|BX511101.3| Zebrafish DNA sequence from clone DKEYP-92F1 in linkage group 2,
             complete sequence
          Length = 81968

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 6     aacatcaaatcatatatcat 25
             ||||||||||||||||||||
Sbjct: 16480 aacatcaaatcatatatcat 16499



to top

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 308     cggcgcccttggccagggcctcga 331
               ||||||| ||||||||||||||||
Sbjct: 1740172 cggcgccattggccagggcctcga 1740195



to top

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 446     ccacgagcaccaccttgccg 465
               ||||||||||||||||||||
Sbjct: 3396843 ccacgagcaccaccttgccg 3396862



to top

>ref|XM_395084.2| PREDICTED: Apis mellifera similar to CG5811-PA (LOC411614), mRNA
          Length = 1281

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 93   gaccaatggcacaacaatta 112
            ||||||||||||||||||||
Sbjct: 1214 gaccaatggcacaacaatta 1233



to top

>gb|AE004912.1| Pseudomonas aeruginosa PAO1, section 473 of 529 of the complete
            genome
          Length = 12498

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 311  cgcccttggccagggcctcg 330
            ||||||||||||||||||||
Sbjct: 5666 cgcccttggccagggcctcg 5685



to top

>gb|AY124521.1| Luzula acuminata ATPase F1 alpha subunit (atp1) gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 1235

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  catcatatataattaatgca 54
           ||||||||||||||||||||
Sbjct: 707 catcatatataattaatgca 688



to top

>gb|AF130358.2|AF130358 Homo sapiens chromosome 21q11.2 PAC 90B5, complete sequence
          Length = 197778

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 137   caaaaattaagggaaaacat 156
             ||||||||||||||||||||
Sbjct: 40577 caaaaattaagggaaaacat 40596



to top

>emb|AL929026.10| Mouse DNA sequence from clone RP23-332K7 on chromosome 2, complete
             sequence
          Length = 124244

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 282   gtaagtggccttgatggagg 301
             ||||||||||||||||||||
Sbjct: 64001 gtaagtggccttgatggagg 63982



to top

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 314     ccttggccagggcctcgaac 333
               ||||||||||||||||||||
Sbjct: 4157398 ccttggccagggcctcgaac 4157417



to top

>gb|AC140483.3| Mus musculus BAC clone RP24-145A22 from 1, complete sequence
          Length = 176649

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 5      taacatcaaatcatatatcatgaa 28
              |||||||||||||||| |||||||
Sbjct: 170528 taacatcaaatcatatctcatgaa 170551



to top

>gb|AF154918.1|AF154918 Ocimum basilicum caffeic acid O-methyltransferase (COMT2) mRNA,
           complete cds
          Length = 1187

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 345 cctctccctaccacctgggttgtgcgcgagcatgat 380
           ||||||| | |||||||||||||| || ||||||||
Sbjct: 995 cctctccttgccacctgggttgtgagccagcatgat 960



to top

>gb|AC006556.3|AC006556 Homo sapiens, clone hRPK.37_A_1, complete sequence
          Length = 156833

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 137   caaaaattaagggaaaacat 156
             ||||||||||||||||||||
Sbjct: 86222 caaaaattaagggaaaacat 86203



to top

>emb|AL132709.5|CNS01DTB Human chromosome 14 DNA sequence BAC R-909M7 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 200540

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 39     atatataattaatgcaacatttaa 62
              ||||||||||||||||| ||||||
Sbjct: 154212 atatataattaatgcaatatttaa 154189



to top

>dbj|AP001660.1| Homo sapiens genomic DNA, chromosome 21q, section 4/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 137    caaaaattaagggaaaacat 156
              ||||||||||||||||||||
Sbjct: 255530 caaaaattaagggaaaacat 255549



to top

>dbj|AP006736.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT45I15, TM1494,
            complete sequence
          Length = 114162

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 1    aatgtaacatcaaatcatatatca 24
            ||||||||||||||||| ||||||
Sbjct: 7053 aatgtaacatcaaatcagatatca 7076



to top

>dbj|AP006694.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT45A22, TM0400a,
             complete sequence
          Length = 94961

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 1     aatgtaacatcaaatcatatatca 24
             ||||||||||||||||| ||||||
Sbjct: 46187 aatgtaacatcaaatcagatatca 46210



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 1     aatgtaacatcaaatcatatatca 24
             ||||||||||||||||| ||||||
Sbjct: 38489 aatgtaacatcaaatcagatatca 38512



to top

>dbj|AP006667.1| Lotus japonicus genomic DNA, chromosome 5, clone:LjT31L14, TM0366,
             complete sequence
          Length = 100936

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 1     aatgtaacatcaaatcatatatca 24
             ||||||||||||||||| ||||||
Sbjct: 20283 aatgtaacatcaaatcagatatca 20306



to top

>dbj|AP006652.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT30M07, TM0331c,
             complete sequence
          Length = 56699

