ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart36e12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ318884.1|TTU318884 Triticum turgidum subsp. durum xip-II g... 68 3e-08
2dbj|AB204556.1| Triticum aestivum Xip-III gene for xylanase inhi... 62 2e-06
3gb|AC165299.13| Mus musculus chromosome 15, clone RP23-266F2, co... 54 4e-04
4gb|AC167164.6| Mus musculus chromosome 7, clone RP24-276M8, comp... 54 4e-04
5gb|AC155300.2| Mus musculus BAC clone RP24-232D3 from chromosome... 54 4e-04
6gb|AC155235.2| Mus musculus BAC clone RP24-406H23 from chromosom... 54 4e-04
7gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence 54 4e-04
8gb|AC134795.10| Mus musculus chromosome 15, clone RP24-456M21, c... 54 4e-04
9gb|AY687385.1| Pelodiscus sinensis mitochondrion, complete genome 54 4e-04
10gb|AC102369.21| Mus musculus chromosome 12, clone RP23-246F14, c... 54 4e-04
11gb|AC101787.11| Mus musculus chromosome 1, clone RP24-147F6, com... 54 4e-04
12gb|AC118702.8| Mus musculus chromosome 5, clone RP24-166J1, comp... 54 4e-04
13gb|AC113098.12| Mus musculus chromosome 8, clone RP23-314K9, com... 54 4e-04
14gb|AC133648.3| Mus musculus BAC clone RP23-291B1 from chromosome... 54 4e-04
15emb|CR936412.13| Zebrafish DNA sequence from clone DKEY-181M21 i... 54 4e-04
16gb|AC123843.4| Mus musculus BAC clone RP23-407D18 from chromosom... 54 4e-04
17gb|AC122900.3| Mus musculus BAC clone RP23-39N24 from 15, comple... 54 4e-04
18emb|CR716376.2|CNS0GFPD Tetraodon nigroviridis full-length cDNA 54 4e-04
19gb|AC162899.5| Mus musculus chromosome 1, clone RP24-222G3, comp... 54 4e-04
20emb|AJ421451.1|LCA421451 Lemur catta mitochondrion complete mito... 54 4e-04
21gb|AC160536.4| Mus musculus chromosome 8, clone RP24-92K22, comp... 54 4e-04
22gb|AC151617.2| Emiliania huxleyi clone JGIACCU-13M3, complete se... 54 4e-04
23gb|AC010711.5| Drosophila melanogaster 3L BAC RP98-22D12 (Roswel... 54 4e-04
24gb|AC079617.5| Homo sapiens BAC clone RP11-623K14 from 4, comple... 54 4e-04
25gb|AC110911.18| Mus musculus chromosome 7, clone RP24-357A15, co... 54 4e-04
26gb|AC157567.6| Mus musculus chromosome 5, clone RP23-246I12, com... 54 4e-04
27gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 54 4e-04
28gb|AC091657.3| Rattus norvegicus strain Brown Norway clone RP31-... 54 4e-04
29gb|AC091710.3| Rattus norvegicus strain Brown Norway clone RP31-... 54 4e-04
30emb|CT571248.10| Mouse DNA sequence from clone RP24-355C16 on ch... 54 4e-04
31gb|AE003470.4| Drosophila melanogaster chromosome 3L, section 4 ... 54 4e-04
32emb|CT009765.9| Mouse DNA sequence from clone RP23-235B7 on chro... 54 4e-04
33gb|AC163446.2| Mus musculus chromosome 5, clone RP23-151G22, com... 54 4e-04
34emb|AL772402.5| Mouse DNA sequence from clone RP23-65J9 on chrom... 54 4e-04
35ref|NM_101931.2| Arabidopsis thaliana unknown protein AT1G20790 ... 52 0.002
36gb|U83904.1|HVU83904 Hordeum vulgare lipoxygenase isoenzyme 1 (L... 52 0.002
37gb|AC166648.4| Mus musculus chromosome 5, clone RP23-102C14, com... 52 0.002
38gb|AC113104.15| Mus musculus chromosome 18, clone RP23-321L15, c... 52 0.002
39gb|AC150413.2| Branchiostoma floridae clone CH302-61A17, complet... 52 0.002
40gb|AC158951.5| Mus musculus chromosome 8, clone RP23-265B11, com... 52 0.002
41gb|AC121946.3| Mus musculus BAC clone RP24-212F15 from chromosom... 52 0.002
42emb|AL353621.19| Human DNA sequence from clone RP11-490D19 on ch... 52 0.002
43emb|BX649331.16| Zebrafish DNA sequence from clone DKEY-12N3 in ... 52 0.002
44dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
45gb|AC069251.5|AC069251 Genomic sequence for Arabidopsis thaliana... 52 0.002
46gb|AC117729.9| Mus musculus chromosome 8, clone RP24-126M11, com... 52 0.002
47gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 52 0.002
48emb|BX000507.2|CNS08CDX Oryza sativa chromosome 12, . BAC OJ1003... 52 0.002
49gb|AC134457.4| Mus musculus BAC clone RP23-340O18 from 10, compl... 52 0.002
50gb|AC164300.3| Mus musculus BAC clone RP23-310J6 from chromosome... 50 0.006
51dbj|AP001980.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 50 0.006
52dbj|AP003460.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 50 0.006
53gb|AC110192.14| Mus musculus chromosome 7, clone RP23-227K15, co... 50 0.006
54emb|AL929214.6| Mouse DNA sequence from clone RP23-195I21 on chr... 50 0.006
55gb|AC166650.7| Mus musculus chromosome 5, clone RP23-434O9, comp... 48 0.025
56gb|AC101807.12| Mus musculus chromosome 18, clone RP24-251J22, c... 48 0.025
57gb|AC102735.9| Mus musculus chromosome 5, clone RP24-237I4, comp... 48 0.025
58gb|AC161580.12| Mus musculus chromosome 3, clone RP23-422D10, co... 48 0.025
59gb|AC166649.5| Mus musculus chromosome 5, clone RP23-379D24, com... 48 0.025
60ref|NM_193094.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.025
61gb|AC147263.3| Mus musculus BAC clone RP24-213I13 from chromosom... 48 0.025
62gb|AC142270.4| Mus musculus BAC clone RP24-115G23 from chromosom... 48 0.025
63gb|AC091268.2| Rattus norvegicus strain Brown Norway clone RP31-... 48 0.025
64gb|AC163328.6| Mus musculus chromosome 5, clone RP24-405J8, comp... 48 0.025
65gb|AC122008.4| Mus musculus BAC clone RP24-344F8 from chromosome... 48 0.025
66gb|AC124483.4| Mus musculus BAC clone RP24-127J3 from chromosome... 48 0.025
67gb|AC125277.1| Mus musculus BAC clone RP24-554P24 from 13, compl... 48 0.025
68gb|AC109805.8| Mus musculus chromosome 3, clone RP23-91D14, comp... 48 0.025
69gb|AC135605.25| Medicago truncatula clone mth2-7m1, complete seq... 48 0.025
70gb|AC124964.17| Medicago truncatula clone mth2-27c4, complete se... 48 0.025
71gb|AC165165.3| Mus musculus BAC clone RP23-121B15 from chromosom... 48 0.025
72gb|AC113633.5| Rattus norvegicus 4 BAC CH230-350N19 (Children's ... 48 0.025
73emb|AJ422119.1|TAE422119 Triticum aestivum mRNA for xylanase inh... 48 0.025
74gb|AC013549.9| Homo sapiens chromosome 11, clone RP11-47J17, com... 48 0.025
75dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.025
76gb|DP000027.1| Rattus norvegicus target 1 genomic scaffold 48 0.025
77dbj|AK111717.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.025
78dbj|AP004339.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.025
79emb|X95927.1|RNCFTR7 R.norvegicus CFTR gene 48 0.025
80gb|AC154614.3| Mus musculus BAC clone RP23-255I2 from chromosome... 48 0.025
81gb|AC151998.6| Mus musculus BAC clone RP23-98L16 from chromosome... 48 0.025
82emb|CT030152.4| Mouse DNA sequence from clone RP24-323G18 on chr... 48 0.025
83gb|AC168210.13| Mus musculus chromosome 5, clone RP24-72J20, com... 48 0.025
84gb|AC163685.4| Mus musculus BAC clone RP23-4M16 from chromosome ... 48 0.025
85gb|AC109147.19| Mus musculus chromosome 8, clone RP23-341D16, co... 46 0.100
86gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, c... 46 0.100
87gb|AC115968.10| Mus musculus chromosome 1, clone RP24-72P6, comp... 46 0.100
88gb|AC007928.7| Drosophila melanogaster clone BACR04O02, complete... 46 0.100
89gb|AC132440.3| Mus musculus BAC clone RP23-239I24 from chromosom... 46 0.100
90gb|AC115064.9| Mus musculus chromosome 1, clone RP24-401B18, com... 46 0.100
91gb|AC129561.13| Mus musculus chromosome 1, clone RP23-192P10, co... 46 0.100
92gb|AC147546.1| Rattus norvegicus chromosome 1 clone RP32-323A19 ... 46 0.100
93gb|AC130541.4| Mus musculus BAC clone RP24-124P9 from chromosome... 46 0.100
94gb|AC132430.3| Mus musculus BAC clone RP23-208D22 from chromosom... 46 0.100
95gb|AC124429.4| Mus musculus BAC clone RP24-239N4 from chromosome... 46 0.100
96gb|AC114817.3| Mus musculus BAC clone RP23-28O15 from 14, comple... 46 0.100
97gb|AC104102.4| Mus musculus BAC clone RP24-377I13 from 15, compl... 46 0.100
98gb|AC162946.4| Mus musculus BAC clone RP23-38M11 from chromosome... 46 0.100
99emb|AJ627388.1| Yersinia pseudotuberculosis adhesion pathogenici... 46 0.100
100emb|AL671990.5| Mouse DNA sequence from clone RP23-41A24 on chro... 46 0.100
101emb|BX647858.1|HSM808004 Homo sapiens genomic DNA; cDNA DKFZp313... 46 0.100
102emb|AL845158.5| Mouse DNA sequence from clone RP23-147E6 on chro... 46 0.100
103gb|AC022018.10| Homo sapiens chromosome 10 clone RP11-214N15, co... 46 0.100
104gb|AC107326.4| Drosophila melanogaster X BAC RP98-33A8 (Roswell ... 46 0.100
105gb|AC009126.2| Homo sapiens chromosome 5 clone RP11-496M2, compl... 46 0.100
106gb|AC092239.1|AC092239 Drosophila melanogaster, chromosome 2L, r... 46 0.100
107gb|AC008906.5|AC008906 Homo sapiens chromosome 5 clone CTD-2260A... 46 0.100
108gb|AC061965.16| Homo sapiens chromosome 15, clone RP11-37J13, co... 46 0.100
109gb|AC104417.14| Homo sapiens chromosome 8, clone RP11-953B20, co... 46 0.100
110gb|AC009073.8|AC009073 Homo sapiens chromosome 16 clone RP11-31O... 46 0.100
111emb|AL844579.10| Mouse DNA sequence from clone RP23-219M22 on ch... 46 0.100
112gb|AC154311.2| Mus musculus BAC clone RP23-359C9 from 16, comple... 46 0.100
113emb|BX469898.9| Zebrafish DNA sequence from clone DKEY-180H12 in... 46 0.100
114gb|AC110033.9| Mus musculus chromosome 1, clone RP23-117O18, com... 46 0.100
115gb|AC102758.10| Mus musculus chromosome 7, clone RP24-200F21, co... 46 0.100
116gb|AE003704.3| Drosophila melanogaster chromosome 3R, section 42... 46 0.100
117gb|AE003611.3| Drosophila melanogaster chromosome 2L, section 20... 46 0.100
118gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 o... 46 0.100
119gb|AC108796.10| Mus musculus chromosome 1, clone RP23-349L18, co... 46 0.100
120gb|AC140839.9| Mus musculus chromosome 3, clone RP24-316D12, com... 46 0.100
121gb|AC159965.5| Mus musculus chromosome 15, clone RP23-471C16, co... 46 0.100
122gb|AC158587.3| Mus musculus chromosome 7, clone RP24-156F13, com... 46 0.100
123gb|AC171680.5| Mus musculus chromosome 7, clone RP23-146B24, com... 46 0.100
124emb|AL671935.30| Mouse DNA sequence from clone RP23-421J13 on ch... 46 0.100
125emb|AL591417.9| Mouse DNA sequence from clone RP23-272C1 on chro... 46 0.100
126gb|AC005333.1|AC005333 Drosophila melanogaster DNA sequence (P1s... 46 0.100
127emb|AL713918.22| Mouse DNA sequence from clone RP23-350D7 on chr... 46 0.100
128gb|AC151735.3| Mus musculus BAC clone RP23-24D16 from 9, complet... 46 0.100
129gb|AC122908.4| Mus musculus BAC clone RP23-51D10 from 1, complet... 46 0.100
130gb|AC154344.1| Mus musculus BAC clone RP23-226G16 from 16, compl... 46 0.100
131emb|AL713990.16| Mouse DNA sequence from clone RP23-224N1 on chr... 46 0.100
132gb|DQ221252.1| Tetraodon nigroviridis voltage-gated sodium chann... 46 0.100
133gb|AC167022.4| Mus musculus BAC clone RP23-183A4 from chromosome... 46 0.100
134emb|AL845280.4| Mouse DNA sequence from clone RP23-265L1 on chro... 46 0.100
135emb|AL626774.23| Mouse DNA sequence from clone RP23-198O15 on ch... 46 0.100
136gb|AC140979.17| Mus musculus chromosome 1, clone RP23-307M11, co... 46 0.100
137emb|AL021067.1|DMC123F11 Drosophila melanogaster cosmid clone 12... 46 0.100
138gb|AC110560.11| Mus musculus chromosome 3, clone RP23-254K1, com... 44 0.39
139gb|AC161269.4| Mus musculus BAC clone RP23-120K16 from chromosom... 44 0.39
140gb|AC101716.6| Mus musculus chromosome 7, clone RP23-287I20, com... 44 0.39
141gb|AC161480.9| Mus musculus chromosome 15, clone RP23-404I10, co... 44 0.39
142gb|AC008097.5| Drosophila melanogaster clone BACR20D06, complete... 44 0.39
143gb|AC148336.4| Mus musculus BAC clone RP23-21J15 from chromosome... 44 0.39
144gb|DQ415921.1| Cleome spinosa clone BAC Cs2, complete sequence 44 0.39
145gb|AC162459.2| Mus musculus chromosome 3, clone RP23-80A8, compl... 44 0.39
146gb|AC156620.10| Mus musculus chromosome 5, clone RP23-80G18, com... 44 0.39
147gb|AC109204.21| Mus musculus chromosome 17, clone RP23-55J9, com... 44 0.39
148gb|AC165344.3| Mus musculus BAC clone RP23-390P7 from chromosome... 44 0.39
149gb|AC129567.8| Mus musculus chromosome 8, clone RP23-50L10, comp... 44 0.39
150gb|AC101796.8| Mus musculus chromosome 1, clone RP24-206P18, com... 44 0.39
151gb|AC139940.5| Mus musculus chromosome 15, clone RP23-468K16, co... 44 0.39
152gb|AC138093.7| Mus musculus chromosome 16, clone RP24-559J21, co... 44 0.39
153gb|AC107667.12| Mus musculus chromosome 3, clone RP23-187C2, com... 44 0.39
154emb|CT009736.8| Mouse DNA sequence from clone RP23-99F22 on chro... 44 0.39
155gb|AC124728.5| Mus musculus BAC clone RP23-470C22 from chromosom... 44 0.39
156gb|AC138768.3| Mus musculus BAC clone RP24-465E14 from chromosom... 44 0.39
157gb|AC114821.4| Mus musculus BAC clone RP23-72K1 from chromosome ... 44 0.39
158gb|AC122184.4| Mus musculus BAC clone RP23-16C12 from chromosome... 44 0.39
159gb|AC127290.3| Mus musculus BAC clone RP23-364F13 from chromosom... 44 0.39
160gb|AC124184.3| Mus musculus BAC clone RP23-227N23 from 10, compl... 44 0.39
161gb|AC121857.2| Mus musculus BAC clone RP24-98A9 from 1, complete... 44 0.39
162gb|AC113316.14| Mus musculus chromosome 5, clone RP23-441I24, co... 44 0.39
163gb|AC021218.9| Homo sapiens BAC clone RP11-525O1 from 7, complet... 44 0.39
164ref|XM_728614.1| Plasmodium chabaudi chabaudi hypothetical prote... 44 0.39
165gb|AC102409.10| Mus musculus chromosome 18, clone RP24-365B20, c... 44 0.39
166gb|AC164001.4| Mus musculus chromosome 7, clone RP23-332G12, com... 44 0.39
167gb|AC122167.8| Medicago truncatula clone mth1-10d10, complete se... 44 0.39
168gb|AC163994.4| Mus musculus chromosome 1, clone RP24-132H2, comp... 44 0.39
169emb|Z81008.1|HS369O24 Human DNA sequence from clone RP3-369O24 o... 44 0.39
170gb|AC158571.3| Mus musculus chromosome 3, clone RP23-117E23, com... 44 0.39
171gb|AC158575.3| Mus musculus chromosome 7, clone RP23-275H16, com... 44 0.39
172gb|AC117661.20| Mus musculus chromosome 6, clone RP23-343P1, com... 44 0.39
173gb|AC162391.9| Mus musculus 6 BAC RP23-126H2 (Roswell Park Cance... 44 0.39
174emb|AL646096.8| Mouse DNA sequence from clone RP23-176J13 on chr... 44 0.39
175gb|AC078925.18| Homo sapiens 12q BAC RP11-76C10 (Roswell Park Ca... 44 0.39
176emb|AL714006.13| Mouse DNA sequence from clone RP23-173E15 on ch... 44 0.39
177gb|AC113029.23| Mus musculus chromosome 5, clone RP23-206J17, co... 44 0.39
178gb|AC155270.3| Mus musculus BAC clone RP23-195H19 from chromosom... 44 0.39
179gb|AC009779.18| Homo sapiens 12 BAC RP11-644F5 (Roswell Park Can... 44 0.39
180emb|AL928605.22| Mouse DNA sequence from clone RP23-139P14 on ch... 44 0.39
181gb|AC008603.7| Homo sapiens chromosome 5 clone CTB-107P3, comple... 44 0.39
182gb|AC104340.10| Mus musculus chromosome 7, clone RP24-495M13, co... 44 0.39
183gb|AC099012.1| Drosophila melanogaster, chromosome 2R, region 56... 44 0.39
184gb|AC092752.2| Genomic sequence for Mus musculus, clone RP23-51O... 44 0.39
185gb|AC149206.2| Medicago truncatula chromosome 2 BAC clone mte1-4... 44 0.39
186dbj|AK043643.1| Mus musculus 10 days neonate cortex cDNA, RIKEN ... 44 0.39
187dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.39
188gb|AY843546.1| Acacia brevispica microsatellite Ab15 sequence 44 0.39
189gb|AC100738.8| Mus musculus chromosome 15, clone RP24-362K21, co... 44 0.39
190gb|AC155817.2| Mus musculus BAC clone RP23-473M8 from chromosome... 44 0.39
191gb|AC156015.2| Mus musculus BAC clone RP24-345H1 from chromosome... 44 0.39
192gb|AC007559.3| Homo sapiens BAC clone RP11-364J6 from 2, complet... 44 0.39
193gb|AC012074.9| Homo sapiens BAC clone RP11-458N5 from 2, complet... 44 0.39
194gb|AC139849.5| Mus musculus BAC clone RP23-84M17 from chromosome... 44 0.39
195dbj|AP004622.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.39
196emb|BX294656.8| Zebrafish DNA sequence from clone CH211-238M13, ... 44 0.39
197gb|AC154342.2| Mus musculus BAC clone RP23-227D10 from 17, compl... 44 0.39
198gb|AC154244.2| Mus musculus BAC clone RP24-321P20 from 17, compl... 44 0.39
199gb|AC122362.5| Mus musculus BAC clone RP23-430N1 from chromosome... 44 0.39
200gb|AC150560.5| Mus musculus BAC clone RP23-16I14 from 15, comple... 44 0.39
201gb|AC154438.2| Mus musculus BAC clone RP23-178P20 from 16, compl... 44 0.39
202gb|AC122495.4| Mus musculus BAC clone RP24-397P10 from 9, comple... 44 0.39
203gb|AC102012.7| Mus musculus chromosome 3, clone RP24-542B2, comp... 44 0.39
204gb|AC105335.27| Mus musculus chromosome 5, clone RP23-377H14, co... 44 0.39
205gb|AC007189.6|AC007189 Homo sapiens, clone 19_A_8, complete sequ... 44 0.39
206gb|AC174449.2| Mus musculus BAC clone RP23-338O19 from chromosom... 44 0.39
207gb|AE003793.3| Drosophila melanogaster chromosome 2R, section 57... 44 0.39
208emb|AL359220.4|CNS05TEI Human chromosome 14 DNA sequence BAC R-8... 44 0.39
209emb|AL049838.3|CNS0000C Human chromosome 14 DNA sequence BAC R-9... 44 0.39
210emb|BX629359.1|CNS09SBT Tetraodon nigroviridis BAC sequence 44 0.39
211gb|AC116703.10| Mus musculus chromosome 6, clone RP23-16O17, com... 44 0.39
212gb|AC121139.20| Mus musculus chromosome 5, clone RP23-429G1, com... 44 0.39
213emb|AL691450.15| Mouse DNA sequence from clone RP23-20F9 on chro... 44 0.39
214gb|AC005286.1|AC005286 Drosophila melanogaster DNA sequence (P1s... 44 0.39
215gb|AC140553.3| Mus musculus BAC clone RP24-71M17 from 1, complet... 44 0.39
216gb|AC127270.4| Mus musculus BAC clone RP23-453E16 from 12, compl... 44 0.39
217gb|AC153819.5| Mus musculus 6 BAC RP23-445H14 (Roswell Park Canc... 44 0.39
218emb|CT025592.14| Mouse DNA sequence from clone RP23-431J17 on ch... 44 0.39
219gb|AC170594.2| Mus musculus BAC clone RP24-425N5 from chromosome... 44 0.39
220emb|AL772220.7| Mouse DNA sequence from clone RP23-409N18 on chr... 44 0.39
221emb|AL844900.3| Mouse DNA sequence from clone RP23-301L16 on chr... 44 0.39
222gb|M23926.1|MUSIFN6A Mus musculus (clone pKK22) interferon-alpha... 44 0.39
223emb|AL671269.11| Mouse DNA sequence from clone RP23-143P22 on ch... 44 0.39
224emb|AL772374.9| Mouse DNA sequence from clone RP23-27I23 on chro... 44 0.39
225emb|AL805969.13| Mouse DNA sequence from clone RP23-40L1 on chro... 44 0.39
226emb|AL355792.8| Human DNA sequence from clone RP5-1123F10 on chr... 44 0.39
227emb|AL606498.17| Mouse DNA sequence from clone RP23-197C15 on ch... 44 0.39
228gb|AC022346.4| Drosophila melanogaster clone BACR22I24, complete... 42 1.6
229gb|AC161376.2| Mus musculus BAC clone RP23-264M10 from chromosom... 42 1.6
230gb|AC102656.28| Mus musculus chromosome 5, clone RP23-15G1, comp... 42 1.6
231gb|AC154844.2| Mus musculus BAC clone RP23-46K13 from chromosome... 42 1.6
232gb|AC117807.7| Mus musculus chromosome 8, clone RP24-568P2, comp... 42 1.6
233gb|AC139025.9| Mus musculus chromosome 8, clone RP23-426K13, com... 42 1.6
234gb|AC165961.2| Mus musculus BAC clone RP23-378M19 from chromosom... 42 1.6
235gb|AC168275.4| Mus musculus 10 BAC RP23-350O21 (Roswell Park Can... 42 1.6
236gb|AC168276.3| Mus musculus BAC RP24-485I12 (Roswell Park Cance... 42 1.6
237gb|AC118021.13| Mus musculus chromosome 7, clone RP23-459P15, co... 42 1.6
238gb|AC166370.3| Mus musculus BAC clone RP23-20I24 from chromosome... 42 1.6
