ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart36b07
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_475314.1| Oryza sativa (japonica cultivar-group), predic... 153 6e-34
2ref|NM_190752.1| Oryza sativa (japonica cultivar-group), predic... 127 4e-26
3dbj|AK119536.1| Oryza sativa (japonica cultivar-group) cDNA clon... 127 4e-26
4gb|AF218845.1|AF218845 Porteresia coarctata fructose-1,6-bisphos... 127 4e-26
5dbj|AK070516.1| Oryza sativa (japonica cultivar-group) cDNA clon... 127 4e-26
6dbj|AB007193.1| Oryza sativa mRNA for fructose-1,6-bisphosphatas... 127 4e-26
7emb|X89006.1|SHRNAF16B Saccharum hybrid cultivar H65-7052 mRNA f... 103 5e-19
8dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 94 5e-16
9dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic D... 94 5e-16
10gb|AF378183.1|AF378183 Oryza sativa cultivar Milyang23 cytosolic... 86 1e-13
11gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome... 84 5e-13
12dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 84 5e-13
13emb|X61690.1|SOFBPY S.olearacea Scytfbpy gene for fructose-1,6-b... 68 3e-08
14gb|AY093594.1| Pisum sativum cytoplasmic fructose-1,6-bisphospha... 68 3e-08
15gb|M80597.1|BEUF16BPP Beta vulgaris cytosolic fructose-1,6-bisph... 68 3e-08
16gb|AF317553.1|AF317553 Beta vulgaris cytosolic fructose-1,6-bisp... 68 3e-08
17emb|AJ243392.1|PSA243392 Pisum sativum mRNA for cytosolic fructo... 66 1e-07
18ref|NM_103492.3| Arabidopsis thaliana fructose-bisphosphatase/ p... 62 2e-06
19ref|XM_364050.1| Magnaporthe grisea 70-15 hypothetical protein (... 62 2e-06
20gb|BT000470.1| Arabidopsis thaliana fructose 1,6-bisphosphatase,... 62 2e-06
21gb|BT008732.1| Arabidopsis thaliana At1g43670 gene, complete cds 62 2e-06
22gb|BC012927.1| Homo sapiens fructose-1,6-bisphosphatase 1, mRNA ... 58 3e-05
23ref|NM_000507.2| Homo sapiens fructose-1,6-bisphosphatase 1 (FBP... 58 3e-05
24gb|AF378182.1|AF378182 Oryza sativa cultivar Stejaree45 cytosoli... 58 3e-05
25dbj|AK223395.1| Homo sapiens mRNA for fructose-1,6-bisphosphatas... 58 3e-05
26gb|AF073475.1|AF073475 Homo sapiens fructose-1,6-bisphosphatase ... 58 3e-05
27dbj|D26054.1|HUMF16B1 Homo sapiens mRNA for fructose-1,6-bisphos... 58 3e-05
28gb|AY544122.1| Homo sapiens growth-inhibiting protein 17 mRNA, c... 58 3e-05
29gb|L10320.1|HUMF16BPA Human fructose-1,6-bisphosphatase homotetr... 58 3e-05
30gb|M19922.1|HUMALD Human fructose 1,6-bisphosphatase mRNA, compl... 58 3e-05
31dbj|D26056.1|HUMF16B3 Human mRNA for fructose-1,6-bisphosphatase... 58 3e-05
32dbj|D26055.1|HUMF16B2 Human mRNA for fructose-1,6-bisphosphatase... 58 3e-05
33ref|XM_520717.1| PREDICTED: Pan troglodytes similar to Fructose-... 56 1e-04
34ref|XM_324153.1| Neurospora crassa OR74A hypothetical protein (N... 56 1e-04
35ref|XM_955330.1| Neurospora crassa OR74A hypothetical protein (N... 56 1e-04
36gb|AY866483.1| Homo sapiens fructose-1,6-bisphosphatase 1 (FBP1)... 54 4e-04
