ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart36e02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF479051.1| Triticum aestivum early nodule-specific-like prot... 52 0.002
2ref|XM_525127.1| PREDICTED: Pan troglodytes similar to cryopyrin... 42 1.5
3gb|AY338199.1| Cercopithecus cephus cryopyrin (CIAS1) gene, part... 42 1.5
4gb|AY338197.1| Theropithecus gelada cryopyrin (CIAS1) gene, part... 42 1.5
5gb|AY338196.1| Gorilla gorilla cryopyrin (CIAS1) gene, partial cds 42 1.5
6gb|AY338200.1| Colobus guereza cryopyrin (CIAS1) gene, partial cds 40 5.9
7gb|AY323788.1| Hyla cinerea SIH-06 Rag-2 gene, partial cds 40 5.9
8gb|AY422168.1| Homo sapiens cryopyrin deletion 4 isoform (CIAS1)... 40 5.9
9gb|AC024382.7| Homo sapiens chromosome 8, clone RP11-351C8, comp... 40 5.9
10gb|AC011061.13| Homo sapiens chromosome 17, clone RP11-12H18, co... 40 5.9
11gb|AC104335.2| Homo sapiens chromosome 1 clone RP11-433K2, compl... 40 5.9
12ref|NM_004895.3| Homo sapiens cold autoinflammatory syndrome 1 (... 40 5.9
13gb|AC025518.8| Homo sapiens chromosome 17, clone RP11-713H12, co... 40 5.9
14ref|NM_183395.1| Homo sapiens cold autoinflammatory syndrome 1 (... 40 5.9
15emb|CR759738.1| Human DNA sequence from clone XX-NCIH2171_16J17,... 40 5.9
16emb|CR626873.1| Human DNA sequence from clone XX-NCIH2171_5J24, ... 40 5.9
17gb|AY064167.1| Lactobacillus helveticus N-deoxyribosyltransferas... 40 5.9
18gb|AY092033.1| Homo sapiens NALP3 intermediate isoform (NALP3) m... 40 5.9
19gb|AF418985.2| Homo sapiens NALP3 short isoform mRNA, complete cds 40 5.9
20gb|AF420469.1| Homo sapiens PYRIN-containing APAF1-like protein ... 40 5.9
21gb|AC083813.29| Homo sapiens 12q BAC RP11-304C10 (Roswell Park C... 40 5.9
22gb|AF468522.1| Homo sapiens NALP3 long isoform (NALP3) mRNA, com... 40 5.9
23gb|AY051114.1|AY051112S3 Homo sapiens cryopyrin (CIAS1) gene, ex... 40 5.9
24gb|AF427617.1|AF427617 Homo sapiens cryopyrin (CIAS1) mRNA, comp... 40 5.9
25gb|AF410477.1|AF410477 Homo sapiens cryopyrin (CIAS1) mRNA, comp... 40 5.9
26gb|AF054176.1|AF054176 Homo sapiens angiotensin/vasopressin rece... 40 5.9
27gb|AC016748.3| Homo sapiens BAC clone RP11-494M7 from 2, complet... 40 5.9
28dbj|AK027194.1| Homo sapiens cDNA: FLJ23541 fis, clone LNG08276,... 40 5.9
29gb|U51038.1|HSU51038 Human nonmuscle myosin II heavy chain-B gen... 40 5.9
30dbj|AB208891.1| Homo sapiens mRNA for Cryopyrin deletion 4 isofo... 40 5.9
31emb|AL732296.11| Mouse DNA sequence from clone RP23-131P6 on chr... 40 5.9

>gb|AF479051.1| Triticum aestivum early nodule-specific-like protein ENOD8 gene
           mRNA, partial cds
          Length = 501

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 387 acgtcatgctaggccgctagcttgctctttcgtctggagct 427
           |||||||| ||||| |||||||||| ||||||||| |||||
Sbjct: 491 acgtcatgntaggctgctagcttgccctttcgtctcgagct 451



to top

>ref|XM_525127.1| PREDICTED: Pan troglodytes similar to cryopyrin isoform a; chromosome
            1 open reading frame 7; angiotensin/vasopressin receptor
            AII/AVP-like; NACHT, LRR and PYD containing protein 3;
            cryopyrin; PYRIN-containing APAF1-like protein 1;
            Muckle-Wells syndrome (LOC469743), mRNA
          Length = 3663

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 42   ccagaggtgggcgcagaggcg 62
            |||||||||||||||||||||
Sbjct: 1827 ccagaggtgggcgcagaggcg 1807



to top

>gb|AY338199.1| Cercopithecus cephus cryopyrin (CIAS1) gene, partial cds
          Length = 1521