239gb|AC166368.3| Mus musculus BAC clone RP23-63I1 from chromosome ... 42 1.6
240gb|AC167241.2| Mus musculus BAC clone RP24-560M14 from chromosom... 42 1.6
241gb|AC161536.7| Mus musculus chromosome 5, clone RP23-340A18, com... 42 1.6
242ref|XM_991783.1| PREDICTED: Mus musculus centrosomal protein 164... 42 1.6
243gb|AC107230.8| Mus musculus chromosome 18, clone RP23-238L23, co... 42 1.6
244gb|AC109269.17| Mus musculus chromosome 1, clone RP23-325F17, co... 42 1.6
245emb|AJ418636.1|SAU418636 Sparus aurata satellite DNA, clone SAdi... 42 1.6
246emb|AJ865197.1| Cocos nucifera microsatellite DNA, clone CnCir 96 42 1.6
247ref|XM_387353.1| Gibberella zeae PH-1 chromosome 4 hypothetical ... 42 1.6
248gb|AC126055.4| Mus musculus BAC clone RP23-368O6 from chromosome... 42 1.6
249gb|AC115825.11| Mus musculus chromosome 9, clone RP23-444E13, co... 42 1.6
250gb|AC109179.7| Mus musculus chromosome 18, clone RP23-382N7, com... 42 1.6
251gb|AC155315.6| Mus musculus BAC clone RP23-212F18 from chromosom... 42 1.6
252gb|AC112683.10| Mus musculus chromosome 17, clone RP23-332P1, co... 42 1.6
253emb|AL391601.6| Human DNA sequence from clone RP11-551D9 on chro... 42 1.6
254emb|AL357354.10| Human DNA sequence from clone RP11-465C5 on chr... 42 1.6
255gb|AC010053.7| Drosophila melanogaster 3L BAC RP98-6H19 (Roswell... 42 1.6
256emb|AL138972.1|DMBR25B3 Drosophila melanogaster BAC clone BACR25B3 42 1.6
257emb|AL031154.1|SPBC1685 S.pombe chromosome II cosmid c1685 42 1.6
258gb|AC154393.8| Mus musculus chromosome 1, clone RP23-64O1, compl... 42 1.6
259gb|AC104140.5| Drosophila melanogaster X BAC RP98-9H13 (Roswell ... 42 1.6
260gb|AC104054.6| Drosophila melanogaster X BAC RP98-21G11 (Roswell... 42 1.6
261gb|AF453501.1| Actinosynnema pretiosum subsp. auranticum maytans... 42 1.6
262gb|AC010033.8| Drosophila melanogaster 3L BAC RP98-3I5 (Roswell ... 42 1.6
263gb|AC170742.3| Sorex araneus clone SA_Ba-580J7, complete sequence 42 1.6
264gb|AC100795.2| Homo sapiens chromosome 18, clone RP11-956K8, com... 42 1.6
265gb|AC112031.4| Rattus norvegicus BAC CH230-99K18 (Children's Ho... 42 1.6
266gb|AC008099.5| Drosophila melanogaster, chromosome 2L, region 25... 42 1.6
267gb|BC027092.1| Mus musculus centrosomal protein 164, mRNA (cDNA ... 42 1.6
268gb|AC007158.10|AC007158 Homo sapiens, clone RP11-90A1, complete ... 42 1.6
269gb|AC160137.2| Mus musculus BAC clone RP23-136A1 from chromosome... 42 1.6
270gb|AC154572.2| Mus musculus BAC clone RP23-392G15 from chromosom... 42 1.6
271gb|AC154505.3| Mus musculus BAC clone RP24-92J14 from chromosome... 42 1.6
272gb|AC159229.2| Mus musculus BAC clone RP24-351I2 from chromosome... 42 1.6
273gb|AC159741.2| Mus musculus BAC clone RP23-178B21 from chromosom... 42 1.6
274gb|AC152449.4| Mus musculus BAC clone RP24-560O24 from chromosom... 42 1.6
275gb|AC009058.10| Homo sapiens chromosome 16 clone RP11-292B23, co... 42 1.6
276gb|AC007092.4| Homo sapiens BAC clone RP11-90D1 from 2, complete... 42 1.6
277gb|AC132956.4| Mus musculus BAC clone RP23-106K20 from chromosom... 42 1.6
278gb|AC009024.6|AC009024 Homo sapiens chromosome 16 clone RP11-112... 42 1.6
279gb|AC145294.4| Mus musculus BAC clone RP23-88B16 from 7, complet... 42 1.6
280gb|AC149278.3| Mus musculus BAC clone RP24-101G17 from 7, comple... 42 1.6
281emb|BX511203.3| Rattus norvegicus chromosome 1 clone RN-79C10, c... 42 1.6
282gb|AC156387.5| Mus musculus 10 BAC RP24-396H15 (Roswell Park Can... 42 1.6
283gb|AE003575.5| Drosophila melanogaster chromosome 2L, section 16... 42 1.6
284gb|AE003544.4| Drosophila melanogaster chromosome 3L, section 41... 42 1.6
285gb|AE003496.4| Drosophila melanogaster chromosome X, section 48 ... 42 1.6
286emb|AL049775.2|CNS00006 Human chromosome 14 DNA sequence BAC R-4... 42 1.6
287gb|AE003424.2| Drosophila melanogaster chromosome X, section 8 o... 42 1.6
288gb|AC159104.2| Mus musculus BAC clone RP23-246E2 from chromosome... 42 1.6
289gb|AC115809.8| Mus musculus chromosome 8, clone RP23-416L3, comp... 42 1.6
290emb|AL805963.23| Mouse DNA sequence from clone RP23-98K7 on chro... 42 1.6
291gb|AC119921.12| Mus musculus chromosome 12, clone RP24-252B23, c... 42 1.6
292emb|AL845318.8| Mouse DNA sequence from clone RP23-326F22 on chr... 42 1.6
293gb|AC149596.2| Mus musculus BAC clone RP24-424J20 from 7, comple... 42 1.6
294gb|AC126804.3| Mus musculus BAC clone RP23-3F1 from 9, complete ... 42 1.6
295gb|AC126049.3| Mus musculus BAC clone RP23-224I16 from 1, comple... 42 1.6
296gb|AC169084.3| Mus musculus BAC clone RP24-427O13 from chromosom... 42 1.6
297emb|AL672239.8| Mouse DNA sequence from clone RP23-144D15 on chr... 42 1.6
298emb|AL831752.7| Mouse DNA sequence from clone RP23-414J22 on chr... 42 1.6
299emb|AL807400.9| Mouse DNA sequence from clone RP23-196A4 on chro... 42 1.6
300emb|AL591763.14| Mouse DNA sequence from clone RP23-480D17 on ch... 42 1.6
301gb|AC154262.1| Mus musculus chromosome 14 clone RP24-304G19, com... 40 6.2
302gb|AC154093.1| Homo sapiens chromosome 13 clone fa0790, complete... 40 6.2
303gb|AC123656.9| Mus musculus chromosome 15, clone RP23-188M21, co... 40 6.2
304gb|AC124333.13| Mus musculus chromosome 1, clone RP24-511E9, com... 40 6.2
305gb|AC138300.8| Mus musculus chromosome 14, clone RP23-187B20, co... 40 6.2
306gb|AY486602.1| Hevea brasiliensis clone mHbCIRa380 microsatellit... 40 6.2
307gb|AC161108.2| Mus musculus chromosome 1, clone RP23-224G12, com... 40 6.2
308gb|AC113039.10| Mus musculus chromosome 1, clone RP23-229P20, co... 40 6.2
309gb|CP000017.1| Streptococcus pyogenes MGAS5005, complete genome 40 6.2
310gb|AC165080.4| Mus musculus BAC clone RP24-93F20 from chromosome... 40 6.2
311gb|AC154194.2| Mus musculus BAC clone RP24-401L2 from chromosome... 40 6.2
312gb|AC120555.9| Mus musculus chromosome 12, clone RP24-311D18, co... 40 6.2
313gb|AC111620.5| Rattus norvegicus 2 BAC CH230-123K4 (Children's H... 40 6.2
314gb|AC091453.2| Mus musculus chromosome X clones RP21-19N11, RP21... 40 6.2
315gb|CP000003.1| Streptococcus pyogenes MGAS10394, complete genome 40 6.2
316gb|AC124322.7| Mus musculus chromosome 7, clone RP24-330M21, com... 40 6.2
317gb|AE006511.1| Streptococcus pyogenes M1 GAS, section 40 of 167 ... 40 6.2
318gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 40 6.2
319gb|AC147502.2| Mus musculus BAC clone RP23-111N9 from chromosome... 40 6.2
320gb|CP000262.1| Streptococcus pyogenes MGAS10750, complete genome 40 6.2
321gb|CP000261.1| Streptococcus pyogenes MGAS2096, complete genome 40 6.2
322gb|CP000260.1| Streptococcus pyogenes MGAS10270, complete genome 40 6.2
323gb|CP000259.1| Streptococcus pyogenes MGAS9429, complete genome 40 6.2
324gb|AC138110.3| Mus musculus BAC clone RP24-363O16 from chromosom... 40 6.2
325gb|AC168270.1| Mus musculus BAC clone RP23-173C15 from chromosom... 40 6.2
326gb|AC167723.3| Mus musculus BAC RP23-297A10 (Roswell Park Cance... 40 6.2
327gb|AC153597.13| Mus musculus 6 BAC RP23-18K9 (Roswell Park Cance... 40 6.2
328gb|AC139863.5| Mus musculus chromosome 14, clone RP23-19M21, com... 40 6.2
329gb|AC095326.9| Rattus norvegicus 1 BAC CH230-89E14 (Children's H... 40 6.2
330emb|CR352310.15| Zebrafish DNA sequence from clone CH211-254E10 ... 40 6.2
331emb|AL954205.1| Pan troglodytes chromosome 22 clone RP43-046M07 ... 40 6.2
332emb|AJ578565.1|EGU578565 Elaeis guineensis microsatellite DNA, c... 40 6.2
333gb|AC146577.2| Pan troglodytes BAC clone CH251-189A13 from Y, co... 40 6.2
334gb|AC113056.26| Mus musculus chromosome 1, clone RP23-252F11, co... 40 6.2
335gb|AC121833.3| Mus musculus BAC clone RP24-69C16 from chromosome... 40 6.2
336gb|AC132109.3| Mus musculus BAC clone RP24-172E19 from chromosom... 40 6.2
337gb|AC115290.5| Mus musculus BAC clone RP23-65M10 from chromosome... 40 6.2
338gb|AC124536.4| Mus musculus BAC clone RP23-332H4 from chromosome... 40 6.2
339emb|CR388124.15| Zebrafish DNA sequence from clone CH211-72C8 in... 40 6.2
340gb|AC137948.12| Mus musculus chromosome 1, clone RP23-393D20, co... 40 6.2
341emb|Z68121.1|CET24D3 Caenorhabditis elegans Cosmid T24D3, comple... 40 6.2
342emb|Z50873.1|CEF17E5 Caenorhabditis elegans Cosmid F17E5, comple... 40 6.2
343gb|AC122057.3| Mus musculus BAC clone RP24-468F14 from chromosom... 40 6.2
344gb|AC121971.3| Mus musculus BAC clone RP24-275H22 from chromosom... 40 6.2
345gb|AC125093.4| Mus musculus BAC clone RP24-176F8 from chromosome... 40 6.2
346gb|AC104095.4| Mus musculus BAC clone RP23-403G12 from chromosom... 40 6.2
347gb|AC125207.5| Mus musculus BAC clone RP23-220C16 from 8, comple... 40 6.2
348emb|CR925759.7| Wallaby DNA sequence from clone MEKBa-346C2, com... 40 6.2
349gb|AC124753.3| Mus musculus BAC clone RP23-284J4 from 9, complet... 40 6.2
350emb|CR936483.10| Human DNA sequence from clone DAAP-35D11 on chr... 40 6.2
351gb|AC108949.4| Mus musculus BAC clone RP23-451K2 from 6, complet... 40 6.2
352gb|AC121872.2| Mus musculus BAC clone RP24-122E10 from 12, compl... 40 6.2
353ref|XM_739708.1| Plasmodium chabaudi chabaudi hypothetical prote... 40 6.2
354gb|AC102092.7| Mus musculus chromosome 3, clone RP23-20B1, compl... 40 6.2
355gb|AC153489.7| Mus musculus 10 BAC RP23-95A4 (Roswell Park Cance... 40 6.2
356gb|CP000056.1| Streptococcus pyogenes MGAS6180, complete genome 40 6.2
357gb|AC159816.2| Mus musculus BAC clone RP23-321A19 from chromosom... 40 6.2
358gb|AC124360.5| Mus musculus BAC clone RP24-502M22 from chromosom... 40 6.2
359emb|BX927314.11| Zebrafish DNA sequence from clone DKEYP-88H4 in... 40 6.2
360emb|BX000688.11| Human DNA sequence from clone DAQB-36F16 on chr... 40 6.2
361emb|AL662826.11| Human DNA sequence from clone XXbac-101I20 on c... 40 6.2
362emb|AL645936.5| Human DNA sequence from clone XXbac-126D10 on ch... 40 6.2
363emb|AL391665.28| Human DNA sequence from clone RP11-519K18 on ch... 40 6.2
364emb|AL359649.8| Human DNA sequence from clone RP11-65D24 on chro... 40 6.2
365gb|AC108527.6| Rattus norvegicus 9 BAC CH230-7F11 (Children's Ho... 40 6.2
366emb|AL353896.12| Human DNA sequence from clone RP11-390J12 on ch... 40 6.2
367emb|AL136461.10| Human DNA sequence from clone RP11-32G22 on chr... 40 6.2
368gb|AC161231.7| Mus musculus chromosome 5, clone RP24-241P24, com... 40 6.2
369gb|AC162180.2| Mus musculus BAC clone RP23-126K16 from chromosom... 40 6.2
370emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 40 6.2
371gb|BC094506.1| Mus musculus mucin 15, mRNA (cDNA clone MGC:10627... 40 6.2
372gb|BC038066.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:348... 40 6.2
373gb|BC020027.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:366... 40 6.2
374gb|BC048853.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:515... 40 6.2
375gb|BC055469.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:402... 40 6.2
376emb|AL731853.9| Mouse DNA sequence from clone RP23-128G5 on chro... 40 6.2
377emb|CR407571.9| Zebrafish DNA sequence from clone CH211-140C16 i... 40 6.2
378emb|AL606520.16| Mouse DNA sequence from clone RP23-280G18 on ch... 40 6.2
379emb|AL662792.21| Mouse DNA sequence from clone RP23-52L14 on chr... 40 6.2
380emb|CR759766.5| Human DNA sequence from clone DAMA-BMC177C8 on c... 40 6.2
381emb|CR450726.6| Zebrafish DNA sequence from clone CH211-149F21 i... 40 6.2
382emb|BX842611.2| Mouse DNA sequence from clone RP23-57L17 on chro... 40 6.2
383emb|CR457461.7| Zebrafish DNA sequence from clone DKEY-23O10 in ... 40 6.2
384gb|AC009121.8| Homo sapiens chromosome 16 clone RP11-485G7, comp... 40 6.2
385emb|CR759870.6| Human DNA sequence from clone DADB-225M10 on chr... 40 6.2
386emb|CR388210.7| Human DNA sequence from clone DAMA-186H17 on chr... 40 6.2
387gb|AC024375.13| Homo sapiens chromosome 15, clone RP11-572A8, co... 40 6.2
388dbj|BS000621.1| Pan troglodytes chromosome Y clone:PTBY-001L21, ... 40 6.2
389gb|AC022825.9| Homo sapiens chromosome 8, clone RP11-88J22, comp... 40 6.2
390emb|BX537453.3|RN86L3 Rattus norvegicus chromosome 1 BAC RP32-86... 40 6.2
391gb|AC091201.4| Drosophila melanogaster 3L BAC RP98-47H5 (Roswell... 40 6.2
392gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 40 6.2
393gb|AC010715.6| Drosophila melanogaster 3L BAC RP98-9G21 (Roswell... 40 6.2
394gb|AC108695.2| Homo sapiens 3 BAC RP11-744C8 (Roswell Park Cance... 40 6.2
395gb|AE009996.1| Streptococcus pyogenes strain MGAS8232, section 4... 40 6.2
396gb|AC098976.2| Homo sapiens BAC clone RP11-751L19 from 4, comple... 40 6.2
397gb|AC021979.6| Homo sapiens chromosome 15, clone RP11-30G8, comp... 40 6.2
398gb|AC010837.2| Homo sapiens chromosome 18, clone RP11-307E5, com... 40 6.2
399gb|CP000249.1| Frankia sp. CcI3, complete genome 40 6.2
400gb|DP000052.1| Sus scrofa target 126 genomic scaffold 40 6.2
401gb|AC006137.3|AC006137 Homo sapiens clone SCb-254N2 (UWGC:rg254N... 40 6.2
402gb|AC012097.8| Drosophila melanogaster, chromosome X, region 16F... 40 6.2
403gb|AC120137.16| Mus musculus chromosome 5, clone RP23-280O16, co... 40 6.2
404gb|AC158533.2| Mus musculus BAC clone RP23-107I15 from chromosom... 40 6.2
405gb|AC153361.5| Mus musculus BAC clone RP23-291L20 from chromosom... 40 6.2
406gb|AC157594.4| Mus musculus BAC clone RP23-279A2 from chromosome... 40 6.2
407gb|AC093049.1| Drosophila melanogaster, chromosome 2R, region 45... 40 6.2
408gb|AC156832.2| Mus musculus BAC clone RP24-212B22 from chromosom... 40 6.2
409gb|AC159628.2| Mus musculus BAC clone RP24-206C4 from chromosome... 40 6.2
410gb|AC157475.2| Mus musculus BAC clone RP24-243F19 from chromosom... 40 6.2
411gb|AC137146.9| Mus musculus chromosome 1, clone RP24-358I14, com... 40 6.2
412gb|AC098982.7| Rattus norvegicus BAC CH230-46O20 (Children's Ho... 40 6.2
413gb|AC148698.1| Macaca mulatta Major Histocompatibility Complex B... 40 6.2
414gb|AC148689.1| Macaca mulatta Major Histocompatibility Complex B... 40 6.2
415gb|AC153375.3| Mus musculus 6 BAC RP23-353E9 (Roswell Park Cance... 40 6.2
416emb|BX323039.6| Zebrafish DNA sequence from clone CH211-145A11 i... 40 6.2
417gb|AC012163.13|AC012163 Drosophila melanogaster, chromosome X, r... 40 6.2
418dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.2
419dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.2
420gb|AC154183.2| Mus musculus BAC clone RP23-474E16 from chromosom... 40 6.2
421gb|AC013719.8| Homo sapiens BAC clone RP11-270E5 from 2, complet... 40 6.2
422gb|AC027242.16| Homo sapiens chromosome 8, clone RP11-678P19, co... 40 6.2
423gb|AE014074.1| Streptococcus pyogenes MGAS315, complete genome 40 6.2
424gb|AC135628.8| Homo sapiens chromosome 15, clone RP11-883G10, co... 40 6.2
425gb|AC021636.16| Homo sapiens chromosome 8, clone RP11-637F16, co... 40 6.2
426gb|AC097377.3| Homo sapiens BAC clone RP11-83F13 from 2, complet... 40 6.2
427gb|AC134985.11| Mus musculus chromosome 5, clone RP24-432L3, com... 40 6.2
428gb|AC103644.15| Mus musculus chromosome 7, clone RP24-361F3, com... 40 6.2
429dbj|BA000034.2| Streptococcus pyogenes SSI-1 DNA, complete genome 40 6.2
430gb|AC103635.8| Mus musculus chromosome 1, clone RP24-397O8, comp... 40 6.2
431dbj|AP004732.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.2
432emb|BX548065.6| Mouse DNA sequence from clone RP23-163B21 on chr... 40 6.2
433dbj|AP004123.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.2
434gb|AC140488.4| Mus musculus BAC clone RP24-142A8 from 9, complet... 40 6.2
435gb|AC155233.2| Mus musculus BAC clone RP24-381F23 from 12, compl... 40 6.2
436emb|CT954231.1| Medicago truncatula chromosome 5 clone mth2-166e... 40 6.2
437gb|AC154489.2| Mus musculus BAC clone RP23-205G15 from chromosom... 40 6.2
438gb|AE003835.4| Drosophila melanogaster chromosome 2R, section 15... 40 6.2
439gb|AE003566.3| Drosophila melanogaster chromosome 3L, section 19... 40 6.2
440gb|AE003564.3| Drosophila melanogaster chromosome 3L, section 21... 40 6.2
441gb|AE003507.3| Drosophila melanogaster chromosome X, section 59 ... 40 6.2
442gb|AC124095.7| Mus musculus chromosome 1, clone RP23-245G9, comp... 40 6.2
443gb|AC121114.10| Mus musculus chromosome 15, clone RP23-63M19, co... 40 6.2
444gb|AC115725.9| Mus musculus chromosome 5, clone RP23-21A18, comp... 40 6.2
445emb|CT571274.6| Mouse DNA sequence from clone RP24-142M17 on chr... 40 6.2
446gb|AC006074.1|AC006074 Drosophila melanogaster, chromosome 2R, r... 40 6.2
447gb|AC123620.14| Mus musculus chromosome 12, clone RP23-53J21, co... 40 6.2
448emb|AL954345.11| Mouse DNA sequence from clone RP23-79N6 on chro... 40 6.2
449gb|AC159900.3| Mus musculus BAC clone RP23-48H10 from chromosome... 40 6.2
450emb|AL031983.2|HS271M21 Human DNA sequence from clone RP1-271M21... 40 6.2
451emb|AL731785.2|CNS08C89 Oryza sativa chromosome 12, . BAC OSJNBa... 40 6.2
452emb|AL845320.10| Zebrafish DNA sequence from clone DKEY-30J19, c... 40 6.2
453gb|AC171912.2| Capitella capitata clone JGIBGZA-9O3, complete se... 40 6.2
454gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome 40 6.2
455gb|AC121960.3| Mus musculus BAC clone RP24-248C17 from 14, compl... 40 6.2
456gb|AC133170.2| Mus musculus BAC clone RP24-267K11 from 3, comple... 40 6.2
457gb|AC140192.3| Mus musculus BAC clone RP24-377O11 from 6, comple... 40 6.2
458gb|AC140466.3| Mus musculus BAC clone RP24-392F9 from 6, complet... 40 6.2
459gb|AC149060.4| Mus musculus BAC clone RP23-242D8 from 7, complet... 40 6.2
460gb|AC138459.3| Mus musculus BAC clone RP23-335K20 from 10, compl... 40 6.2
461gb|AC121770.3| Mus musculus BAC clone RP23-341M16 from 17, compl... 40 6.2
462gb|AC123868.4| Mus musculus BAC clone RP23-129K6 from 8, complet... 40 6.2
463gb|AC131698.4| Mus musculus BAC clone RP23-428E12 from 3, comple... 40 6.2
464gb|AC122217.4| Mus musculus BAC clone RP23-118J3 from 16, comple... 40 6.2
465emb|CR387992.11| Zebrafish DNA sequence from clone DKEY-234K24 i... 40 6.2
466emb|CT025838.2| Medicago truncatula chromosome 5 clone mth2-124f... 40 6.2
467gb|AC164092.3| Mus musculus BAC clone RP23-366E4 from chromosome... 40 6.2
468gb|AC169384.2| Mus musculus chromosome 5, clone RP23-231C16, com... 40 6.2
469gb|AC115895.9| Mus musculus chromosome 5, clone RP24-443E20, com... 40 6.2
470gb|U03026.1|RNU03026 Rattus norvegicus proenkephalin gene, 5' re... 40 6.2
471emb|AL662818.16| Mouse DNA sequence from clone RP23-266O8 on chr... 40 6.2
472emb|AL592224.17| Mouse DNA sequence from clone RP23-174G1 on chr... 40 6.2
473emb|AL808127.4| Mouse DNA sequence from clone RP23-263L18 on chr... 40 6.2
474emb|AL805924.5| Mouse DNA sequence from clone RP23-329M9 on chro... 40 6.2
475emb|AL772170.14| Mouse DNA sequence from clone RP23-322G9 on chr... 40 6.2
476emb|AL806523.14| Mouse DNA sequence from clone RP23-423O7 on chr... 40 6.2
477emb|AL669982.10| Mouse DNA sequence from clone RP23-297N24 on ch... 40 6.2
478emb|AL590963.11| Mouse DNA sequence from clone RP23-395E10 on ch... 40 6.2
479dbj|AB065476.1| Homo sapiens gene for seven transmembrane helix ... 40 6.2
480emb|AL645805.5| Mouse DNA sequence from clone RP23-175A18 on chr... 40 6.2