37gb|BT012957.1| Lycopersicon esculentum clone 114145F, mRNA sequence 54 4e-04
38gb|BT013377.1| Lycopersicon esculentum clone 135407F, mRNA sequence 54 4e-04
39emb|AL161728.25| Human DNA sequence from clone RP11-342C23 on ch... 54 4e-04
40emb|X76946.1|STCYF1 S.tuberosum cy-F1 mRNA for cytosolic fructos... 54 4e-04
41gb|AY035554.1| Oryza sativa cytosolic fructose-1,6-bisphosphatas... 54 4e-04
42gb|U21930.1|HSLFBPS6 Human fructose-1,6-biphosphatase (FBP1) gen... 54 4e-04
43gb|AC009526.4|AC009526 Arabidopsis thaliana chromosome I BAC F2J... 50 0.007
44gb|DQ165552.1| Brassica rapa subsp. pekinensis fructose 1,6-bisp... 48 0.027
45ref|XM_533503.2| PREDICTED: Canis familiaris similar to fructose... 48 0.027
46ref|XM_850754.1| PREDICTED: Canis familiaris similar to fructose... 48 0.027
47ref|XM_843213.1| PREDICTED: Canis familiaris similar to fructose... 48 0.027
48gb|AF130251.1|AF130251 Musa acuminata cytosolic fructose-1,6-bis... 48 0.027
49gb|U20179.1|BNU20179 Brassica napus fructose 1,6-bisphosphatase ... 48 0.027
50gb|AY692816.1| Saccharomyces cerevisiae clone FLH113339.01X YLR3... 46 0.11
51ref|XM_389456.1| Gibberella zeae PH-1 chromosome 4 conserved hyp... 46 0.11
52emb|Y00754.1|SCFBP1 Yeast FBP1 gene for fructose-1.6-bisphosphat... 46 0.11
53gb|U19103.1|YSCL8039 Saccharomyces cerevisiae chromosome XII cos... 46 0.11
54gb|J03207.1|YSCFBPA S.cerevisiae fructose-1,6-bisphosphatase (FB... 46 0.11
55emb|AL115150.1|CNS01C6U Botrytis cinerea strain T4 cDNA library 44 0.43
56emb|AL113555.1|CNS01AYJ Botrytis cinerea strain T4 cDNA library 44 0.43
57ref|XM_977287.1| PREDICTED: Mus musculus hypothetical protein LO... 42 1.7
58ref|XM_988157.1| PREDICTED: Mus musculus hypothetical protein LO... 42 1.7
59ref|XM_896651.2| PREDICTED: Mus musculus hypothetical protein LO... 42 1.7
60emb|CR731123.2|CNS0GR2W Tetraodon nigroviridis full-length cDNA 42 1.7
61emb|CR729935.2|CNS0GQ5X Tetraodon nigroviridis full-length cDNA 42 1.7
62emb|CR729491.2|CNS0GPTL Tetraodon nigroviridis full-length cDNA 42 1.7
63emb|CR727752.2|CNS0GOHA Tetraodon nigroviridis full-length cDNA 42 1.7
64emb|CR727289.2|CNS0GO4F Tetraodon nigroviridis full-length cDNA 42 1.7
65emb|CR726696.1|CNS0GNNY Tetraodon nigroviridis full-length cDNA 42 1.7
66emb|CR723913.2|CNS0GLIN Tetraodon nigroviridis full-length cDNA 42 1.7
67emb|CR701043.2|CNS0G3VJ Tetraodon nigroviridis full-length cDNA 42 1.7
68emb|CR688453.2|CNS0FU5T Tetraodon nigroviridis full-length cDNA 42 1.7
69emb|CR689786.1|CNS0FV6U Tetraodon nigroviridis full-length cDNA 42 1.7
70emb|CR688620.2|CNS0FUAG Tetraodon nigroviridis full-length cDNA 42 1.7
71emb|CR681314.1|CNS0FONI Tetraodon nigroviridis full-length cDNA 42 1.7
72emb|CR679766.2|CNS0FNGI Tetraodon nigroviridis full-length cDNA 42 1.7
73emb|CR679267.2|CNS0FN2N Tetraodon nigroviridis full-length cDNA 42 1.7
74emb|CR678962.2|CNS0FMU6 Tetraodon nigroviridis full-length cDNA 42 1.7
75emb|CR679150.1|CNS0FMZE Tetraodon nigroviridis full-length cDNA 42 1.7