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 42  ccagaggtgggcgcagaggcg 62
           |||||||||||||||||||||
Sbjct: 896 ccagaggtgggcgcagaggcg 876



to top

>gb|AY338197.1| Theropithecus gelada cryopyrin (CIAS1) gene, partial cds
          Length = 1521

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 42  ccagaggtgggcgcagaggcg 62
           |||||||||||||||||||||
Sbjct: 896 ccagaggtgggcgcagaggcg 876



to top

>gb|AY338196.1| Gorilla gorilla cryopyrin (CIAS1) gene, partial cds
          Length = 1521

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 42  ccagaggtgggcgcagaggcg 62
           |||||||||||||||||||||
Sbjct: 896 ccagaggtgggcgcagaggcg 876



to top

>gb|AY338200.1| Colobus guereza cryopyrin (CIAS1) gene, partial cds
          Length = 1521

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 42  ccagaggtgggcgcagaggc 61
           ||||||||||||||||||||
Sbjct: 896 ccagaggtgggcgcagaggc 877



to top

>gb|AY323788.1| Hyla cinerea SIH-06 Rag-2 gene, partial cds
          Length = 816

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 306 tcttctcctggcaagtccagccat 329
           ||||||||||| ||||||||||||
Sbjct: 585 tcttctcctgggaagtccagccat 608



to top

>gb|AY422168.1| Homo sapiens cryopyrin deletion 4 isoform (CIAS1) mRNA, complete cds,
            alternatively spliced
          Length = 2934

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 42   ccagaggtgggcgcagaggc 61
            ||||||||||||||||||||
Sbjct: 1395 ccagaggtgggcgcagaggc 1376



to top

>gb|AC024382.7| Homo sapiens chromosome 8, clone RP11-351C8, complete sequence
          Length = 193599

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 10     ccatgactgaattgaaacag 29
              ||||||||||||||||||||
Sbjct: 137025 ccatgactgaattgaaacag 137006



to top

>gb|AC011061.13| Homo sapiens chromosome 17, clone RP11-12H18, complete sequence
          Length = 165643

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 172    gagagaacgccagccaaccc 191
              ||||||||||||||||||||
Sbjct: 153540 gagagaacgccagccaaccc 153559



to top

>gb|AC104335.2| Homo sapiens chromosome 1 clone RP11-433K2, complete sequence
          Length = 212426

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 42     ccagaggtgggcgcagaggc 61
              ||||||||||||||||||||
Sbjct: 193287 ccagaggtgggcgcagaggc 193268



to top

>ref|NM_004895.3| Homo sapiens cold autoinflammatory syndrome 1 (CIAS1), transcript
            variant 1, mRNA
          Length = 4484

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 42   ccagaggtgggcgcagaggc 61
            ||||||||||||||||||||
Sbjct: 2147 ccagaggtgggcgcagaggc 2128



to top

>gb|AC025518.8| Homo sapiens chromosome 17, clone RP11-713H12, complete sequence
          Length = 176355

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 172   gagagaacgccagccaaccc 191
             ||||||||||||||||||||
Sbjct: 25564 gagagaacgccagccaaccc 25583



to top

>ref|NM_183395.1| Homo sapiens cold autoinflammatory syndrome 1 (CIAS1), transcript
            variant 2, mRNA
          Length = 4142

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 42   ccagaggtgggcgcagaggc 61
            ||||||||||||||||||||
Sbjct: 2147 ccagaggtgggcgcagaggc 2128



to top

>emb|CR759738.1| Human DNA sequence from clone XX-NCIH2171_16J17, complete sequence
          Length = 108579

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 10   ccatgactgaattgaaacag 29
            ||||||||||||||||||||
Sbjct: 5705 ccatgactgaattgaaacag 5686



to top

>emb|CR626873.1| Human DNA sequence from clone XX-NCIH2171_5J24, complete sequence
          Length = 93411

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 10    ccatgactgaattgaaacag 29
             ||||||||||||||||||||
Sbjct: 24181 ccatgactgaattgaaacag 24162



to top

>gb|AY064167.1| Lactobacillus helveticus N-deoxyribosyltransferase (ntd) gene,
           complete cds
          Length = 1286

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 296 gccgacgtcttcttctcctggcaa 319
           |||||||||||||||| |||||||
Sbjct: 493 gccgacgtcttcttcttctggcaa 470



to top

>gb|AY092033.1| Homo sapiens NALP3 intermediate isoform (NALP3) mRNA, complete cds
          Length = 3237