>emb|AJ318884.1|TTU318884 Triticum turgidum subsp. durum xip-II gene for putative xylanase
            inhibitor protein
          Length = 2143

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                      
Query: 232  tcccagaccatgaccccgccatagttggccgccttctgcacc 273
            |||||||||||||||||||||||||||  |||||||||||||
Sbjct: 1886 tcccagaccatgaccccgccatagttgttcgccttctgcacc 1845



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 368  acgccgccgtccacttgtcccactgc 393
            |||||||||||||||| |||||||||
Sbjct: 1729 acgccgccgtccacttctcccactgc 1704



to top

>dbj|AB204556.1| Triticum aestivum Xip-III gene for xylanase inhibitor XIP-III,
           complete cds
          Length = 934

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 232 tcccagaccatgaccccgccatagttggccgccttctgcaccacctgtatgacgccgtag 291
           ||||||| |||||||||||| |||||| ||  ||||||||||||| |  ||| |||||||
Sbjct: 877 tcccagagcatgaccccgccgtagttgtccttcttctgcaccaccggcgtgatgccgtag 818

                      
Query: 292 tagaggttctt 302
           |||| ||||||
Sbjct: 817 tagacgttctt 807



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 367 tacgccgccgtccacttgtcccac 390
           ||||||||||||||| ||||||||
Sbjct: 742 tacgccgccgtccacctgtcccac 719



to top

>gb|AC165299.13| Mus musculus chromosome 15, clone RP23-266F2, complete sequence
          Length = 186266

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 168576 gcacatgcacatgcacatgcacatgca 168602



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              ||||||||||||||||||||||||
Sbjct: 168582 gcacatgcacatgcacatgcacat 168605



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 101    atgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||
Sbjct: 168574 atgcacatgcacatgcacatgca 168596



to top

>gb|AC167164.6| Mus musculus chromosome 7, clone RP24-276M8, complete sequence
          Length = 171048

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 65274 gcacatgcacatgcacatgcacatgca 65300



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 65268 gcacatgcacatgcacatgcacatgca 65294



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 65262 gcacatgcacatgcacatgcacatgca 65288



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 65256 gcacatgcacatgcacatgcacatgca 65282



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 99    acatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||
Sbjct: 65252 acatgcacatgcacatgcacatgca 65276



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             ||||||||||||||||||||||||
Sbjct: 65280 gcacatgcacatgcacatgcacat 65303



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||||| |||||||||||||||||||
Sbjct: 65245 cacatgtacatgcacatgcacatgca 65270



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             |||||||||||||||||| |||||
Sbjct: 65286 gcacatgcacatgcacatacacat 65309



to top

>gb|AC155300.2| Mus musculus BAC clone RP24-232D3 from chromosome 12, complete sequence
          Length = 176261

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 109047 gcacatgcacatgcacatgcacatgca 109021



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 109041 gcacatgcacatgcacatgcacatgca 109015



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 109035 gcacatgcacatgcacatgcacatgca 109009



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 109029 gcacatgcacatgcacatgcacatgca 109003



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 109023 gcacatgcacatgcacatgcacatgca 108997



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              ||||||||||||||||||||||||||
Sbjct: 109052 cacatgcacatgcacatgcacatgca 109027



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              ||||||||||||||||||||||||
Sbjct: 109017 gcacatgcacatgcacatgcacat 108994



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              ||||| ||||||||||||||||||||
Sbjct: 109058 cacatacacatgcacatgcacatgca 109033



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              |||||||||||||||||| |||||
Sbjct: 109011 gcacatgcacatgcacatacacat 108988



to top

>gb|AC155235.2| Mus musculus BAC clone RP24-406H23 from chromosome 12, complete
             sequence
          Length = 158341

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 12885 gcacatgcacatgcacatgcacatgca 12859



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 12879 gcacatgcacatgcacatgcacatgca 12853



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 12873 gcacatgcacatgcacatgcacatgca 12847



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 12867 gcacatgcacatgcacatgcacatgca 12841



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 12861 gcacatgcacatgcacatgcacatgca 12835



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||||||
Sbjct: 12890 cacatgcacatgcacatgcacatgca 12865



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             ||||||||||||||||||||||||
Sbjct: 12855 gcacatgcacatgcacatgcacat 12832



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||| ||||||||||||||||||||
Sbjct: 12896 cacatacacatgcacatgcacatgca 12871



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             |||||||||||||||||| |||||
Sbjct: 12849 gcacatgcacatgcacatacacat 12826



to top

>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence
          Length = 3587082

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                          
Query: 97      gcacatgcacatgcacatgcacatgca 123
               |||||||||||||||||||||||||||
Sbjct: 3539276 gcacatgcacatgcacatgcacatgca 3539250



to top

>gb|AC134795.10| Mus musculus chromosome 15, clone RP24-456M21, complete sequence
          Length = 166650

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 129383 gcacatgcacatgcacatgcacatgca 129357



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              ||||||||||||||||||||||||
Sbjct: 129377 gcacatgcacatgcacatgcacat 129354



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 101    atgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||
Sbjct: 129385 atgcacatgcacatgcacatgca 129363



to top

>gb|AY687385.1| Pelodiscus sinensis mitochondrion, complete genome
          Length = 17364

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16781 gcacatgcacatgcacatgcacatgca 16807



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16775 gcacatgcacatgcacatgcacatgca 16801



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16769 gcacatgcacatgcacatgcacatgca 16795



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16763 gcacatgcacatgcacatgcacatgca 16789



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16757 gcacatgcacatgcacatgcacatgca 16783



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16643 gcacatgcacatgcacatgcacatgca 16669



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16637 gcacatgcacatgcacatgcacatgca 16663



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16631 gcacatgcacatgcacatgcacatgca 16657



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16625 gcacatgcacatgcacatgcacatgca 16651



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16619 gcacatgcacatgcacatgcacatgca 16645



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16613 gcacatgcacatgcacatgcacatgca 16639



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16607 gcacatgcacatgcacatgcacatgca 16633



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16601 gcacatgcacatgcacatgcacatgca 16627



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16595 gcacatgcacatgcacatgcacatgca 16621



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16589 gcacatgcacatgcacatgcacatgca 16615



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16583 gcacatgcacatgcacatgcacatgca 16609



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16577 gcacatgcacatgcacatgcacatgca 16603



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16571 gcacatgcacatgcacatgcacatgca 16597



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16565 gcacatgcacatgcacatgcacatgca 16591



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16559 gcacatgcacatgcacatgcacatgca 16585



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16553 gcacatgcacatgcacatgcacatgca 16579



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||||||
Sbjct: 16752 cacatgcacatgcacatgcacatgca 16777



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             ||||||||||||||||||||||||
Sbjct: 16787 gcacatgcacatgcacatgcacat 16810



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             ||||||||||||||||||||||||
Sbjct: 16649 gcacatgcacatgcacatgcacat 16672



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||| ||||||||||||||||||||
Sbjct: 16746 cacatacacatgcacatgcacatgca 16771



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             |||||||||||||||||| |||||
Sbjct: 16655 gcacatgcacatgcacatacacat 16678



to top

>gb|AC102369.21| Mus musculus chromosome 12, clone RP23-246F14, complete sequence
          Length = 214580

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 59875 gcacatgcacatgcacatgcacatgca 59849



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 59869 gcacatgcacatgcacatgcacatgca 59843



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 59863 gcacatgcacatgcacatgcacatgca 59837



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 59857 gcacatgcacatgcacatgcacatgca 59831



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 59851 gcacatgcacatgcacatgcacatgca 59825



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||||||
Sbjct: 59880 cacatgcacatgcacatgcacatgca 59855



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             ||||||||||||||||||||||||
Sbjct: 59845 gcacatgcacatgcacatgcacat 59822



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||| ||||||||||||||||||||
Sbjct: 59886 cacatacacatgcacatgcacatgca 59861



to top

>gb|AC101787.11| Mus musculus chromosome 1, clone RP24-147F6, complete sequence
          Length = 172617

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 59989 gcacatgcacatgcacatgcacatgca 59963



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 59983 gcacatgcacatgcacatgcacatgca 59957



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 59977 gcacatgcacatgcacatgcacatgca 59951



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 59971 gcacatgcacatgcacatgcacatgca 59945



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 59965 gcacatgcacatgcacatgcacatgca 59939



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 59959 gcacatgcacatgcacatgcacatgca 59933



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||||||
Sbjct: 59994 cacatgcacatgcacatgcacatgca 59969



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             ||||||||||||||||||||||||
Sbjct: 59953 gcacatgcacatgcacatgcacat 59930



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             |||||||||||||||||| |||||
Sbjct: 59947 gcacatgcacatgcacatacacat 59924



to top

>gb|AC118702.8| Mus musculus chromosome 5, clone RP24-166J1, complete sequence
          Length = 171263

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                       
Query: 97   gcacatgcacatgcacatgcacatgca 123
            |||||||||||||||||||||||||||
Sbjct: 4155 gcacatgcacatgcacatgcacatgca 4129



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 97   gcacatgcacatgcacatgcaca 119
            |||||||||||||||||||||||
Sbjct: 4149 gcacatgcacatgcacatgcaca 4127



to top

>gb|AC113098.12| Mus musculus chromosome 8, clone RP23-314K9, complete sequence
          Length = 190888

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 149707 gcacatgcacatgcacatgcacatgca 149733



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              ||||||||||||||||||||||||||
Sbjct: 149702 cacatgcacatgcacatgcacatgca 149727



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              ||||| ||||||||||||||||||||
Sbjct: 149696 cacatacacatgcacatgcacatgca 149721



to top

>gb|AC133648.3| Mus musculus BAC clone RP23-291B1 from chromosome 7, complete sequence
          Length = 207234

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 137950 gcacatgcacatgcacatgcacatgca 137924



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 137944 gcacatgcacatgcacatgcacatgca 137918



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 137938 gcacatgcacatgcacatgcacatgca 137912



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 137932 gcacatgcacatgcacatgcacatgca 137906



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 137926 gcacatgcacatgcacatgcacatgca 137900



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 137920 gcacatgcacatgcacatgcacatgca 137894



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 137914 gcacatgcacatgcacatgcacatgca 137888