76emb|CR677858.1|CNS0FLZU Tetraodon nigroviridis full-length cDNA 42 1.7
77emb|CR677925.2|CNS0FM1P Tetraodon nigroviridis full-length cDNA 42 1.7
78emb|CR676053.2|CNS0FKM3 Tetraodon nigroviridis full-length cDNA 42 1.7
79emb|CR675016.2|CNS0FJTA Tetraodon nigroviridis full-length cDNA 42 1.7
80emb|CR674539.2|CNS0FJG1 Tetraodon nigroviridis full-length cDNA 42 1.7
81emb|CR674763.1|CNS0FJM9 Tetraodon nigroviridis full-length cDNA 42 1.7
82emb|CR674395.2|CNS0FJC1 Tetraodon nigroviridis full-length cDNA 42 1.7
83emb|CR673987.2|CNS0FJ0P Tetraodon nigroviridis full-length cDNA 42 1.7
84emb|CR673697.2|CNS0FISN Tetraodon nigroviridis full-length cDNA 42 1.7
85emb|CR672580.2|CNS0FHXM Tetraodon nigroviridis full-length cDNA 42 1.7
86emb|CR672777.1|CNS0FI33 Tetraodon nigroviridis full-length cDNA 42 1.7
87emb|CR671973.2|CNS0FHGR Tetraodon nigroviridis full-length cDNA 42 1.7
88emb|CR671920.2|CNS0FHFA Tetraodon nigroviridis full-length cDNA 42 1.7
89emb|CR670679.2|CNS0FGGT Tetraodon nigroviridis full-length cDNA 42 1.7
90emb|CR670270.2|CNS0FG5G Tetraodon nigroviridis full-length cDNA 42 1.7
91emb|CR666565.2|CNS0FDAJ Tetraodon nigroviridis full-length cDNA 42 1.7
92emb|CR666528.2|CNS0FD9I Tetraodon nigroviridis full-length cDNA 42 1.7
93emb|CR664928.2|CNS0FC12 Tetraodon nigroviridis full-length cDNA 42 1.7
94emb|CR664903.2|CNS0FC0D Tetraodon nigroviridis full-length cDNA 42 1.7
95emb|CR663156.2|CNS0FANU Tetraodon nigroviridis full-length cDNA 42 1.7
96emb|CR662062.2|CNS0F9TG Tetraodon nigroviridis full-length cDNA 42 1.7
97emb|CR661920.2|CNS0F9PI Tetraodon nigroviridis full-length cDNA 42 1.7
98emb|CR661599.2|CNS0F9GL Tetraodon nigroviridis full-length cDNA 42 1.7
99emb|CR660832.2|CNS0F8VA Tetraodon nigroviridis full-length cDNA 42 1.7
100emb|CR660718.2|CNS0F8S4 Tetraodon nigroviridis full-length cDNA 42 1.7
101emb|CR659043.2|CNS0F7HL Tetraodon nigroviridis full-length cDNA 42 1.7
102emb|CR659356.1|CNS0F7QA Tetraodon nigroviridis full-length cDNA 42 1.7
103emb|CR658470.2|CNS0F71O Tetraodon nigroviridis full-length cDNA 42 1.7
104emb|CR658127.2|CNS0F6S5 Tetraodon nigroviridis full-length cDNA 42 1.7
105emb|CR657521.2|CNS0F6BB Tetraodon nigroviridis full-length cDNA 42 1.7
106emb|CR657430.2|CNS0F68S Tetraodon nigroviridis full-length cDNA 42 1.7
107emb|CR656919.1|CNS0F5UL Tetraodon nigroviridis full-length cDNA 42 1.7
108emb|CR655445.2|CNS0F4PN Tetraodon nigroviridis full-length cDNA 42 1.7
109ref|XM_777318.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 1.7
110dbj|AK043613.1| Mus musculus 10 days neonate cortex cDNA, RIKEN ... 42 1.7
111gb|AC157819.5| Mus musculus chromosome 3, clone RP24-273H20, com... 42 1.7
112gb|AC103937.16| Mus musculus chromosome 3, clone RP23-229C5, com... 42 1.7
113gb|AC093267.2| Homo sapiens chromosome 5 clone RP11-280F11, comp... 40 6.6
114emb|CT010516.6| Mouse DNA sequence from clone RP23-276H24 on chr... 40 6.6 
>ref|XM_475314.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1032