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 42   ccagaggtgggcgcagaggc 61
            ||||||||||||||||||||
Sbjct: 1563 ccagaggtgggcgcagaggc 1544



to top

>gb|AF418985.2| Homo sapiens NALP3 short isoform mRNA, complete cds
          Length = 2528

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 42   ccagaggtgggcgcagaggc 61
            ||||||||||||||||||||
Sbjct: 1563 ccagaggtgggcgcagaggc 1544



to top

>gb|AF420469.1| Homo sapiens PYRIN-containing APAF1-like protein 1 (PYPAF1) mRNA,
            complete cds
          Length = 3857

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 42   ccagaggtgggcgcagaggc 61
            ||||||||||||||||||||
Sbjct: 1533 ccagaggtgggcgcagaggc 1514



to top

>gb|AC083813.29| Homo sapiens 12q BAC RP11-304C10 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 216123

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 49     tgggcgcagaggcgatctgt 68
              ||||||||||||||||||||
Sbjct: 139091 tgggcgcagaggcgatctgt 139072



to top

>gb|AF468522.1| Homo sapiens NALP3 long isoform (NALP3) mRNA, complete cds
          Length = 3579

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 42   ccagaggtgggcgcagaggc 61
            ||||||||||||||||||||
Sbjct: 1563 ccagaggtgggcgcagaggc 1544



to top

>gb|AY051114.1|AY051112S3 Homo sapiens cryopyrin (CIAS1) gene, exon 3
          Length = 1958

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 42   ccagaggtgggcgcagaggc 61
            ||||||||||||||||||||
Sbjct: 1092 ccagaggtgggcgcagaggc 1073



to top

>gb|AF427617.1|AF427617 Homo sapiens cryopyrin (CIAS1) mRNA, complete cds, alternatively
            spliced
          Length = 3828

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 42   ccagaggtgggcgcagaggc 61
            ||||||||||||||||||||
Sbjct: 2147 ccagaggtgggcgcagaggc 2128



to top

>gb|AF410477.1|AF410477 Homo sapiens cryopyrin (CIAS1) mRNA, complete cds, alternatively
            spliced
          Length = 4170

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 42   ccagaggtgggcgcagaggc 61
            ||||||||||||||||||||
Sbjct: 2147 ccagaggtgggcgcagaggc 2128



to top

>gb|AF054176.1|AF054176 Homo sapiens angiotensin/vasopressin receptor AII/AVP mRNA,
           complete cds
          Length = 2218

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 42  ccagaggtgggcgcagaggc 61
           ||||||||||||||||||||
Sbjct: 226 ccagaggtgggcgcagaggc 207



to top

>gb|AC016748.3| Homo sapiens BAC clone RP11-494M7 from 2, complete sequence
          Length = 182776

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    tgggcgcagaggcgatctgt 68
             ||||||||||||||||||||
Sbjct: 60821 tgggcgcagaggcgatctgt 60802



to top

>dbj|AK027194.1| Homo sapiens cDNA: FLJ23541 fis, clone LNG08276, highly similar to
            AF054176 Homo sapiens angiotensin/vasopressin receptor
            AII/AVP mRNA
          Length = 2546

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 42   ccagaggtgggcgcagaggc 61
            ||||||||||||||||||||
Sbjct: 1577 ccagaggtgggcgcagaggc 1558



to top

>gb|U51038.1|HSU51038 Human nonmuscle myosin II heavy chain-B gene, partial cds
          Length = 3603

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 172 gagagaacgccagccaaccc 191
           ||||||||||||||||||||
Sbjct: 858 gagagaacgccagccaaccc 877



to top

>dbj|AB208891.1| Homo sapiens mRNA for Cryopyrin deletion 4 isoform variant protein
          Length = 4008

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 42   ccagaggtgggcgcagaggc 61
            ||||||||||||||||||||
Sbjct: 2156 ccagaggtgggcgcagaggc 2137



to top

>emb|AL732296.11| Mouse DNA sequence from clone RP23-131P6 on chromosome 2, complete
             sequence
          Length = 203503

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 123   atccagcatgacaaaaacaa 142
             ||||||||||||||||||||
Sbjct: 45736 atccagcatgacaaaaacaa 45717


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,416,765
Number of Sequences: 3902068
Number of extensions: 3416765
Number of successful extensions: 62720
Number of sequences better than 10.0: 31
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62682
Number of HSP's gapped (non-prelim): 38
length of query: 437
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 415
effective length of database: 17,147,199,772
effective search space: 7116087905380
effective search space used: 7116087905380
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top