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 137908 gcacatgcacatgcacatgcacatgca 137882



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 137902 gcacatgcacatgcacatgcacatgca 137876



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 137896 gcacatgcacatgcacatgcacatgca 137870



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 137890 gcacatgcacatgcacatgcacatgca 137864



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              ||||||||||||||||||||||||
Sbjct: 137884 gcacatgcacatgcacatgcacat 137861



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 101    atgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||
Sbjct: 137952 atgcacatgcacatgcacatgca 137930



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              |||||||||||||||||| |||||
Sbjct: 137878 gcacatgcacatgcacatacacat 137855



to top

>emb|CR936412.13| Zebrafish DNA sequence from clone DKEY-181M21 in linkage group 18,
              complete sequence
          Length = 151872

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 140340 gcacatgcacatgcacatgcacatgca 140314



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              |||| |||||||||||||||||||||
Sbjct: 140345 cacacgcacatgcacatgcacatgca 140320



to top

>gb|AC123843.4| Mus musculus BAC clone RP23-407D18 from chromosome 8, complete sequence
          Length = 205875

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 113303 gcacatgcacatgcacatgcacatgca 113329



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 113297 gcacatgcacatgcacatgcacatgca 113323



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 113291 gcacatgcacatgcacatgcacatgca 113317



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 113285 gcacatgcacatgcacatgcacatgca 113311



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 113279 gcacatgcacatgcacatgcacatgca 113305



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 113273 gcacatgcacatgcacatgcacatgca 113299



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              ||||||||||||||||||||||||||
Sbjct: 113268 cacatgcacatgcacatgcacatgca 113293



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              ||||||||||||||||||||||||
Sbjct: 113309 gcacatgcacatgcacatgcacat 113332



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              |||||||||||||||||| |||||
Sbjct: 113315 gcacatgcacatgcacatacacat 113338



to top

>gb|AC122900.3| Mus musculus BAC clone RP23-39N24 from 15, complete sequence
          Length = 203855

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 107689 gcacatgcacatgcacatgcacatgca 107663



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 99     acatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||
Sbjct: 107693 acatgcacatgcacatgcacatgca 107669



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     gcacatgcacatgcacatgcacatg 121
              |||||||||||||||||||||||||
Sbjct: 107683 gcacatgcacatgcacatgcacatg 107659



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 99     acatgcacatgcacatgcacatgca 123
              ||||| |||||||||||||||||||
Sbjct: 107699 acatgtacatgcacatgcacatgca 107675



to top

>emb|CR716376.2|CNS0GFPD Tetraodon nigroviridis full-length cDNA
          Length = 952

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 98  cacatgcacatgcacatgcacatgcag 124
           |||||||||||||||||||||||||||
Sbjct: 446 cacatgcacatgcacatgcacatgcag 472



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 97  gcacatgcacatgcacatgca 117
           |||||||||||||||||||||
Sbjct: 451 gcacatgcacatgcacatgca 471



to top

>gb|AC162899.5| Mus musculus chromosome 1, clone RP24-222G3, complete sequence
          Length = 176916

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 145460 gcacatgcacatgcacatgcacatgca 145486



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 145454 gcacatgcacatgcacatgcacatgca 145480



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 145448 gcacatgcacatgcacatgcacatgca 145474



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 145442 gcacatgcacatgcacatgcacatgca 145468



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 145436 gcacatgcacatgcacatgcacatgca 145462



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 145430 gcacatgcacatgcacatgcacatgca 145456



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              ||||||||||||||||||||||||||
Sbjct: 145425 cacatgcacatgcacatgcacatgca 145450



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              ||||||||||||||||||||||||
Sbjct: 145466 gcacatgcacatgcacatgcacat 145489



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              |||||||||||||||||| |||||
Sbjct: 145472 gcacatgcacatgcacatacacat 145495



to top

>emb|AJ421451.1|LCA421451 Lemur catta mitochondrion complete mitochondrial genome
          Length = 17036

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16404 gcacatgcacatgcacatgcacatgca 16430



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16398 gcacatgcacatgcacatgcacatgca 16424



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16392 gcacatgcacatgcacatgcacatgca 16418



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16386 gcacatgcacatgcacatgcacatgca 16412



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16380 gcacatgcacatgcacatgcacatgca 16406



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16374 gcacatgcacatgcacatgcacatgca 16400



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16368 gcacatgcacatgcacatgcacatgca 16394



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16362 gcacatgcacatgcacatgcacatgca 16388



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16356 gcacatgcacatgcacatgcacatgca 16382



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16350 gcacatgcacatgcacatgcacatgca 16376



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16344 gcacatgcacatgcacatgcacatgca 16370



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16338 gcacatgcacatgcacatgcacatgca 16364



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16332 gcacatgcacatgcacatgcacatgca 16358



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16326 gcacatgcacatgcacatgcacatgca 16352



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16320 gcacatgcacatgcacatgcacatgca 16346



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16314 gcacatgcacatgcacatgcacatgca 16340



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16308 gcacatgcacatgcacatgcacatgca 16334



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16302 gcacatgcacatgcacatgcacatgca 16328



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16296 gcacatgcacatgcacatgcacatgca 16322



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16290 gcacatgcacatgcacatgcacatgca 16316



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16284 gcacatgcacatgcacatgcacatgca 16310



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16278 gcacatgcacatgcacatgcacatgca 16304



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16272 gcacatgcacatgcacatgcacatgca 16298



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16266 gcacatgcacatgcacatgcacatgca 16292



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16260 gcacatgcacatgcacatgcacatgca 16286



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16254 gcacatgcacatgcacatgcacatgca 16280



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16248 gcacatgcacatgcacatgcacatgca 16274



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 16242 gcacatgcacatgcacatgcacatgca 16268



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 102   tgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||
Sbjct: 16241 tgcacatgcacatgcacatgca 16262



to top

>gb|AC160536.4| Mus musculus chromosome 8, clone RP24-92K22, complete sequence
          Length = 202719

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 94986 gcacatgcacatgcacatgcacatgca 95012



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||||||
Sbjct: 94981 cacatgcacatgcacatgcacatgca 95006



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||| ||||||||||||||||||||
Sbjct: 94975 cacatacacatgcacatgcacatgca 95000



to top

>gb|AC151617.2| Emiliania huxleyi clone JGIACCU-13M3, complete sequence
          Length = 33456

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13356 gcacatgcacatgcacatgcacatgca 13330



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13350 gcacatgcacatgcacatgcacatgca 13324



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13344 gcacatgcacatgcacatgcacatgca 13318



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13338 gcacatgcacatgcacatgcacatgca 13312



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13332 gcacatgcacatgcacatgcacatgca 13306



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13326 gcacatgcacatgcacatgcacatgca 13300



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13320 gcacatgcacatgcacatgcacatgca 13294



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13314 gcacatgcacatgcacatgcacatgca 13288



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13308 gcacatgcacatgcacatgcacatgca 13282



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13302 gcacatgcacatgcacatgcacatgca 13276



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13296 gcacatgcacatgcacatgcacatgca 13270



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13290 gcacatgcacatgcacatgcacatgca 13264



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13284 gcacatgcacatgcacatgcacatgca 13258



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13278 gcacatgcacatgcacatgcacatgca 13252



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13272 gcacatgcacatgcacatgcacatgca 13246



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13266 gcacatgcacatgcacatgcacatgca 13240



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13260 gcacatgcacatgcacatgcacatgca 13234



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13254 gcacatgcacatgcacatgcacatgca 13228



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13248 gcacatgcacatgcacatgcacatgca 13222



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13242 gcacatgcacatgcacatgcacatgca 13216



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13236 gcacatgcacatgcacatgcacatgca 13210



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13230 gcacatgcacatgcacatgcacatgca 13204



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 13224 gcacatgcacatgcacatgcacatgca 13198



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 99    acatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||
Sbjct: 13360 acatgcacatgcacatgcacatgca 13336



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    gcacatgcacatgcacatgcacatg 121
             |||||||||||||||||||||||||
Sbjct: 13218 gcacatgcacatgcacatgcacatg 13194



to top

>gb|AC010711.5| Drosophila melanogaster 3L BAC RP98-22D12 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 187438

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 70410 gcacatgcacatgcacatgcacatgca 70436



to top

>gb|AC079617.5| Homo sapiens BAC clone RP11-623K14 from 4, complete sequence
          Length = 112615

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 28613 gcacatgcacatgcacatgcacatgca 28587



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||||||
Sbjct: 28618 cacatgcacatgcacatgcacatgca 28593



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    gcacatgcacatgcacatgcacatg 121
             |||||||||||||||||||||||||
Sbjct: 28607 gcacatgcacatgcacatgcacatg 28583



to top

>gb|AC110911.18| Mus musculus chromosome 7, clone RP24-357A15, complete sequence
          Length = 146978

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 51696 gcacatgcacatgcacatgcacatgca 51722



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 51690 gcacatgcacatgcacatgcacatgca 51716



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 51684 gcacatgcacatgcacatgcacatgca 51710



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 51678 gcacatgcacatgcacatgcacatgca 51704



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 99    acatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||
Sbjct: 51674 acatgcacatgcacatgcacatgca 51698



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             ||||||||||||||||||||||||
Sbjct: 51702 gcacatgcacatgcacatgcacat 51725



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||||| |||||||||||||||||||
Sbjct: 51667 cacatgtacatgcacatgcacatgca 51692



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             |||||||||||||||||| |||||
Sbjct: 51708 gcacatgcacatgcacatacacat 51731



to top

>gb|AC157567.6| Mus musculus chromosome 5, clone RP23-246I12, complete sequence
          Length = 157519

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 89387 gcacatgcacatgcacatgcacatgca 89361



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 97    gcacatgcacatgcacatgcaca 119
             |||||||||||||||||||||||
Sbjct: 89381 gcacatgcacatgcacatgcaca 89359



to top

>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                          
Query: 97      gcacatgcacatgcacatgcacatgca 123
               |||||||||||||||||||||||||||
Sbjct: 2058901 gcacatgcacatgcacatgcacatgca 2058875



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                         
Query: 97      gcacatgcacatgcacatgcacatgc 122
               ||||||||||||||||||||||||||
Sbjct: 2058895 gcacatgcacatgcacatgcacatgc 2058870



to top

>gb|AC091657.3| Rattus norvegicus strain Brown Norway clone RP31-29N16, complete
            sequence
          Length = 141898

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                       
Query: 97   gcacatgcacatgcacatgcacatgca 123
            |||||||||||||||||||||||||||
Sbjct: 2916 gcacatgcacatgcacatgcacatgca 2890



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 97   gcacatgcacatgcacatgcacatgc 122
            ||||||||||||||||||||||||||
Sbjct: 2910 gcacatgcacatgcacatgcacatgc 2885



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 97   gcacatgcacatgcacatgcacatgca 123
            ||||| |||||||||||||||||||||
Sbjct: 2922 gcacacgcacatgcacatgcacatgca 2896



to top

>gb|AC091710.3| Rattus norvegicus strain Brown Norway clone RP31-580N24, complete
             sequence
          Length = 87280

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 77034 gcacatgcacatgcacatgcacatgca 77008



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 97    gcacatgcacatgcacatgcacatgc 122
             ||||||||||||||||||||||||||
Sbjct: 77028 gcacatgcacatgcacatgcacatgc 77003



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             ||||| |||||||||||||||||||||
Sbjct: 77040 gcacacgcacatgcacatgcacatgca 77014



to top

>emb|CT571248.10| Mouse DNA sequence from clone RP24-355C16 on chromosome 16, complete
             sequence
          Length = 136128

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 60747 gcacatgcacatgcacatgcacatgca 60773



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 60741 gcacatgcacatgcacatgcacatgca 60767



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 60735 gcacatgcacatgcacatgcacatgca 60761



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 60729 gcacatgcacatgcacatgcacatgca 60755



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||||||
Sbjct: 60724 cacatgcacatgcacatgcacatgca 60749



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             ||||||||||||||||||||||||
Sbjct: 60753 gcacatgcacatgcacatgcacat 60776



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||| ||||||||||||||||||||
Sbjct: 60718 cacatacacatgcacatgcacatgca 60743



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             |||||||||||||||||| |||||
Sbjct: 60759 gcacatgcacatgcacatacacat 60782



to top

>gb|AE003470.4| Drosophila melanogaster chromosome 3L, section 4 of 83 of the complete
              sequence
          Length = 318699

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 194958 gcacatgcacatgcacatgcacatgca 194984



to top

>emb|CT009765.9| Mouse DNA sequence from clone RP23-235B7 on chromosome 12, complete
            sequence
          Length = 197822

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                       
Query: 97   gcacatgcacatgcacatgcacatgca 123
            |||||||||||||||||||||||||||
Sbjct: 3929 gcacatgcacatgcacatgcacatgca 3955



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                       
Query: 97   gcacatgcacatgcacatgcacatgca 123
            |||||||||||||||||||||||||||
Sbjct: 3923 gcacatgcacatgcacatgcacatgca 3949



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                       
Query: 97   gcacatgcacatgcacatgcacatgca 123
            |||||||||||||||||||||||||||
Sbjct: 3917 gcacatgcacatgcacatgcacatgca 3943



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                       
Query: 97   gcacatgcacatgcacatgcacatgca 123
            |||||||||||||||||||||||||||
Sbjct: 3911 gcacatgcacatgcacatgcacatgca 3937



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                       
Query: 97   gcacatgcacatgcacatgcacatgca 123
            |||||||||||||||||||||||||||
Sbjct: 3905 gcacatgcacatgcacatgcacatgca 3931



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 98   cacatgcacatgcacatgcacatgca 123
            ||||||||||||||||||||||||||
Sbjct: 3900 cacatgcacatgcacatgcacatgca 3925



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 97   gcacatgcacatgcacatgcacat 120
            ||||||||||||||||||||||||
Sbjct: 3935 gcacatgcacatgcacatgcacat 3958



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 98   cacatgcacatgcacatgcacatgca 123
            ||||| ||||||||||||||||||||
Sbjct: 3894 cacatacacatgcacatgcacatgca 3919



to top

>gb|AC163446.2| Mus musculus chromosome 5, clone RP23-151G22, complete sequence
          Length = 190466

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||||
Sbjct: 155791 gcacatgcacatgcacatgcacatgca 155765



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 97     gcacatgcacatgcacatgcaca 119
              |||||||||||||||||||||||
Sbjct: 155785 gcacatgcacatgcacatgcaca 155763



to top

>emb|AL772402.5| Mouse DNA sequence from clone RP23-65J9 on chromosome 11, complete
             sequence
          Length = 242502

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 81189 gcacatgcacatgcacatgcacatgca 81163



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 81183 gcacatgcacatgcacatgcacatgca 81157



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||||
Sbjct: 81177 gcacatgcacatgcacatgcacatgca 81151



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 99    acatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||
Sbjct: 81193 acatgcacatgcacatgcacatgca 81169



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             ||||||||||||||||||||||||
Sbjct: 81171 gcacatgcacatgcacatgcacat 81148



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 99    acatgcacatgcacatgcacatgca 123
             ||||| |||||||||||||||||||
Sbjct: 81199 acatgtacatgcacatgcacatgca 81175



to top

>ref|NM_101931.2| Arabidopsis thaliana unknown protein AT1G20790 mRNA, complete cds
          Length = 1308

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 97   gcacatgcacatgcacatgcacatgc 122
            ||||||||||||||||||||||||||
Sbjct: 1101 gcacatgcacatgcacatgcacatgc 1126



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 100  catgcacatgcacatgcacatgca 123
            ||||||||||||||||||||||||
Sbjct: 1098 catgcacatgcacatgcacatgca 1121



to top

>gb|U83904.1|HVU83904 Hordeum vulgare lipoxygenase isoenzyme 1 (Lox:Hv1) gene, promoter
            region and partial cds
          Length = 5236

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 100  catgcacatgcacatgcacatgcagt 125
            ||||||||||||||||||||||||||
Sbjct: 3178 catgcacatgcacatgcacatgcagt 3203



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 97   gcacatgcacatgcacatgca 117
            |||||||||||||||||||||
Sbjct: 3181 gcacatgcacatgcacatgca 3201



to top

>gb|AC166648.4| Mus musculus chromosome 5, clone RP23-102C14, complete sequence
          Length = 203566

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 97     gcacatgcacatgcacatgcacatgc 122
              ||||||||||||||||||||||||||
Sbjct: 158681 gcacatgcacatgcacatgcacatgc 158706



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 99     acatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||
Sbjct: 158677 acatgcacatgcacatgcacatgca 158701



to top

>gb|AC113104.15| Mus musculus chromosome 18, clone RP23-321L15, complete sequence
          Length = 207418

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||||||
Sbjct: 90185 cacatgcacatgcacatgcacatgca 90160



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 97    gcacatgcacatgcacatgcaca 119
             |||||||||||||||||||||||
Sbjct: 90180 gcacatgcacatgcacatgcaca 90158



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||| ||||||||||||||||||||
Sbjct: 90191 cacatacacatgcacatgcacatgca 90166



to top

>gb|AC150413.2| Branchiostoma floridae clone CH302-61A17, complete sequence
          Length = 240260

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              ||||||||||||||||||||||||||
Sbjct: 226269 cacatgcacatgcacatgcacatgca 226244



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              ||||||||||||||||||||||||
Sbjct: 226264 gcacatgcacatgcacatgcacat 226241



to top

>gb|AC158951.5| Mus musculus chromosome 8, clone RP23-265B11, complete sequence
          Length = 191700

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              ||||||||||||||||||||||||||
Sbjct: 155887 cacatgcacatgcacatgcacatgca 155912



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              ||||||||||||||||||||||||
Sbjct: 155892 gcacatgcacatgcacatgcacat 155915



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              |||||||||||||||||| |||||
Sbjct: 155898 gcacatgcacatgcacatacacat 155921



to top

>gb|AC121946.3| Mus musculus BAC clone RP24-212F15 from chromosome 10, complete
             sequence
          Length = 181828

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||||||
Sbjct: 16980 cacatgcacatgcacatgcacatgca 16955



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             ||||||||||||||||||||||||
Sbjct: 16975 gcacatgcacatgcacatgcacat 16952



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||| ||||||||||||||||||||
Sbjct: 16986 cacatacacatgcacatgcacatgca 16961



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             |||||||||||||||||| |||||
Sbjct: 16969 gcacatgcacatgcacatacacat 16946



to top

>emb|AL353621.19| Human DNA sequence from clone RP11-490D19 on chromosome 9 Contains a
              novel pseudogene, the MRPL50 gene for mitochondrial
              ribosomal protein L50, the ZNF189 gene for zinc finger
              protein 189, the ALDOB gene for aldolase B,
              fructose-bisphosphate, a NADH dehydrogenase (ubiquinone) 1
              alpha subcomplex (NDUFA4) pseudogene, three novel genes,
              the 5' end of the RNF20 gene for ring finger protein 20 and
              three CpG islands, complete sequence
          Length = 164115

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              ||||||||||||||||||||||||||
Sbjct: 138241 cacatgcacatgcacatgcacatgca 138216



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 97     gcacatgcacatgcacatgca 117
              |||||||||||||||||||||
Sbjct: 138236 gcacatgcacatgcacatgca 138216



to top

>emb|BX649331.16| Zebrafish DNA sequence from clone DKEY-12N3 in linkage group 11,
             complete sequence
          Length = 252675

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||||||
Sbjct: 10587 cacatgcacatgcacatgcacatgca 10612



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             ||||||||||||||||||||||||
Sbjct: 10592 gcacatgcacatgcacatgcacat 10615



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                         
Query: 98      cacatgcacatgcacatgcacatgca 123
               ||||||||||||||||||||||||||
Sbjct: 1349842 cacatgcacatgcacatgcacatgca 1349867