 Score =  153 bits (77), Expect = 6e-34
 Identities = 182/217 (83%)
 Strand = Plus / Minus

                                                                        
Query: 271  gactccgaagcgtacagtgatttaatctcctccacatcatcgtagctcccgaggaatatc 330
            ||||| |||||||||| || ||| || |||||||| ||||| |||||||| |||||||| 
Sbjct: 1019 gactctgaagcgtacaatgctttgatatcctccacgtcatcatagctccccaggaatatt 960

                                                                        
Query: 331  ggagacctctggtgtatgtcacaagggacaatttcaagggcccgctgtttgccggtgaaa 390
            ||||| || |  || || |  |  || |||| |||||||||||| |||||||| ||||||
Sbjct: 959  ggagatctatcatgaatctttctgggaacaagttcaagggcccgttgtttgcctgtgaaa 900

                                                                        
Query: 391  gattggcctccggcttgctccatcaggaatgacatggggaaaacctcgtacagaacacga 450
            | ||| ||||| ||||||||||||| ||||||||| ||||| || |||||||||||||||
Sbjct: 899  gcttgtcctccagcttgctccatcaagaatgacattgggaacacttcgtacagaacacga 840

                                                 
Query: 451  agctttccgttggggctcttcttgtccgcggggtaca 487
            || |||||||| ||||||||||  ||||| |||||||
Sbjct: 839  agttttccgtttgggctcttctgatccgcagggtaca 803
to top
>ref|NM_190752.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1110

 Score =  127 bits (64), Expect = 4e-26
 Identities = 109/124 (87%)
 Strand = Plus / Minus

                                                                       
Query: 364 tcaagggcccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgac 423
           ||||| ||||| | |||||| |||||||| |||||||| || ||||||||||||||||||
Sbjct: 980 tcaagagcccgttctttgcctgtgaaagactggcctccagcctgctccatcaggaatgac 921

                                                                       
Query: 424 atggggaaaacctcgtacagaacacgaagctttccgttggggctcttcttgtccgcgggg 483
           ||||||||||| || ||||||||||| || ||||| || |||||||||||||| || |||
Sbjct: 920 atggggaaaacttcatacagaacacggagttttccatttgggctcttcttgtctgcaggg 861

               
Query: 484 taca 487
           ||||
Sbjct: 860 taca 857
to top
>dbj|AK119536.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-B07, full
            insert sequence
          Length = 1315

 Score =  127 bits (64), Expect = 4e-26
 Identities = 109/124 (87%)
 Strand = Plus / Minus

                                                                        
Query: 364  tcaagggcccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgac 423
            ||||| ||||| | |||||| |||||||| |||||||| || ||||||||||||||||||
Sbjct: 1023 tcaagagcccgttctttgcctgtgaaagactggcctccagcctgctccatcaggaatgac 964

                                                                        
Query: 424  atggggaaaacctcgtacagaacacgaagctttccgttggggctcttcttgtccgcgggg 483
            ||||||||||| || ||||||||||| || ||||| || |||||||||||||| || |||
Sbjct: 963  atggggaaaacttcatacagaacacggagttttccatttgggctcttcttgtctgcaggg 904

                
Query: 484  taca 487
            ||||
Sbjct: 903  taca 900
to top
>gb|AF218845.1|AF218845 Porteresia coarctata fructose-1,6-bisphosphatase mRNA, complete cds
          Length = 1035