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 1     aatgtaacatcaaatcatatatca 24
             ||||||||||||||||| ||||||
Sbjct: 21830 aatgtaacatcaaatcagatatca 21853



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 1     aatgtaacatcaaatcatatatca 24
             ||||||||||||||||| ||||||
Sbjct: 14129 aatgtaacatcaaatcagatatca 14152



to top

>dbj|AP006634.1| Lotus japonicus genomic DNA, chromosome 5, clone:LjT15O18, TM0086,
             complete sequence
          Length = 133572

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 1     aatgtaacatcaaatcatatatca 24
             ||||||||||||||||| ||||||
Sbjct: 69659 aatgtaacatcaaatcagatatca 69682



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 1     aatgtaacatcaaatcatatatca 24
             ||||||||||||||||| ||||||
Sbjct: 63398 aatgtaacatcaaatcagatatca 63421



to top

>dbj|AP006366.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT35C03, TM0176a,
              complete sequence
          Length = 119525

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 1      aatgtaacatcaaatcatatatca 24
              ||||||||||||||||| ||||||
Sbjct: 102820 aatgtaacatcaaatcagatatca 102797



to top

>dbj|AP006093.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT47G03, TM0166,
            complete sequence
          Length = 97864

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 1    aatgtaacatcaaatcatatatca 24
            ||||||||||||||||| ||||||
Sbjct: 4739 aatgtaacatcaaatcagatatca 4762



to top

>dbj|AP004976.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT09L18, TM0159,
             complete sequence
          Length = 91722

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 1     aatgtaacatcaaatcatatatca 24
             ||||||||||||||||| ||||||
Sbjct: 50328 aatgtaacatcaaatcagatatca 50351



to top

>dbj|AP004965.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT20J05, TM0143b,
             complete sequence
          Length = 83991

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 1     aatgtaacatcaaatcatatatca 24
             ||||||||||||||||| ||||||
Sbjct: 66104 aatgtaacatcaaatcagatatca 66081



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 1     aatgtaacatcaaatcatatatca 24
             ||||||||||||||||| ||||||
Sbjct: 58293 aatgtaacatcaaatcagatatca 58270



to top

>dbj|AP004533.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT14G02, TM0080,
             complete sequence
          Length = 76730

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 1     aatgtaacatcaaatcatatatca 24
             ||||||||||||||||| ||||||
Sbjct: 67140 aatgtaacatcaaatcagatatca 67163



to top

>dbj|AP004516.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT04F23, TM0044b,
            complete sequence
          Length = 20786

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 1    aatgtaacatcaaatcatatatca 24
            ||||||||||||||||| ||||||
Sbjct: 5472 aatgtaacatcaaatcagatatca 5449



to top

>dbj|AP004509.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT16K17, TM0037a,
             complete sequence
          Length = 84322

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 1     aatgtaacatcaaatcatatatca 24
             ||||||||||||||||| ||||||
Sbjct: 79657 aatgtaacatcaaatcagatatca 79680



to top

>dbj|AP004487.1| Lotus japonicus genomic DNA, chromosome 5, clone:LjT05B20, TM0019b,
             complete sequence
          Length = 72735

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 1     aatgtaacatcaaatcatatatca 24
             ||||||||||||| ||||||||||
Sbjct: 56512 aatgtaacatcaattcatatatca 56489



to top

>dbj|AP004470.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT15D01, TM0004b,
             complete sequence
          Length = 28108

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 1     aatgtaacatcaaatcatatatca 24
             ||||||||||||||||| ||||||
Sbjct: 24391 aatgtaacatcaaatcagatatca 24368



to top

>dbj|AP004467.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT06K11, TM0002,
             complete sequence
          Length = 106023

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 5     taacatcaaatcatatatca 24
             ||||||||||||||||||||
Sbjct: 93804 taacatcaaatcatatatca 93785



to top

>gb|M16222.1|MZEMTATP Maize mitochondrial ATP-alpha gene encoding F1-ATPase alpha
           subunit, complete cds
          Length = 1742

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  catcatatataattaatgca 54
           ||||||||||||||||||||
Sbjct: 879 catcatatataattaatgca 860



to top

>emb|AL078615.2|HS98L15 Homo sapiens chromosome 21 PAC RPCIP704L1598Q2, complete sequence
          Length = 116189

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 137   caaaaattaagggaaaacat 156
             ||||||||||||||||||||
Sbjct: 66964 caaaaattaagggaaaacat 66983


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,367,872
Number of Sequences: 3902068
Number of extensions: 4367872
Number of successful extensions: 92313
Number of sequences better than 10.0: 145
Number of HSP's better than 10.0 without gapping: 145
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 91542
Number of HSP's gapped (non-prelim): 692
length of query: 486
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 464
effective length of database: 17,147,199,772
effective search space: 7956300694208
effective search space used: 7956300694208
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top