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                        
Query: 97      gcacatgcacatgcacatgcacatg 121
               |||||||||||||||||||||||||
Sbjct: 1349847 gcacatgcacatgcacatgcacatg 1349871



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 105      acatgcacatgcacatgcag 124
                ||||||||||||||||||||
Sbjct: 13094744 acatgcacatgcacatgcag 13094763



to top

>gb|AC069251.5|AC069251 Genomic sequence for Arabidopsis thaliana BAC F2D10 from chromosome I,
              complete sequence
          Length = 143879

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 97     gcacatgcacatgcacatgcacatgc 122
              ||||||||||||||||||||||||||
Sbjct: 111625 gcacatgcacatgcacatgcacatgc 111600



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 100    catgcacatgcacatgcacatgca 123
              ||||||||||||||||||||||||
Sbjct: 111628 catgcacatgcacatgcacatgca 111605



to top

>gb|AC117729.9| Mus musculus chromosome 8, clone RP24-126M11, complete sequence
          Length = 193119

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              ||||||||||||||||||||||||||
Sbjct: 119863 cacatgcacatgcacatgcacatgca 119838



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              ||||||||||||||||||||||||
Sbjct: 119858 gcacatgcacatgcacatgcacat 119835



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              |||||||||||||||||| |||||
Sbjct: 119852 gcacatgcacatgcacatacacat 119829



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                         
Query: 98      cacatgcacatgcacatgcacatgca 123
               ||||||||||||||||||||||||||
Sbjct: 1349842 cacatgcacatgcacatgcacatgca 1349867



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                        
Query: 97      gcacatgcacatgcacatgcacatg 121
               |||||||||||||||||||||||||
Sbjct: 1349847 gcacatgcacatgcacatgcacatg 1349871



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 105      acatgcacatgcacatgcag 124
                ||||||||||||||||||||
Sbjct: 13049018 acatgcacatgcacatgcag 13049037



to top

>emb|BX000507.2|CNS08CDX Oryza sativa chromosome 12, . BAC OJ1003_C01 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 157453

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||||||
Sbjct: 79327 cacatgcacatgcacatgcacatgca 79302



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    gcacatgcacatgcacatgcacatg 121
             |||||||||||||||||||||||||
Sbjct: 79322 gcacatgcacatgcacatgcacatg 79298



to top

>gb|AC134457.4| Mus musculus BAC clone RP23-340O18 from 10, complete sequence
          Length = 186273

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||||||
Sbjct: 98910 cacatgcacatgcacatgcacatgca 98885



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             ||||||||||||||||||||||||
Sbjct: 98905 gcacatgcacatgcacatgcacat 98882



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||| ||||||||||||||||||||
Sbjct: 98916 cacatacacatgcacatgcacatgca 98891



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             |||||||||||||||||| |||||
Sbjct: 98899 gcacatgcacatgcacatacacat 98876



to top

>gb|AC164300.3| Mus musculus BAC clone RP23-310J6 from chromosome 8, complete sequence
          Length = 200605

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 99     acatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||
Sbjct: 179704 acatgcacatgcacatgcacatgca 179728



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 97     gcacatgcacatgcacatgcaca 119
              |||||||||||||||||||||||
Sbjct: 179708 gcacatgcacatgcacatgcaca 179730



to top

>dbj|AP001980.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-264L21, complete
              sequence
          Length = 151939

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 99     acatgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||||
Sbjct: 105915 acatgcacatgcacatgcacatgca 105891



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     gcacatgcacatgcacatgcacatg 121
              |||||||||||||||||||||||||
Sbjct: 105911 gcacatgcacatgcacatgcacatg 105887



to top

>dbj|AP003460.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-285P16, complete
             sequence
          Length = 171738

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 99    acatgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||||
Sbjct: 28590 acatgcacatgcacatgcacatgca 28566



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    gcacatgcacatgcacatgcacatg 121
             |||||||||||||||||||||||||
Sbjct: 28586 gcacatgcacatgcacatgcacatg 28562



to top

>gb|AC110192.14| Mus musculus chromosome 7, clone RP23-227K15, complete sequence
          Length = 181287

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     gcacatgcacatgcacatgcacatg 121
              |||||||||||||||||||||||||
Sbjct: 158851 gcacatgcacatgcacatgcacatg 158875



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 100    catgcacatgcacatgcacatgca 123
              ||||||||||||||||||||||||
Sbjct: 158848 catgcacatgcacatgcacatgca 158871



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 100    catgcacatgcacatgcacatgca 123
              ||||| ||||||||||||||||||
Sbjct: 158842 catgcgcatgcacatgcacatgca 158865



to top

>emb|AL929214.6| Mouse DNA sequence from clone RP23-195I21 on chromosome 2, complete
            sequence
          Length = 43009

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 93   gcaagcacatgcacatgcacatgca 117
            |||||||||||||||||||||||||
Sbjct: 8647 gcaagcacatgcacatgcacatgca 8623



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 103  gcacatgcacatgcacatgca 123
            |||||||||||||||||||||
Sbjct: 8643 gcacatgcacatgcacatgca 8623



to top

>gb|AC166650.7| Mus musculus chromosome 5, clone RP23-434O9, complete sequence
          Length = 207176

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 99     acatgcacatgcacatgcacatgc 122
              ||||||||||||||||||||||||
Sbjct: 128878 acatgcacatgcacatgcacatgc 128901



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 97     gcacatgcacatgcacatgc 116
              ||||||||||||||||||||
Sbjct: 128882 gcacatgcacatgcacatgc 128901



to top

>gb|AC101807.12| Mus musculus chromosome 18, clone RP24-251J22, complete sequence
          Length = 171409

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              ||||||||||||||||||||||||
Sbjct: 118959 gcacatgcacatgcacatgcacat 118982



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 102    tgcacatgcacatgcacatgca 123
              ||||||||||||||||||||||
Sbjct: 118958 tgcacatgcacatgcacatgca 118979



to top

>gb|AC102735.9| Mus musculus chromosome 5, clone RP24-237I4, complete sequence
          Length = 167871

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 98     cacatgcacatgcacatgcacatg 121
              ||||||||||||||||||||||||
Sbjct: 107712 cacatgcacatgcacatgcacatg 107735



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 104    cacatgcacatgcacatgca 123
              ||||||||||||||||||||
Sbjct: 107712 cacatgcacatgcacatgca 107731



to top

>gb|AC161580.12| Mus musculus chromosome 3, clone RP23-422D10, complete sequence
          Length = 224193

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             ||||||||||||||||||||||||
Sbjct: 96469 gcacatgcacatgcacatgcacat 96446



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 101   atgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||
Sbjct: 96471 atgcacatgcacatgcacatgca 96449



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 101    atgcacatgcacatgcacat 120
              ||||||||||||||||||||
Sbjct: 194258 atgcacatgcacatgcacat 194239



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              |||||||||||||||||| |||||
Sbjct: 194256 gcacatgcacatgcacatacacat 194233



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 101    atgcacatgcacatgcacat 120
              ||||||||||||||||||||
Sbjct: 161658 atgcacatgcacatgcacat 161639



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              |||||||||||||||||| |||||
Sbjct: 161656 gcacatgcacatgcacatacacat 161633



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 101    atgcacatgcacatgcacat 120
              ||||||||||||||||||||
Sbjct: 129038 atgcacatgcacatgcacat 129019



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              |||||||||||||||||| |||||
Sbjct: 129036 gcacatgcacatgcacatacacat 129013



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             |||||||||||||||||| |||||
Sbjct: 96463 gcacatgcacatgcacatacacat 96440



to top

>gb|AC166649.5| Mus musculus chromosome 5, clone RP23-379D24, complete sequence
          Length = 176315

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 99    acatgcacatgcacatgcacatgc 122
             ||||||||||||||||||||||||
Sbjct: 96802 acatgcacatgcacatgcacatgc 96779



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 97    gcacatgcacatgcacatgc 116
             ||||||||||||||||||||
Sbjct: 96798 gcacatgcacatgcacatgc 96779



to top

>ref|NM_193094.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 951

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 232 tcccagaccatgaccccgccatagttggccgccttctgca 271
           ||||||| |||||  ||||| |||||||||||||||||||
Sbjct: 896 tcccagatcatgaagccgccgtagttggccgccttctgca 857



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 367 tacgccgccgtccacttgtcccac 390
           ||||||||||||||| ||||||||
Sbjct: 737 tacgccgccgtccacctgtcccac 714



to top

>gb|AC147263.3| Mus musculus BAC clone RP24-213I13 from chromosome 13, complete
             sequence
          Length = 182371

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             ||||||||||||||||||||||||
Sbjct: 11344 gcacatgcacatgcacatgcacat 11321



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 102   tgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||
Sbjct: 11345 tgcacatgcacatgcacatgca 11324



to top

>gb|AC142270.4| Mus musculus BAC clone RP24-115G23 from chromosome 3, complete sequence
          Length = 170870

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 100   catgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||||
Sbjct: 42083 catgcacatgcacatgcacatgca 42060



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 97    gcacatgcacatgcacatgcaca 119
             |||||||||||||||||||||||
Sbjct: 42080 gcacatgcacatgcacatgcaca 42058



to top

>gb|AC091268.2| Rattus norvegicus strain Brown Norway clone RP31-536L14, complete
             sequence
          Length = 148631

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 99    acatgcacatgcacatgcacatgc 122
             ||||||||||||||||||||||||
Sbjct: 39527 acatgcacatgcacatgcacatgc 39550



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||||| |||||||||||||||||||
Sbjct: 39520 cacatgaacatgcacatgcacatgca 39545



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 97    gcacatgcacatgcacatgc 116
             ||||||||||||||||||||
Sbjct: 39531 gcacatgcacatgcacatgc 39550



to top

>gb|AC163328.6| Mus musculus chromosome 5, clone RP24-405J8, complete sequence
          Length = 141045

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 99    acatgcacatgcacatgcacatgc 122
             ||||||||||||||||||||||||
Sbjct: 83997 acatgcacatgcacatgcacatgc 84020



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 97    gcacatgcacatgcacatgc 116
             ||||||||||||||||||||
Sbjct: 84001 gcacatgcacatgcacatgc 84020



to top

>gb|AC122008.4| Mus musculus BAC clone RP24-344F8 from chromosome 3, complete sequence
          Length = 209378

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              ||||||||||||||||||||||||
Sbjct: 164877 gcacatgcacatgcacatgcacat 164900



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 101    atgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||
Sbjct: 164875 atgcacatgcacatgcacatgca 164897



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              |||||||||||||||||| |||||
Sbjct: 164883 gcacatgcacatgcacatacacat 164906



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              |||||||||||||||||| |||||
Sbjct: 132310 gcacatgcacatgcacatacacat 132333



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 101    atgcacatgcacatgcacat 120
              ||||||||||||||||||||
Sbjct: 132308 atgcacatgcacatgcacat 132327



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             |||||||||||||||||| |||||
Sbjct: 99690 gcacatgcacatgcacatacacat 99713



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 101   atgcacatgcacatgcacat 120
             ||||||||||||||||||||
Sbjct: 99688 atgcacatgcacatgcacat 99707



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             |||||||||||||||||| |||||
Sbjct: 67090 gcacatgcacatgcacatacacat 67113



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 101   atgcacatgcacatgcacat 120
             ||||||||||||||||||||
Sbjct: 67088 atgcacatgcacatgcacat 67107



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             |||||||||||||||||| |||||
Sbjct: 34485 gcacatgcacatgcacatacacat 34508



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 101   atgcacatgcacatgcacat 120
             ||||||||||||||||||||
Sbjct: 34483 atgcacatgcacatgcacat 34502



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 97   gcacatgcacatgcacatgcacat 120
            |||||||||||||||||| |||||
Sbjct: 1886 gcacatgcacatgcacatacacat 1909



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 101  atgcacatgcacatgcacat 120
            ||||||||||||||||||||
Sbjct: 1884 atgcacatgcacatgcacat 1903



to top

>gb|AC124483.4| Mus musculus BAC clone RP24-127J3 from chromosome 5, complete sequence
          Length = 134272

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 99    acatgcacatgcacatgcacatgc 122
             ||||||||||||||||||||||||
Sbjct: 15574 acatgcacatgcacatgcacatgc 15597



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 99     acatgcacatgcacatgcacatgc 122
              |||||||||||||||||| |||||
Sbjct: 133170 acatgcacatgcacatgcccatgc 133193



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 97    gcacatgcacatgcacatgc 116
             ||||||||||||||||||||
Sbjct: 15578 gcacatgcacatgcacatgc 15597



to top

>gb|AC125277.1| Mus musculus BAC clone RP24-554P24 from 13, complete sequence
          Length = 141866

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              ||||||||||||||||||||||||
Sbjct: 116030 gcacatgcacatgcacatgcacat 116007



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 102    tgcacatgcacatgcacatgca 123
              ||||||||||||||||||||||
Sbjct: 116031 tgcacatgcacatgcacatgca 116010



to top

>gb|AC109805.8| Mus musculus chromosome 3, clone RP23-91D14, complete sequence
          Length = 171006

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 100   catgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||||
Sbjct: 40201 catgcacatgcacatgcacatgca 40178



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 97    gcacatgcacatgcacatgcaca 119
             |||||||||||||||||||||||
Sbjct: 40198 gcacatgcacatgcacatgcaca 40176



to top

>gb|AC135605.25| Medicago truncatula clone mth2-7m1, complete sequence
          Length = 121648

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 100   catgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||||
Sbjct: 68488 catgcacatgcacatgcacatgca 68465



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 97    gcacatgcacatgcacatgcac 118
             ||||||||||||||||||||||
Sbjct: 68485 gcacatgcacatgcacatgcac 68464



to top

>gb|AC124964.17| Medicago truncatula clone mth2-27c4, complete sequence
          Length = 114519

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 100   catgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||||
Sbjct: 51400 catgcacatgcacatgcacatgca 51423



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 97    gcacatgcacatgcacatgcac 118
             ||||||||||||||||||||||
Sbjct: 51403 gcacatgcacatgcacatgcac 51424



to top

>gb|AC165165.3| Mus musculus BAC clone RP23-121B15 from chromosome 3, complete sequence
          Length = 228648

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 100   catgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||||
Sbjct: 23707 catgcacatgcacatgcacatgca 23730



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 97    gcacatgcacatgcacatgcaca 119
             |||||||||||||||||||||||
Sbjct: 23710 gcacatgcacatgcacatgcaca 23732



to top

>gb|AC113633.5| Rattus norvegicus 4 BAC CH230-350N19 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 133392

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 99    acatgcacatgcacatgcacatgc 122
             ||||||||||||||||||||||||
Sbjct: 65795 acatgcacatgcacatgcacatgc 65772



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||||| |||||||||||||||||||
Sbjct: 65802 cacatgaacatgcacatgcacatgca 65777



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 97    gcacatgcacatgcacatgc 116
             ||||||||||||||||||||
Sbjct: 65791 gcacatgcacatgcacatgc 65772



to top

>emb|AJ422119.1|TAE422119 Triticum aestivum mRNA for xylanase inhibitor protein I (xipI gene)
          Length = 915

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 367 tacgccgccgtccacttgtcccac 390
           ||||||||||||||||||||||||
Sbjct: 725 tacgccgccgtccacttgtcccac 702



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 85/106 (80%)
 Strand = Plus / Minus

                                                                       
Query: 197 agctgctgtaatttgtccgcttgtcctcgtaacgttcccagaccatgaccccgccatagt 256
           |||||||||| || ||| |||||||   ||| || ||||||| |||||  ||||| ||||
Sbjct: 895 agctgctgtagttggtctgcttgtcgaagtatcggtcccagagcatgatgccgccgtagt 836

                                                         
Query: 257 tggccgccttctgcaccacctgtatgacgccgtagtagaggttctt 302
           || ||  ||||||| ||||| |   |||||||||||||| ||||||
Sbjct: 835 tgtccttcttctgcgccaccggcgcgacgccgtagtagacgttctt 790



to top

>gb|AC013549.9| Homo sapiens chromosome 11, clone RP11-47J17, complete sequence
          Length = 163180

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             ||||||||||||||||||||||||
Sbjct: 99803 gcacatgcacatgcacatgcacat 99780



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             ||||| |||||||||||||||||||||
Sbjct: 99809 gcacacgcacatgcacatgcacatgca 99783



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             |||||||||||||||||| |||||
Sbjct: 99797 gcacatgcacatgcacattcacat 99774



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                        
Query: 232      tcccagaccatgaccccgccatagttggccgccttctgca 271
                ||||||| |||||  ||||| |||||||||||||||||||
Sbjct: 26162457 tcccagatcatgaagccgccgtagttggccgccttctgca 26162418



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 367      tacgccgccgtccacttgtcccac 390
                ||||||||||||||| ||||||||
Sbjct: 26162298 tacgccgccgtccacctgtcccac 26162275



to top

>gb|DP000027.1| Rattus norvegicus target 1 genomic scaffold
          Length = 1888123

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                       
Query: 99      acatgcacatgcacatgcacatgc 122
               ||||||||||||||||||||||||
Sbjct: 1244991 acatgcacatgcacatgcacatgc 1245014



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 98      cacatgcacatgcacatgcacatgca 123
               |||||| |||||||||||||||||||
Sbjct: 1244984 cacatgaacatgcacatgcacatgca 1245009



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 97      gcacatgcacatgcacatgc 116
               ||||||||||||||||||||
Sbjct: 1244995 gcacatgcacatgcacatgc 1245014



to top

>dbj|AK111717.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023022A01, full
           insert sequence
          Length = 1165

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 232 tcccagaccatgaccccgccatagttggccgccttctgca 271
           ||||||| |||||  ||||| |||||||||||||||||||
Sbjct: 944 tcccagatcatgaagccgccgtagttggccgccttctgca 905



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 367 tacgccgccgtccacttgtcccac 390
           ||||||||||||||| ||||||||
Sbjct: 785 tacgccgccgtccacctgtcccac 762



to top

>dbj|AP004339.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0519E12
          Length = 152448

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                     
Query: 232   tcccagaccatgaccccgccatagttggccgccttctgca 271
             ||||||| |||||  ||||| |||||||||||||||||||
Sbjct: 54315 tcccagatcatgaagccgccgtagttggccgccttctgca 54276



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 367   tacgccgccgtccacttgtcccac 390
             ||||||||||||||| ||||||||
Sbjct: 54156 tacgccgccgtccacctgtcccac 54133



to top

>emb|X95927.1|RNCFTR7 R.norvegicus CFTR gene
          Length = 4787

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 99   acatgcacatgcacatgcacatgc 122
            ||||||||||||||||||||||||
Sbjct: 3999 acatgcacatgcacatgcacatgc 4022



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 98   cacatgcacatgcacatgcacatgca 123
            |||||| |||||||||||||||||||
Sbjct: 3992 cacatgaacatgcacatgcacatgca 4017



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 97   gcacatgcacatgcacatgc 116
            ||||||||||||||||||||
Sbjct: 4003 gcacatgcacatgcacatgc 4022



to top

>gb|AC154614.3| Mus musculus BAC clone RP23-255I2 from chromosome 14, complete sequence
          Length = 186187

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 98    cacatgcacatgcacatgcacatg 121
             ||||||||||||||||||||||||
Sbjct: 65805 cacatgcacatgcacatgcacatg 65828



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 65805 cacatgcacatgcacatgca 65824



to top

>gb|AC151998.6| Mus musculus BAC clone RP23-98L16 from chromosome 8, complete sequence
          Length = 219376

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 100    catgcacatgcacatgcacatgca 123
              ||||||||||||||||||||||||
Sbjct: 155972 catgcacatgcacatgcacatgca 155949



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 97     gcacatgcacatgcacatgca 117
              |||||||||||||||||||||
Sbjct: 155969 gcacatgcacatgcacatgca 155949



to top

>emb|CT030152.4| Mouse DNA sequence from clone RP24-323G18 on chromosome 13, complete
              sequence
          Length = 129293

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              ||||||||||||||||||||||||
Sbjct: 120165 gcacatgcacatgcacatgcacat 120188



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||||||| ||||||||
Sbjct: 120171 gcacatgcacatgcacatacacatgca 120197



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 101    atgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||
Sbjct: 120163 atgcacatgcacatgcacatgca 120185



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              |||||||||||| |||||||||||
Sbjct: 120177 gcacatgcacatacacatgcacat 120200



to top

>gb|AC168210.13| Mus musculus chromosome 5, clone RP24-72J20, complete sequence
          Length = 193750

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 99     acatgcacatgcacatgcacatgc 122
              ||||||||||||||||||||||||
Sbjct: 116178 acatgcacatgcacatgcacatgc 116155



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 97     gcacatgcacatgcacatgc 116
              ||||||||||||||||||||
Sbjct: 116174 gcacatgcacatgcacatgc 116155



to top

>gb|AC163685.4| Mus musculus BAC clone RP23-4M16 from chromosome 13, complete sequence
          Length = 242910

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              ||||||||||||||||||||||||
Sbjct: 169818 gcacatgcacatgcacatgcacat 169795



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 102    tgcacatgcacatgcacatgca 123
              ||||||||||||||||||||||
Sbjct: 169819 tgcacatgcacatgcacatgca 169798



to top

>gb|AC109147.19| Mus musculus chromosome 8, clone RP23-341D16, complete sequence
          Length = 184600

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 98    cacatgcacatgcacatgcacatgcag 124
             |||||||||||||||||||| ||||||
Sbjct: 53534 cacatgcacatgcacatgcatatgcag 53560



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              ||||||||||| ||||||||||||||
Sbjct: 173381 cacatgcacatacacatgcacatgca 173406



to top

>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence
          Length = 1130447

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 97     gcacatgcacatgcacatgcaca 119
              |||||||||||||||||||||||
Sbjct: 859544 gcacatgcacatgcacatgcaca 859566



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 101    atgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||
Sbjct: 859542 atgcacatgcacatgcacatgca 859564



to top

>gb|AC115968.10| Mus musculus chromosome 1, clone RP24-72P6, complete sequence
          Length = 229959

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 97    gcacatgcacatgcacatgcaca 119
             |||||||||||||||||||||||
Sbjct: 29909 gcacatgcacatgcacatgcaca 29931



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||| |||||||||||||||||||||
Sbjct: 29904 cacacgcacatgcacatgcacatgca 29929



to top

>gb|AC007928.7| Drosophila melanogaster clone BACR04O02, complete sequence
          Length = 176395

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||| ||||||||||||
Sbjct: 103503 gcacatgcacatgcgcatgcacatgca 103477



to top

>gb|AC132440.3| Mus musculus BAC clone RP23-239I24 from chromosome 8, complete sequence
          Length = 183218

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 97    gcacatgcacatgcacatgcaca 119
             |||||||||||||||||||||||
Sbjct: 68833 gcacatgcacatgcacatgcaca 68855



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             ||||| |||||||||||||||||||||
Sbjct: 68827 gcacaggcacatgcacatgcacatgca 68853



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             ||||||||||| |||||||||||||||
Sbjct: 68821 gcacatgcacaggcacatgcacatgca 68847



to top

>gb|AC115064.9| Mus musculus chromosome 1, clone RP24-401B18, complete sequence
          Length = 184893

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             ||||||||||| |||||||||||||||
Sbjct: 49436 gcacatgcacacgcacatgcacatgca 49410



to top

>gb|AC129561.13| Mus musculus chromosome 1, clone RP23-192P10, complete sequence
          Length = 217279

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              ||||||||||| |||||||||||||||
Sbjct: 127345 gcacatgcacacgcacatgcacatgca 127319



to top

>gb|AC147546.1| Rattus norvegicus chromosome 1 clone RP32-323A19 map q33, complete
             sequence
          Length = 118946

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 101   atgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||
Sbjct: 91029 atgcacatgcacatgcacatgca 91007



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 97    gcacatgcacatgcacatgcaca 119
             |||||||||||||||||||||||
Sbjct: 91027 gcacatgcacatgcacatgcaca 91005



to top

>gb|AC130541.4| Mus musculus BAC clone RP24-124P9 from chromosome 3, complete sequence
          Length = 191814

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             ||||||||||| |||||||||||||||
Sbjct: 37217 gcacatgcacacgcacatgcacatgca 37243



to top

>gb|AC132430.3| Mus musculus BAC clone RP23-208D22 from chromosome 9, complete sequence
          Length = 192991

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 97    gcacatgcacatgcacatgcaca 119
             |||||||||||||||||||||||
Sbjct: 96817 gcacatgcacatgcacatgcaca 96839



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 103   gcacatgcacatgcacatgca 123
             |||||||||||||||||||||
Sbjct: 96817 gcacatgcacatgcacatgca 96837



to top

>gb|AC124429.4| Mus musculus BAC clone RP24-239N4 from chromosome 13, complete sequence
          Length = 168858

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 98     cacatgcacatgcacatgcacat 120
              |||||||||||||||||||||||
Sbjct: 153982 cacatgcacatgcacatgcacat 154004



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 104    cacatgcacatgcacatgca 123
              ||||||||||||||||||||
Sbjct: 153982 cacatgcacatgcacatgca 154001



to top

>gb|AC114817.3| Mus musculus BAC clone RP23-28O15 from 14, complete sequence
          Length = 211624

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||| ||||||||||||||
Sbjct: 197818 gcacatgcacatacacatgcacatgca 197792



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              ||||||||||||||||| ||||||||
Sbjct: 197823 cacatgcacatgcacatacacatgca 197798



to top

>gb|AC104102.4| Mus musculus BAC clone RP24-377I13 from 15, complete sequence
          Length = 187284

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              ||||||||||| |||||||||||||||
Sbjct: 172950 gcacatgcacacgcacatgcacatgca 172976



to top

>gb|AC162946.4| Mus musculus BAC clone RP23-38M11 from chromosome 9, complete sequence
          Length = 183012

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 97    gcacatgcacatgcacatgcaca 119
             |||||||||||||||||||||||
Sbjct: 19626 gcacatgcacatgcacatgcaca 19604



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||| |||||||||||||||||||||
Sbjct: 19631 cacacgcacatgcacatgcacatgca 19606



to top

>emb|AJ627388.1| Yersinia pseudotuberculosis adhesion pathogenicity island (YAPI),
             complete sequence, strain 32777
          Length = 102752

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 97    gcacatgcacatgcacatgcaca 119
             |||||||||||||||||||||||
Sbjct: 64731 gcacatgcacatgcacatgcaca 64753



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 102   tgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||
Sbjct: 64730 tgcacatgcacatgcacatgca 64751



to top

>emb|AL671990.5| Mouse DNA sequence from clone RP23-41A24 on chromosome X, complete
             sequence
          Length = 204483

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             ||||||||||| |||||||||||||||
Sbjct: 29485 gcacatgcacacgcacatgcacatgca 29511



to top

>emb|BX647858.1|HSM808004 Homo sapiens genomic DNA; cDNA DKFZp313K1416 (from clone
           DKFZp313K1416)
          Length = 2410

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 98  cacatgcacatgcacatgcacat 120
           |||||||||||||||||||||||
Sbjct: 430 cacatgcacatgcacatgcacat 408



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 104 cacatgcacatgcacatgca 123
           ||||||||||||||||||||
Sbjct: 430 cacatgcacatgcacatgca 411



to top

>emb|AL845158.5| Mouse DNA sequence from clone RP23-147E6 on chromosome 4 Contains a
              component of oligomeric golgi complex 1 (Cog5) pseudogene
              and part of the Ptprd gene for receptor type protein
              tyrosine phosphatase D, complete sequence
          Length = 198523

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              ||||||||||| |||||||||||||||
Sbjct: 157146 gcacatgcacacgcacatgcacatgca 157172



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              ||||||||||||||||| |||||||||
Sbjct: 157140 gcacatgcacatgcacacgcacatgca 157166



to top

>gb|AC022018.10| Homo sapiens chromosome 10 clone RP11-214N15, complete sequence
          Length = 159617

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 97    gcacatgcacatgcacatgcaca 119
             |||||||||||||||||||||||
Sbjct: 69413 gcacatgcacatgcacatgcaca 69391



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 103   gcacatgcacatgcacatgca 123
             |||||||||||||||||||||
Sbjct: 69413 gcacatgcacatgcacatgca 69393



to top

>gb|AC107326.4| Drosophila melanogaster X BAC RP98-33A8 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 177096

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 101   atgcacatgcacatgcacatgca 123
             |||||||||||||||||||||||
Sbjct: 48162 atgcacatgcacatgcacatgca 48140



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             ||||||||||||||||||||| |||||
Sbjct: 48160 gcacatgcacatgcacatgcatatgca 48134



to top

>gb|AC009126.2| Homo sapiens chromosome 5 clone RP11-496M2, complete sequence
          Length = 177978

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 98    cacatgcacatgcacatgcacat 120
             |||||||||||||||||||||||
Sbjct: 15885 cacatgcacatgcacatgcacat 15863



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 15885 cacatgcacatgcacatgca 15866



to top

>gb|AC092239.1|AC092239 Drosophila melanogaster, chromosome 2L, region 25F-26X, BAC clone
             BACR48E14, complete sequence
          Length = 166441

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             ||||||||||| |||||||||||||||
Sbjct: 49575 gcacatgcacacgcacatgcacatgca 49549



to top

>gb|AC008906.5|AC008906 Homo sapiens chromosome 5 clone CTD-2260A17, complete sequence
          Length = 151801

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 98    cacatgcacatgcacatgcacat 120
             |||||||||||||||||||||||
Sbjct: 88742 cacatgcacatgcacatgcacat 88720



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 88742 cacatgcacatgcacatgca 88723



to top

>gb|AC061965.16| Homo sapiens chromosome 15, clone RP11-37J13, complete sequence
          Length = 169399

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             |||||||||||| ||||||||||||||
Sbjct: 14120 gcacatgcacatacacatgcacatgca 14094



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||||||||||||||| ||||||||
Sbjct: 14125 cacatgcacatgcacatacacatgca 14100



to top

>gb|AC104417.14| Homo sapiens chromosome 8, clone RP11-953B20, complete sequence
          Length = 186063

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 98    cacatgcacatgcacatgcacatgcag 124
             ||||| |||||||||||||||||||||
Sbjct: 43140 cacatccacatgcacatgcacatgcag 43166



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             ||||||||| ||||||||||||||
Sbjct: 43587 gcacatgcaaatgcacatgcacat 43610



to top

>gb|AC009073.8|AC009073 Homo sapiens chromosome 16 clone RP11-31O11, complete sequence
          Length = 177978

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 98    cacatgcacatgcacatgcacat 120
             |||||||||||||||||||||||
Sbjct: 15885 cacatgcacatgcacatgcacat 15863



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 15885 cacatgcacatgcacatgca 15866



to top

>emb|AL844579.10| Mouse DNA sequence from clone RP23-219M22 on chromosome 2, complete
             sequence
          Length = 103290

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 98    cacatgcacatgcacatgcacat 120
             |||||||||||||||||||||||
Sbjct: 42287 cacatgcacatgcacatgcacat 42265



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 42287 cacatgcacatgcacatgca 42268



to top

>gb|AC154311.2| Mus musculus BAC clone RP23-359C9 from 16, complete sequence
          Length = 194103

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 97    gcacatgcacatgcacatgcaca 119
             |||||||||||||||||||||||
Sbjct: 58117 gcacatgcacatgcacatgcaca 58095



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 103   gcacatgcacatgcacatgca 123
             |||||||||||||||||||||
Sbjct: 58117 gcacatgcacatgcacatgca 58097



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             ||||||||||||||||| ||||||
Sbjct: 58111 gcacatgcacatgcacacgcacat 58088



to top

>emb|BX469898.9| Zebrafish DNA sequence from clone DKEY-180H12 in linkage group 18,
             complete sequence
          Length = 185729

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             ||||||||||||||||| |||||||||
Sbjct: 44185 gcacatgcacatgcacacgcacatgca 44211



to top

>gb|AC110033.9| Mus musculus chromosome 1, clone RP23-117O18, complete sequence
          Length = 260404

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             ||||||||||| |||||||||||||||
Sbjct: 39374 gcacatgcacacgcacatgcacatgca 39400



to top

>gb|AC102758.10| Mus musculus chromosome 7, clone RP24-200F21, complete sequence
          Length = 181057

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              ||||||||||||||||| |||||||||
Sbjct: 168219 gcacatgcacatgcacacgcacatgca 168193



to top

>gb|AE003704.3| Drosophila melanogaster chromosome 3R, section 42 of 118 of the complete
              sequence
          Length = 220679

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||| ||||||||||||
Sbjct: 202200 gcacatgcacatgcgcatgcacatgca 202226



to top

>gb|AE003611.3| Drosophila melanogaster chromosome 2L, section 20 of 83 of the complete
              sequence
          Length = 260731

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              ||||||||||| |||||||||||||||
Sbjct: 175533 gcacatgcacacgcacatgcacatgca 175507



to top

>gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 of 74 of the complete
              sequence
          Length = 304204

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 101    atgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||
Sbjct: 110472 atgcacatgcacatgcacatgca 110450



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              ||||||||||||||||||||| |||||
Sbjct: 110470 gcacatgcacatgcacatgcatatgca 110444



to top

>gb|AC108796.10| Mus musculus chromosome 1, clone RP23-349L18, complete sequence
          Length = 188713

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             ||||||||||| |||||||||||||||
Sbjct: 53893 gcacatgcacacgcacatgcacatgca 53919



to top

>gb|AC140839.9| Mus musculus chromosome 3, clone RP24-316D12, complete sequence
          Length = 168722

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             ||||||||||| |||||||||||||||
Sbjct: 57411 gcacatgcacacgcacatgcacatgca 57385



to top

>gb|AC159965.5| Mus musculus chromosome 15, clone RP23-471C16, complete sequence
          Length = 173156

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             ||||||||||| |||||||||||||||
Sbjct: 93687 gcacatgcacacgcacatgcacatgca 93713



to top

>gb|AC158587.3| Mus musculus chromosome 7, clone RP24-156F13, complete sequence
          Length = 152262

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             ||||||||||||||||| |||||||||
Sbjct: 24281 gcacatgcacatgcacacgcacatgca 24307



to top

>gb|AC171680.5| Mus musculus chromosome 7, clone RP23-146B24, complete sequence
          Length = 200031

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 97     gcacatgcacatgcacatgcaca 119
              |||||||||||||||||||||||
Sbjct: 139469 gcacatgcacatgcacatgcaca 139491



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 103    gcacatgcacatgcacatgca 123
              |||||||||||||||||||||
Sbjct: 139469 gcacatgcacatgcacatgca 139489



to top

>emb|AL671935.30| Mouse DNA sequence from clone RP23-421J13 on chromosome X, complete
              sequence
          Length = 194258

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              |||||||||||||| ||||||||||||
Sbjct: 185772 gcacatgcacatgcgcatgcacatgca 185746



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              ||||||||||||||||||| ||||||
Sbjct: 185777 cacatgcacatgcacatgcgcatgca 185752



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 98     cacatgcacatgcacatgcacatgc 122
              ||||| |||||||||||||||||||
Sbjct: 185783 cacatacacatgcacatgcacatgc 185759



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              |||||||| |||||||||||||||
Sbjct: 185766 gcacatgcgcatgcacatgcacat 185743



to top

>emb|AL591417.9| Mouse DNA sequence from clone RP23-272C1 on chromosome 11, complete
            sequence
          Length = 131385

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 97   gcacatgcacatgcacatgcaca 119
            |||||||||||||||||||||||
Sbjct: 8084 gcacatgcacatgcacatgcaca 8106



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 102  tgcacatgcacatgcacatgca 123
            ||||||||||||||||||||||
Sbjct: 8083 tgcacatgcacatgcacatgca 8104



to top

>gb|AC005333.1|AC005333 Drosophila melanogaster DNA sequence (P1s DS06477 (D116) and DS03026
             (D126)), complete sequence
          Length = 94797

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             ||||||||||| |||||||||||||||
Sbjct: 46974 gcacatgcacacgcacatgcacatgca 47000



to top

>emb|AL713918.22| Mouse DNA sequence from clone RP23-350D7 on chromosome 4, complete
             sequence
          Length = 180282

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             ||||||||||| |||||||||||||||
Sbjct: 86617 gcacatgcacacgcacatgcacatgca 86643



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||||||||||||||| |||||||||
Sbjct: 86612 cacatgcacatgcacacgcacatgca 86637



to top

>gb|AC151735.3| Mus musculus BAC clone RP23-24D16 from 9, complete sequence
          Length = 201762

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 97     gcacatgcacatgcacatgcaca 119
              |||||||||||||||||||||||
Sbjct: 161188 gcacatgcacatgcacatgcaca 161166



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              |||| |||||||||||||||||||||
Sbjct: 161193 cacacgcacatgcacatgcacatgca 161168



to top

>gb|AC122908.4| Mus musculus BAC clone RP23-51D10 from 1, complete sequence
          Length = 208926

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 97     gcacatgcacatgcacatgcacatgca 123
              ||||||||||| |||||||||||||||
Sbjct: 199208 gcacatgcacacgcacatgcacatgca 199182



to top

>gb|AC154344.1| Mus musculus BAC clone RP23-226G16 from 16, complete sequence
          Length = 171340

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 97     gcacatgcacatgcacatgcaca 119
              |||||||||||||||||||||||
Sbjct: 116938 gcacatgcacatgcacatgcaca 116960



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 101    atgcacatgcacatgcacatgca 123
              |||||||||||||||||||||||
Sbjct: 116936 atgcacatgcacatgcacatgca 116958



to top

>emb|AL713990.16| Mouse DNA sequence from clone RP23-224N1 on chromosome X, complete
             sequence
          Length = 163330

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 97    gcacatgcacatgcacatgcaca 119
             |||||||||||||||||||||||
Sbjct: 11303 gcacatgcacatgcacatgcaca 11325



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||| |||||||||||||||||||||
Sbjct: 11298 cacaggcacatgcacatgcacatgca 11323



to top

>gb|DQ221252.1| Tetraodon nigroviridis voltage-gated sodium channel Nav1.4b (Nav1.4b)
            gene, complete cds
          Length = 14067

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 98   cacatgcacatgcacatgcacat 120
            |||||||||||||||||||||||
Sbjct: 8258 cacatgcacatgcacatgcacat 8280



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 104  cacatgcacatgcacatgca 123
            ||||||||||||||||||||
Sbjct: 8258 cacatgcacatgcacatgca 8277



to top

>gb|AC167022.4| Mus musculus BAC clone RP23-183A4 from chromosome 8, complete sequence
          Length = 224462

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 98    cacatgcacatgcacatgcacatgcag 124
             |||||||||||||||||||| ||||||
Sbjct: 62731 cacatgcacatgcacatgcatatgcag 62705



to top

>emb|AL845280.4| Mouse DNA sequence from clone RP23-265L1 on chromosome X, complete
             sequence
          Length = 142846

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 97    gcacatgcacatgcacatgcacatgca 123
             ||||||||||||||| |||||||||||
Sbjct: 73673 gcacatgcacatgcaaatgcacatgca 73699



to top

>emb|AL626774.23| Mouse DNA sequence from clone RP23-198O15 on chromosome 4, complete
             sequence
          Length = 181545

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 98    cacatgcacatgcacatgcacat 120
             |||||||||||||||||||||||
Sbjct: 57207 cacatgcacatgcacatgcacat 57229



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 57207 cacatgcacatgcacatgca 57226



to top

>gb|AC140979.17| Mus musculus chromosome 1, clone RP23-307M11, complete sequence
          Length = 209748

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 97    gcacatgcacatgcacatgcaca 119
             |||||||||||||||||||||||
Sbjct: 18836 gcacatgcacatgcacatgcaca 18814



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||| |||||||||||||||||||||
Sbjct: 18841 cacacgcacatgcacatgcacatgca 18816



to top

>emb|AL021067.1|DMC123F11 Drosophila melanogaster cosmid clone 123F11
          Length = 23109

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 101 atgcacatgcacatgcacatgca 123
           |||||||||||||||||||||||
Sbjct: 490 atgcacatgcacatgcacatgca 468



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 97  gcacatgcacatgcacatgcacatgca 123
           ||||||||||||||||||||| |||||
Sbjct: 488 gcacatgcacatgcacatgcatatgca 462



to top

>gb|AC110560.11| Mus musculus chromosome 3, clone RP23-254K1, complete sequence
          Length = 156067

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 98   cacatgcacatgcacatgcaca 119
            ||||||||||||||||||||||
Sbjct: 2462 cacatgcacatgcacatgcaca 2483



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 104  cacatgcacatgcacatgca 123
            ||||||||||||||||||||
Sbjct: 2462 cacatgcacatgcacatgca 2481



to top

>gb|AC161269.4| Mus musculus BAC clone RP23-120K16 from chromosome 15, complete
             sequence
          Length = 206234

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||||||||||||||| ||||||||
Sbjct: 99664 cacatgcacatgcacatacacatgca 99639



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 97    gcacatgcacatgcacatgcacat 120
             |||||||||||| |||||||||||
Sbjct: 99659 gcacatgcacatacacatgcacat 99636



to top

>gb|AC101716.6| Mus musculus chromosome 7, clone RP23-287I20, complete sequence
          Length = 182151

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              ||||| ||||||||||||||||||||
Sbjct: 151537 cacatacacatgcacatgcacatgca 151512



to top

>gb|AC161480.9| Mus musculus chromosome 15, clone RP23-404I10, complete sequence
          Length = 187202

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 98     cacatgcacatgcacatgcaca 119
              ||||||||||||||||||||||
Sbjct: 157568 cacatgcacatgcacatgcaca 157589



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 104    cacatgcacatgcacatgca 123
              ||||||||||||||||||||
Sbjct: 157568 cacatgcacatgcacatgca 157587



to top

>gb|AC008097.5| Drosophila melanogaster clone BACR20D06, complete sequence
          Length = 185670

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 97     gcacatgcacatgcacatgcac 118
              ||||||||||||||||||||||
Sbjct: 183297 gcacatgcacatgcacatgcac 183318



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 102    tgcacatgcacatgcacatgca 123
              ||||||||||||||||||||||
Sbjct: 183296 tgcacatgcacatgcacatgca 183317



to top

>gb|AC148336.4| Mus musculus BAC clone RP23-21J15 from chromosome 18, complete sequence
          Length = 238060

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 98     cacatgcacatgcacatgcaca 119
              ||||||||||||||||||||||
Sbjct: 234459 cacatgcacatgcacatgcaca 234480



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 104    cacatgcacatgcacatgca 123
              ||||||||||||||||||||
Sbjct: 234459 cacatgcacatgcacatgca 234478



to top

>gb|DQ415921.1| Cleome spinosa clone BAC Cs2, complete sequence
          Length = 132380

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 99     acatgcacatgcacatgcacat 120
              ||||||||||||||||||||||
Sbjct: 101366 acatgcacatgcacatgcacat 101345



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 100    catgcacatgcacatgcacatgca 123
              |||| |||||||||||||||||||
Sbjct: 101371 catgtacatgcacatgcacatgca 101348



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              |||||||||||||||||| |||||
Sbjct: 101362 gcacatgcacatgcacatacacat 101339



to top

>gb|AC162459.2| Mus musculus chromosome 3, clone RP23-80A8, complete sequence
          Length = 207515

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              |||||||||||||||| |||||||||
Sbjct: 180083 cacatgcacatgcacaagcacatgca 180108



to top

>gb|AC156620.10| Mus musculus chromosome 5, clone RP23-80G18, complete sequence
          Length = 248320

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 94     caagcacatgcacatgcacatgcacatgca 123
              |||||||| ||||||||||| |||||||||
Sbjct: 218766 caagcacaagcacatgcacaggcacatgca 218737



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 94     caagcacatgcacatgcacatgcaca 119
              |||||||||||||| |||||||||||
Sbjct: 218760 caagcacatgcacaggcacatgcaca 218735



to top

>gb|AC109204.21| Mus musculus chromosome 17, clone RP23-55J9, complete sequence
          Length = 245496

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 98   cacatgcacatgcacatgcaca 119
            ||||||||||||||||||||||
Sbjct: 5695 cacatgcacatgcacatgcaca 5674



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 104  cacatgcacatgcacatgca 123
            ||||||||||||||||||||
Sbjct: 5695 cacatgcacatgcacatgca 5676



to top

>gb|AC165344.3| Mus musculus BAC clone RP23-390P7 from chromosome 16, complete sequence
          Length = 193532

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 98     cacatgcacatgcacatgcaca 119
              ||||||||||||||||||||||
Sbjct: 119761 cacatgcacatgcacatgcaca 119740



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 104    cacatgcacatgcacatgca 123
              ||||||||||||||||||||
Sbjct: 119761 cacatgcacatgcacatgca 119742



to top

>gb|AC129567.8| Mus musculus chromosome 8, clone RP23-50L10, complete sequence
          Length = 228046

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 97    gcacatgcacatgcacatgcac 118
             ||||||||||||||||||||||
Sbjct: 88701 gcacatgcacatgcacatgcac 88722



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 103   gcacatgcacatgcacatgca 123
             |||||||||||||||||||||
Sbjct: 88701 gcacatgcacatgcacatgca 88721



to top

>gb|AC101796.8| Mus musculus chromosome 1, clone RP24-206P18, complete sequence
          Length = 171181

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 43169 cacatgcacatgcacatgcaca 43190



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 43169 cacatgcacatgcacatgca 43188



to top

>gb|AC139940.5| Mus musculus chromosome 15, clone RP23-468K16, complete sequence
          Length = 212183

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 33272 cacatgcacatgcacatgcaca 33293



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 33272 cacatgcacatgcacatgca 33291



to top

>gb|AC138093.7| Mus musculus chromosome 16, clone RP24-559J21, complete sequence
          Length = 123569

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 74233 cacatgcacatgcacatgcaca 74254



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 74233 cacatgcacatgcacatgca 74252



to top

>gb|AC107667.12| Mus musculus chromosome 3, clone RP23-187C2, complete sequence
          Length = 229632

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 98     cacatgcacatgcacatgcaca 119
              ||||||||||||||||||||||
Sbjct: 106204 cacatgcacatgcacatgcaca 106183



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 104    cacatgcacatgcacatgca 123
              ||||||||||||||||||||
Sbjct: 106204 cacatgcacatgcacatgca 106185



to top

>emb|CT009736.8| Mouse DNA sequence from clone RP23-99F22 on chromosome 17, complete
             sequence
          Length = 210326

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 26450 cacatgcacatgcacatgcaca 26429



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 26450 cacatgcacatgcacatgca 26431



to top

>gb|AC124728.5| Mus musculus BAC clone RP23-470C22 from chromosome 6, complete sequence
          Length = 183845

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 98     cacatgcacatgcacatgcaca 119
              ||||||||||||||||||||||
Sbjct: 141307 cacatgcacatgcacatgcaca 141328



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              ||||| ||||||||||||||||||||
Sbjct: 141301 cacatacacatgcacatgcacatgca 141326



to top

>gb|AC138768.3| Mus musculus BAC clone RP24-465E14 from chromosome 18, complete
             sequence
          Length = 158065

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 51571 cacatgcacatgcacatgcaca 51550



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 51571 cacatgcacatgcacatgca 51552



to top

>gb|AC114821.4| Mus musculus BAC clone RP23-72K1 from chromosome 1, complete sequence
          Length = 197978

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 97    gcacatgcacatgcacatgcacatgc 122
             ||||||||| ||||||||||||||||
Sbjct: 72500 gcacatgcaaatgcacatgcacatgc 72525



to top

>gb|AC122184.4| Mus musculus BAC clone RP23-16C12 from chromosome 7, complete sequence
          Length = 222122

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              ||||||||||||||| ||||||||||
Sbjct: 148043 cacatgcacatgcacgtgcacatgca 148018



to top

>gb|AC127290.3| Mus musculus BAC clone RP23-364F13 from chromosome 5, complete sequence
          Length = 187121

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 94     caagcacatgcacatgcacatg 115
              ||||||||||||||||||||||
Sbjct: 101713 caagcacatgcacatgcacatg 101734



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 98     cacatgcacatgcacatgcacatg 121
              |||| |||||||||||||||||||
Sbjct: 101711 cacaagcacatgcacatgcacatg 101734



to top

>gb|AC124184.3| Mus musculus BAC clone RP23-227N23 from 10, complete sequence
          Length = 182135

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 98     cacatgcacatgcacatgcaca 119
              ||||||||||||||||||||||
Sbjct: 147254 cacatgcacatgcacatgcaca 147275



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 104    cacatgcacatgcacatgca 123
              ||||||||||||||||||||
Sbjct: 147254 cacatgcacatgcacatgca 147273



to top

>gb|AC121857.2| Mus musculus BAC clone RP24-98A9 from 1, complete sequence
          Length = 171124

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 97     gcacatgcacatgcacatgcac 118
              ||||||||||||||||||||||
Sbjct: 157732 gcacatgcacatgcacatgcac 157753



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 102    tgcacatgcacatgcacatgca 123
              ||||||||||||||||||||||
Sbjct: 157731 tgcacatgcacatgcacatgca 157752



to top

>gb|AC113316.14| Mus musculus chromosome 5, clone RP23-441I24, complete sequence
          Length = 247892

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 98     cacatgcacatgcacatgcaca 119
              ||||||||||||||||||||||
Sbjct: 165924 cacatgcacatgcacatgcaca 165945



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 104    cacatgcacatgcacatgca 123
              ||||||||||||||||||||
Sbjct: 165924 cacatgcacatgcacatgca 165943



to top

>gb|AC021218.9| Homo sapiens BAC clone RP11-525O1 from 7, complete sequence
          Length = 159482

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 27288 cacatgcacatgcacatgcaca 27267



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 27288 cacatgcacatgcacatgca 27269



to top

>ref|XM_728614.1| Plasmodium chabaudi chabaudi hypothetical protein (PC403997.00.0)
           partial mRNA
          Length = 210

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 97  gcacatgcacatgcacatgcacatgc 122
           |||||||||||||| |||||||||||
Sbjct: 134 gcacatgcacatgcgcatgcacatgc 159



to top

>gb|AC102409.10| Mus musculus chromosome 18, clone RP24-365B20, complete sequence
          Length = 137137

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 76350 cacatgcacatgcacatgcaca 76329



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 76350 cacatgcacatgcacatgca 76331



to top

>gb|AC164001.4| Mus musculus chromosome 7, clone RP23-332G12, complete sequence
          Length = 190345

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||| ||||||||||||||||||||
Sbjct: 57936 cacatacacatgcacatgcacatgca 57961



to top

>gb|AC122167.8| Medicago truncatula clone mth1-10d10, complete sequence
          Length = 93126

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 99    acatgcacatgcacatgcacat 120
             ||||||||||||||||||||||
Sbjct: 10195 acatgcacatgcacatgcacat 10216



to top

>gb|AC163994.4| Mus musculus chromosome 1, clone RP24-132H2, complete sequence
          Length = 160383

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 64270 cacatgcacatgcacatgcaca 64291



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 64270 cacatgcacatgcacatgca 64289



to top

>emb|Z81008.1|HS369O24 Human DNA sequence from clone RP3-369O24 on chromosome X Contains part of
              the ODZ1 gene for odz, odd Oz/ten-m homolog 1(Drosophila),
              complete sequence
          Length = 110180

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 98     cacatgcacatgcacatgcaca 119
              ||||||||||||||||||||||
Sbjct: 107146 cacatgcacatgcacatgcaca 107167



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              ||||| ||||||||||||||||||||
Sbjct: 107140 cacatacacatgcacatgcacatgca 107165



to top

>gb|AC158571.3| Mus musculus chromosome 3, clone RP23-117E23, complete sequence
          Length = 197545

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 98     cacatgcacatgcacatgcaca 119
              ||||||||||||||||||||||
Sbjct: 156696 cacatgcacatgcacatgcaca 156717



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 104    cacatgcacatgcacatgca 123
              ||||||||||||||||||||
Sbjct: 156696 cacatgcacatgcacatgca 156715



to top

>gb|AC158575.3| Mus musculus chromosome 7, clone RP23-275H16, complete sequence
          Length = 221489

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 37710 cacatgcacatgcacatgcaca 37689



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 37710 cacatgcacatgcacatgca 37691



to top

>gb|AC117661.20| Mus musculus chromosome 6, clone RP23-343P1, complete sequence
          Length = 180209

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 30422 cacatgcacatgcacatgcaca 30401



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 30422 cacatgcacatgcacatgca 30403



to top

>gb|AC162391.9| Mus musculus 6 BAC RP23-126H2 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 209173

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              ||||||||||| ||||||||||||||
Sbjct: 183613 cacatgcacatacacatgcacatgca 183638



to top

>emb|AL646096.8| Mouse DNA sequence from clone RP23-176J13 on chromosome 11 Contains the
             5' end of the Scpep1 gene for serine carboxypeptidase 1,
             two transcription elongation factor B (SIII) polypeptide 2
             (Tceb2) pseudogenes, four novel genes (incl.
             A930013B10Rik), the Coil gene for coilin, the Trim25 gene
             for tripartite motif protein 25 and the Dgke gene for
             diacylglycerol kinase epsilon, complete sequence
          Length = 171512

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 96100 cacatgcacatgcacatgcaca 96079



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 96100 cacatgcacatgcacatgca 96081



to top

>gb|AC078925.18| Homo sapiens 12q BAC RP11-76C10 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 153284

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 98     cacatgcacatgcacatgcaca 119
              ||||||||||||||||||||||
Sbjct: 115612 cacatgcacatgcacatgcaca 115591



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 104    cacatgcacatgcacatgca 123
              ||||||||||||||||||||
Sbjct: 115612 cacatgcacatgcacatgca 115593



to top

>emb|AL714006.13| Mouse DNA sequence from clone RP23-173E15 on chromosome 4 Contains a
             novel gene and the 3' end of a novel gene, complete
             sequence
          Length = 196097

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 14871 cacatgcacatgcacatgcaca 14850



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 14871 cacatgcacatgcacatgca 14852



to top

>gb|AC113029.23| Mus musculus chromosome 5, clone RP23-206J17, complete sequence
          Length = 223809

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 94     caagcacatgcacatgcacatgcaca 119
              |||||||||||||| |||||||||||
Sbjct: 182132 caagcacatgcacaggcacatgcaca 182157



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 94     caagcacatgcacatgcacatgcacatgca 123
              |||||||| ||||||||||| |||||||||
Sbjct: 182126 caagcacaagcacatgcacaggcacatgca 182155



to top

>gb|AC155270.3| Mus musculus BAC clone RP23-195H19 from chromosome 12, complete sequence
          Length = 215502

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              |||||||||||||||| |||||||||
Sbjct: 178942 cacatgcacatgcacacgcacatgca 178917



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 97     gcacatgcacatgcacatgcacatg 121
              ||||||||||| |||||||||||||
Sbjct: 178937 gcacatgcacacgcacatgcacatg 178913



to top

>gb|AC009779.18| Homo sapiens 12 BAC RP11-644F5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 192550

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 35938 cacatgcacatgcacatgcaca 35917



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 35938 cacatgcacatgcacatgca 35919



to top

>emb|AL928605.22| Mouse DNA sequence from clone RP23-139P14 on chromosome 4, complete
              sequence
          Length = 209024

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 98     cacatgcacatgcacatgcaca 119
              ||||||||||||||||||||||
Sbjct: 186478 cacatgcacatgcacatgcaca 186499



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 104    cacatgcacatgcacatgca 123
              ||||||||||||||||||||
Sbjct: 186478 cacatgcacatgcacatgca 186497



to top

>gb|AC008603.7| Homo sapiens chromosome 5 clone CTB-107P3, complete sequence
          Length = 123866

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||||||||| |||||||||||||||
Sbjct: 78839 cacatgcacacgcacatgcacatgca 78814



to top

>gb|AC104340.10| Mus musculus chromosome 7, clone RP24-495M13, complete sequence
          Length = 170605

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 15011 cacatgcacatgcacatgcaca 15032



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 15011 cacatgcacatgcacatgca 15030



to top

>gb|AC099012.1| Drosophila melanogaster, chromosome 2R, region 56F-57X, BAC clone
             BACR23F24, complete sequence
          Length = 183592

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 97    gcacatgcacatgcacatgcac 118
             ||||||||||||||||||||||
Sbjct: 31529 gcacatgcacatgcacatgcac 31550



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 102   tgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||
Sbjct: 31528 tgcacatgcacatgcacatgca 31549



to top

>gb|AC092752.2| Genomic sequence for Mus musculus, clone RP23-51O3, complete sequence
          Length = 226416

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||| ||||||||||||||||||||
Sbjct: 15953 cacatacacatgcacatgcacatgca 15928



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 15947 cacatgcacatgcacatgcaca 15926



to top

>gb|AC149206.2| Medicago truncatula chromosome 2 BAC clone mte1-49n15, complete
             sequence
          Length = 113539

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 99    acatgcacatgcacatgcacat 120
             ||||||||||||||||||||||
Sbjct: 43483 acatgcacatgcacatgcacat 43504



to top

>dbj|AK043643.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched
            library, clone:A830014N07 product:unclassifiable, full
            insert sequence
          Length = 2863

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 98   cacatgcacatgcacatgcaca 119
            ||||||||||||||||||||||
Sbjct: 1025 cacatgcacatgcacatgcaca 1004



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 104  cacatgcacatgcacatgca 123
            ||||||||||||||||||||
Sbjct: 1025 cacatgcacatgcacatgca 1006



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 417      ggcgtcgtcgtagaacctgaca 438
                ||||||||||||||||||||||
Sbjct: 25771478 ggcgtcgtcgtagaacctgaca 25771499



to top

>gb|AY843546.1| Acacia brevispica microsatellite Ab15 sequence
          Length = 224

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 102 tgcacatgcacatgcacatgca 123
           ||||||||||||||||||||||
Sbjct: 193 tgcacatgcacatgcacatgca 214



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 97  gcacatgcacatgcacatgca 117
           |||||||||||||||||||||
Sbjct: 194 gcacatgcacatgcacatgca 214



to top

>gb|AC100738.8| Mus musculus chromosome 15, clone RP24-362K21, complete sequence
          Length = 128950

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||| |||||
Sbjct: 58627 cacatgcacatgcacatgcatatgca 58652



to top

>gb|AC155817.2| Mus musculus BAC clone RP23-473M8 from chromosome 12, complete sequence
          Length = 159497

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 29950 cacatgcacatgcacatgcaca 29929



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 29950 cacatgcacatgcacatgca 29931



to top

>gb|AC156015.2| Mus musculus BAC clone RP24-345H1 from chromosome 16, complete sequence
          Length = 154624

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 50006 cacatgcacatgcacatgcaca 49985



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 50006 cacatgcacatgcacatgca 49987



to top

>gb|AC007559.3| Homo sapiens BAC clone RP11-364J6 from 2, complete sequence
          Length = 156374

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||||||||| |||||||||||||||
Sbjct: 43745 cacatgcacacgcacatgcacatgca 43770



to top

>gb|AC012074.9| Homo sapiens BAC clone RP11-458N5 from 2, complete sequence
          Length = 197652

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 97     gcacatgcacatgcacatgcacatgc 122
              ||||| ||||||||||||||||||||
Sbjct: 168716 gcacacgcacatgcacatgcacatgc 168691



to top

>gb|AC139849.5| Mus musculus BAC clone RP23-84M17 from chromosome 7, complete sequence
          Length = 189942

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 30858 cacatgcacatgcacatgcaca 30837



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 30858 cacatgcacatgcacatgca 30839



to top

>dbj|AP004622.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0689E12
          Length = 147516

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 417   ggcgtcgtcgtagaacctgaca 438
             ||||||||||||||||||||||
Sbjct: 43689 ggcgtcgtcgtagaacctgaca 43710



to top

>emb|BX294656.8| Zebrafish DNA sequence from clone CH211-238M13, complete sequence
          Length = 162077

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 59327 cacatgcacatgcacatgcaca 59306



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 59327 cacatgcacatgcacatgca 59308



to top

>gb|AC154342.2| Mus musculus BAC clone RP23-227D10 from 17, complete sequence
          Length = 199709

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 62321 cacatgcacatgcacatgcaca 62300



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 62321 cacatgcacatgcacatgca 62302



to top

>gb|AC154244.2| Mus musculus BAC clone RP24-321P20 from 17, complete sequence
          Length = 172093

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||||||||||||||||||| |||||
Sbjct: 50462 cacatgcacatgcacatgcatatgca 50437



to top

>gb|AC122362.5| Mus musculus BAC clone RP23-430N1 from chromosome 6, complete sequence
          Length = 212275

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 98     cacatgcacatgcacatgcaca 119
              ||||||||||||||||||||||
Sbjct: 191335 cacatgcacatgcacatgcaca 191314



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 104    cacatgcacatgcacatgca 123
              ||||||||||||||||||||
Sbjct: 191335 cacatgcacatgcacatgca 191316



to top

>gb|AC150560.5| Mus musculus BAC clone RP23-16I14 from 15, complete sequence
          Length = 208801

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              ||||||||||||||||| ||||||||
Sbjct: 204101 cacatgcacatgcacatacacatgca 204076



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 97     gcacatgcacatgcacatgcacat 120
              |||||||||||| |||||||||||
Sbjct: 204096 gcacatgcacatacacatgcacat 204073



to top

>gb|AC154438.2| Mus musculus BAC clone RP23-178P20 from 16, complete sequence
          Length = 213575

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||||| |||||||||||||||||||
Sbjct: 55769 cacatgaacatgcacatgcacatgca 55744



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 99    acatgcacatgcacatgcaca 119
             |||||||||||||||||||||
Sbjct: 55762 acatgcacatgcacatgcaca 55742



to top

>gb|AC122495.4| Mus musculus BAC clone RP24-397P10 from 9, complete sequence
          Length = 175838

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              ||||||||||||||||||||| ||||
Sbjct: 129905 cacatgcacatgcacatgcacctgca 129880



to top

>gb|AC102012.7| Mus musculus chromosome 3, clone RP24-542B2, complete sequence
          Length = 155366

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||||||||||||||| |||||||||
Sbjct: 81073 cacatgcacatgcacaagcacatgca 81098



to top

>gb|AC105335.27| Mus musculus chromosome 5, clone RP23-377H14, complete sequence
          Length = 171789

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 63343 cacatgcacatgcacatgcaca 63364



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 63343 cacatgcacatgcacatgca 63362



to top

>gb|AC007189.6|AC007189 Homo sapiens, clone 19_A_8, complete sequence
          Length = 154589

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||||||||||||| |||||||||||
Sbjct: 39228 cacatgcacatgcaaatgcacatgca 39203



to top

>gb|AC174449.2| Mus musculus BAC clone RP23-338O19 from chromosome 6, complete
           sequence
          Length = 217169

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 98  cacatgcacatgcacatgcaca 119
           ||||||||||||||||||||||
Sbjct: 814 cacatgcacatgcacatgcaca 793



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 104 cacatgcacatgcacatgca 123
           ||||||||||||||||||||
Sbjct: 814 cacatgcacatgcacatgca 795



to top

>gb|AE003793.3| Drosophila melanogaster chromosome 2R, section 57 of 73 of the complete
              sequence
          Length = 271902

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 97     gcacatgcacatgcacatgcac 118
              ||||||||||||||||||||||
Sbjct: 125790 gcacatgcacatgcacatgcac 125811



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 102    tgcacatgcacatgcacatgca 123
              ||||||||||||||||||||||
Sbjct: 125789 tgcacatgcacatgcacatgca 125810



to top

>emb|AL359220.4|CNS05TEI Human chromosome 14 DNA sequence BAC R-855C23 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 196698

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              |||| |||||||||||||||||||||
Sbjct: 135317 cacacgcacatgcacatgcacatgca 135342



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 97     gcacatgcacatgcacatgca 117
              |||||||||||||||||||||
Sbjct: 135322 gcacatgcacatgcacatgca 135342



to top

>emb|AL049838.3|CNS0000C Human chromosome 14 DNA sequence BAC R-999E24 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 211723

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||||||||||||||| |||||||||
Sbjct: 34678 cacatgcacatgcacacgcacatgca 34703



to top

>emb|BX629359.1|CNS09SBT Tetraodon nigroviridis BAC sequence
          Length = 139693

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 98     cacatgcacatgcacatgcaca 119
              ||||||||||||||||||||||
Sbjct: 109011 cacatgcacatgcacatgcaca 109032



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 104    cacatgcacatgcacatgca 123
              ||||||||||||||||||||
Sbjct: 109011 cacatgcacatgcacatgca 109030



to top

>gb|AC116703.10| Mus musculus chromosome 6, clone RP23-16O17, complete sequence
          Length = 202915

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              ||||||||||| ||||||||||||||
Sbjct: 157476 cacatgcacatacacatgcacatgca 157451



to top

>gb|AC121139.20| Mus musculus chromosome 5, clone RP23-429G1, complete sequence
          Length = 206249

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||||||||| |||||||||||||||
Sbjct: 49736 cacatgcacacgcacatgcacatgca 49761



to top

>emb|AL691450.15| Mouse DNA sequence from clone RP23-20F9 on chromosome 2, complete
             sequence
          Length = 181372

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 37404 cacatgcacatgcacatgcaca 37383



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 37404 cacatgcacatgcacatgca 37385



to top

>gb|AC005286.1|AC005286 Drosophila melanogaster DNA sequence (P1s DS01995 (D179), DS03499
             (D217), and DS08132 (D174)), complete sequence
          Length = 173970

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 97    gcacatgcacatgcacatgcac 118
             ||||||||||||||||||||||
Sbjct: 37904 gcacatgcacatgcacatgcac 37925



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 102   tgcacatgcacatgcacatgca 123
             ||||||||||||||||||||||
Sbjct: 37903 tgcacatgcacatgcacatgca 37924



to top

>gb|AC140553.3| Mus musculus BAC clone RP24-71M17 from 1, complete sequence
          Length = 217538

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 97     gcacatgcacatgcacatgcacatgc 122
              ||||||||| ||||||||||||||||
Sbjct: 193426 gcacatgcaaatgcacatgcacatgc 193451



to top

>gb|AC127270.4| Mus musculus BAC clone RP23-453E16 from 12, complete sequence
          Length = 181004

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 99    acatgcacatgcacatgcacat 120
             ||||||||||||||||||||||
Sbjct: 40743 acatgcacatgcacatgcacat 40764



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||||| |||||||||||||||||||
Sbjct: 40736 cacatggacatgcacatgcacatgca 40761



to top

>gb|AC153819.5| Mus musculus 6 BAC RP23-445H14 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 199780

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||||||||||| |||||||||||||
Sbjct: 52801 cacatgcacatgaacatgcacatgca 52776



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 97    gcacatgcacatgcacatgcacatg 121
             ||||||| |||||||||||||||||
Sbjct: 52796 gcacatgaacatgcacatgcacatg 52772



to top

>emb|CT025592.14| Mouse DNA sequence from clone RP23-431J17 on chromosome 16, complete
             sequence
          Length = 215987

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||||| |||||||||||||||||||
Sbjct: 12432 cacatgaacatgcacatgcacatgca 12457



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 99    acatgcacatgcacatgcaca 119
             |||||||||||||||||||||
Sbjct: 12439 acatgcacatgcacatgcaca 12459



to top

>gb|AC170594.2| Mus musculus BAC clone RP24-425N5 from chromosome 17, complete
           sequence
          Length = 161769

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 98  cacatgcacatgcacatgcaca 119
           ||||||||||||||||||||||
Sbjct: 306 cacatgcacatgcacatgcaca 327



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 104 cacatgcacatgcacatgca 123
           ||||||||||||||||||||
Sbjct: 306 cacatgcacatgcacatgca 325



to top

>emb|AL772220.7| Mouse DNA sequence from clone RP23-409N18 on chromosome 4, complete
              sequence
          Length = 176159

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              |||||||||| |||||||||||||||
Sbjct: 156210 cacatgcacacgcacatgcacatgca 156185



to top

>emb|AL844900.3| Mouse DNA sequence from clone RP23-301L16 on chromosome X, complete
             sequence
          Length = 183256

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 33714 cacatgcacatgcacatgcaca 33735



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 33714 cacatgcacatgcacatgca 33733



to top

>gb|M23926.1|MUSIFN6A Mus musculus (clone pKK22) interferon-alpha 6 (IFN-alpha-6) gene,
           5' region
          Length = 812

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 98  cacatgcacatgcacatgcaca 119
           ||||||||||||||||||||||
Sbjct: 511 cacatgcacatgcacatgcaca 532



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 104 cacatgcacatgcacatgca 123
           ||||||||||||||||||||
Sbjct: 511 cacatgcacatgcacatgca 530



to top

>emb|AL671269.11| Mouse DNA sequence from clone RP23-143P22 on chromosome 4, complete
             sequence
          Length = 183416

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||| |||||||||||||||||||||
Sbjct: 70532 cacacgcacatgcacatgcacatgca 70507



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 97    gcacatgcacatgcacatgcac 118
             ||||||||||||||||||||||
Sbjct: 70527 gcacatgcacatgcacatgcac 70506



to top

>emb|AL772374.9| Mouse DNA sequence from clone RP23-27I23 on chromosome 4, complete
             sequence
          Length = 144574

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             ||||||||||||||||| ||||||||
Sbjct: 38537 cacatgcacatgcacatacacatgca 38562



to top

>emb|AL805969.13| Mouse DNA sequence from clone RP23-40L1 on chromosome 4, complete
             sequence
          Length = 252953

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 98    cacatgcacatgcacatgcaca 119
             ||||||||||||||||||||||
Sbjct: 27449 cacatgcacatgcacatgcaca 27470



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   cacatgcacatgcacatgca 123
             ||||||||||||||||||||
Sbjct: 27449 cacatgcacatgcacatgca 27468



to top

>emb|AL355792.8| Human DNA sequence from clone RP5-1123F10 on chromosome 11 Contains STSs
              and GSSs, complete sequence
          Length = 130116

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 98     cacatgcacatgcacatgcacatgca 123
              |||||||||||||||| |||||||||
Sbjct: 118140 cacatgcacatgcacacgcacatgca 118115



to top

>emb|AL606498.17| Mouse DNA sequence from clone RP23-197C15 on chromosome 11, complete
             sequence
          Length = 222330

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 98    cacatgcacatgcacatgcacatgca 123
             |||||||||||| |||||||||||||
Sbjct: 88707 cacatgcacatgaacatgcacatgca 88732



to top

>gb|AC022346.4| Drosophila melanogaster clone BACR22I24, complete sequence
          Length = 181052

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 99    acatgcacatgcacatgcaca 119
             |||||||||||||||||||||
Sbjct: 65856 acatgcacatgcacatgcaca 65836



to top

>gb|AC161376.2| Mus musculus BAC clone RP23-264M10 from chromosome 16, complete
             sequence
          Length = 199086

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 98    cacatgcacatgcacatgcacatgc 122
             |||||||||| ||||||||||||||
Sbjct: 19438 cacatgcacacgcacatgcacatgc 19414



to top

>gb|AC102656.28| Mus musculus chromosome 5, clone RP23-15G1, complete sequence
          Length = 227533

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 95     aagcacatgcacatgcacatgcaca 119
              |||||||||||||||| ||||||||
Sbjct: 163531 aagcacatgcacatgcgcatgcaca 163507



to top

>gb|AC154844.2| Mus musculus BAC clone RP23-46K13 from chromosome 16, complete sequence
          Length = 196946

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 91    aagcaagcacatgcacatgcacatgcaca 119
             ||||| ||||||||||||||||| |||||
Sbjct: 49013 aagcatgcacatgcacatgcacacgcaca 49041



to top

>gb|AC117807.7| Mus musculus chromosome 8, clone RP24-568P2, complete sequence
          Length = 175586

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 104   cacatgcacatgcacatgcag 124
             |||||||||||||||||||||
Sbjct: 54154 cacatgcacatgcacatgcag 54174



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 98    cacatgcacatgcacatgca 117
             ||||||||||||||||||||
Sbjct: 54154 cacatgcacatgcacatgca 54173



to top

>gb|AC139025.9| Mus musculus chromosome 8, clone RP23-426K13, complete sequence
          Length = 203230

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 104    cacatgcacatgcacatgcag 124
              |||||||||||||||||||||
Sbjct: 181556 cacatgcacatgcacatgcag 181536



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 98     cacatgcacatgcacatgca 117
              ||||||||||||||||||||
Sbjct: 181556 cacatgcacatgcacatgca 181537



to top

>gb|AC165961.2| Mus musculus BAC clone RP23-378M19 from chromosome 16, complete
             sequence
          Length = 211284

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 98    cacatgcacatgcacatgcacatgc 122
             ||||||||||||| |||||||||||
Sbjct: 64229 cacatgcacatgctcatgcacatgc 64253



to top

>gb|AC168275.4| Mus musculus 10 BAC RP23-350O21 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 188458

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 104   cacatgcacatgcacatgcag 124
             |||||||||||||||||||||
Sbjct: 45613 cacatgcacatgcacatgcag 45633



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 98    cacatgcacatgcacatgca 117
             ||||||||||||||||||||
Sbjct: 45613 cacatgcacatgcacatgca 45632



to top

>gb|AC168276.3| Mus musculus  BAC RP24-485I12 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 186675

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 104    cacatgcacatgcacatgcag 124
              |||||||||||||||||||||
Sbjct: 159516 cacatgcacatgcacatgcag 159536



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 98     cacatgcacatgcacatgca 117
              ||||||||||||||||||||
Sbjct: 159516 cacatgcacatgcacatgca 159535



to top

>gb|AC118021.13| Mus musculus chromosome 7, clone RP23-459P15, complete sequence
          Length = 196441

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 91   aagcaagcacatgcacatgcacatgcacatgca 123
            |||||||||||  |||||| |||||||||||||
Sbjct: 2204 aagcaagcacacccacatgaacatgcacatgca 2236



to top

>gb|AC166370.3| Mus musculus BAC clone RP23-20I24 from chromosome 9, complete sequence
          Length = 242229

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   tgcacatgcacatgcacatgc 122
             |||||||||||||||||||||
Sbjct: 69670 tgcacatgcacatgcacatgc 69690



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 97    gcacatgcacatgcacatgc 116
             ||||||||||||||||||||
Sbjct: 69671 gcacatgcacatgcacatgc 69690



to top

>gb|AC166368.3| Mus musculus BAC clone RP23-63I1 from chromosome 7, complete sequence
          Length = 242362

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 99     acatgcacatgcacatgcaca 119
              |||||||||||||||||||||
Sbjct: 114293 acatgcacatgcacatgcaca 114313



to top

>gb|AC167241.2| Mus musculus BAC clone RP24-560M14 from chromosome 17, complete
             sequence
          Length = 184079

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 99    acatgcacatgcacatgcacatgca 123
             ||||||||||| |||||||||||||
Sbjct: 33410 acatgcacatgtacatgcacatgca 33386



to top

>gb|AC161536.7| Mus musculus chromosome 5, clone RP23-340A18, complete sequence
          Length = 218835

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 95     aagcacatgcacatgcacatgcaca 119
              |||||||||||||||| ||||||||
Sbjct: 153156 aagcacatgcacatgcgcatgcaca 153180



to top

>ref|XM_991783.1| PREDICTED: Mus musculus centrosomal protein 164, transcript variant
           1 (Cep164), mRNA
          Length = 2428

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 98  cacatgcacatgcacatgcacatgc 122
           |||||||||| ||||||||||||||
Sbjct: 902 cacatgcacacgcacatgcacatgc 878



to top

>gb|AC107230.8| Mus musculus chromosome 18, clone RP23-238L23, complete sequence
          Length = 192286

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 99     acatgcacatgcacatgcacatgca 123
              ||||| |||||||||||||||||||
Sbjct: 165260 acatgtacatgcacatgcacatgca 165284



to top

>gb|AC109269.17| Mus musculus chromosome 1, clone RP23-325F17, complete sequence
          Length = 219191

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 97     gcacatgcacatgcacatgcacatg 121
              |||| ||||||||||||||||||||
Sbjct: 194593 gcacgtgcacatgcacatgcacatg 194617



to top

>emb|AJ418636.1|SAU418636 Sparus aurata satellite DNA, clone SAdi-IMBB05
          Length = 374

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 98  cacatgcacatgcacatgcac 118
           |||||||||||||||||||||
Sbjct: 39  cacatgcacatgcacatgcac 59



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 104 cacatgcacatgcacatgca 123
           ||||||||||||||||||||
Sbjct: 39  cacatgcacatgcacatgca 58



to top

>emb|AJ865197.1| Cocos nucifera microsatellite DNA, clone CnCir 96
          Length = 321

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 95  aagcacatgcacatgcacatgcaca 119
           ||||||||||||||||||| |||||
Sbjct: 253 aagcacatgcacatgcacacgcaca 229



to top

>ref|XM_387353.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG07177.1)
           partial mRNA
          Length = 2604

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 97  gcacatgcacatgcacatgcacatg 121
           ||||| |||||||||||||||||||
Sbjct: 157 gcacaggcacatgcacatgcacatg 181



to top

>gb|AC126055.4| Mus musculus BAC clone RP23-368O6 from chromosome 16, complete sequence
          Length = 197096

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 98     cacatgcacatgcacatgcacatgc 122
              |||||||||| ||||||||||||||
Sbjct: 152568 cacatgcacacgcacatgcacatgc 152544



to top

>gb|AC115825.11| Mus musculus chromosome 9, clone RP23-444E13, complete sequence
          Length = 192100

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 101   atgcacatgcacatgcacatg 121
             |||||||||||||||||||||
Sbjct: 91691 atgcacatgcacatgcacatg 91671



to top

>gb|AC109179.7| Mus musculus chromosome 18, clone RP23-382N7, complete sequence
          Length = 241644

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 99    acatgcacatgcacatgcacatgca 123
             ||||| |||||||||||||||||||
Sbjct: 71075 acatgtacatgcacatgcacatgca 71099


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,659,913
Number of Sequences: 3902068
Number of extensions: 3659913
Number of successful extensions: 98736
Number of sequences better than 10.0: 480
Number of HSP's better than 10.0 without gapping: 482
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 95529
Number of HSP's gapped (non-prelim): 2736
length of query: 457
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 435
effective length of database: 17,147,199,772
effective search space: 7459031900820
effective search space used: 7459031900820
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top