 Score =  127 bits (64), Expect = 4e-26
 Identities = 109/124 (87%)
 Strand = Plus / Minus

                                                                       
Query: 364 tcaagggcccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgac 423
           ||||| ||||| | |||||| |||||||| |||||||| || ||||||||||||||||||
Sbjct: 920 tcaagagcccgttctttgcctgtgaaagactggcctccagcctgctccatcaggaatgac 861

                                                                       
Query: 424 atggggaaaacctcgtacagaacacgaagctttccgttggggctcttcttgtccgcgggg 483
           ||||||||||| || ||||||||||| || ||||| || |||||||||||||| || |||
Sbjct: 860 atggggaaaacttcatacagaacacggagttttccattcgggctcttcttgtctgcaggg 801

               
Query: 484 taca 487
           ||||
Sbjct: 800 taca 797
to top
>dbj|AK070516.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023057C24, full
            insert sequence
          Length = 1376

 Score =  127 bits (64), Expect = 4e-26
 Identities = 109/124 (87%)
 Strand = Plus / Minus

                                                                        
Query: 364  tcaagggcccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgac 423
            ||||| ||||| | |||||| |||||||| |||||||| || ||||||||||||||||||
Sbjct: 1031 tcaagagcccgttctttgcctgtgaaagactggcctccagcctgctccatcaggaatgac 972

                                                                        
Query: 424  atggggaaaacctcgtacagaacacgaagctttccgttggggctcttcttgtccgcgggg 483
            ||||||||||| || ||||||||||| || ||||| || |||||||||||||| || |||
Sbjct: 971  atggggaaaacttcatacagaacacggagttttccatttgggctcttcttgtctgcaggg 912

                
Query: 484  taca 487
            ||||
Sbjct: 911  taca 908
to top
>dbj|AB007193.1| Oryza sativa mRNA for fructose-1,6-bisphosphatase (cytosolic
            isoform), complete cds
          Length = 1544

 Score =  127 bits (64), Expect = 4e-26
 Identities = 109/124 (87%)
 Strand = Plus / Minus

                                                                        
Query: 364  tcaagggcccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgac 423
            ||||| ||||| | |||||| |||||||| |||||||| || ||||||||||||||||||
Sbjct: 1000 tcaagagcccgttctttgcctgtgaaagactggcctccagcctgctccatcaggaatgac 941

                                                                        
Query: 424  atggggaaaacctcgtacagaacacgaagctttccgttggggctcttcttgtccgcgggg 483
            ||||||||||| || ||||||||||| || ||||| || |||||||||||||| || |||
Sbjct: 940  atggggaaaacttcatacagaacacggagttttccatttgggctcttcttgtctgcaggg 881

                
Query: 484  taca 487
            ||||
Sbjct: 880  taca 877
to top
>emb|X89006.1|SHRNAF16B Saccharum hybrid cultivar H65-7052 mRNA for cytosolic
            fructose-1,6-bisphosphatase
          Length = 1318

 Score =  103 bits (52), Expect = 5e-19
 Identities = 169/208 (81%)
 Strand = Plus / Minus

                                                                        
Query: 280  gcgtacagtgatttaatctcctccacatcatcgtagctcccgaggaatatcggagacctc 339
            ||||||| || ||| || ||||||||||| |||||||| |||||||||||||| || |||
Sbjct: 1074 gcgtacaatgctttgatttcctccacatcgtcgtagctgccgaggaatatcggggatctc 1015

                                                                        
Query: 340  tggtgtatgtcacaagggacaatttcaagggcccgctgtttgccggtgaaagattggcct 399
            | ||| || |     ||||| |  ||||| ||||| | |||||| ||||| || || |||
Sbjct: 1014 tcgtggatcttggttgggaccagatcaagagcccgttctttgcctgtgaaggactgacct 955

                                                                        
Query: 400  ccggcttgctccatcaggaatgacatggggaaaacctcgtacagaacacgaagctttccg 459
            || || |||||||| |||||||||||||||||||| || || || ||||| |||||||| 
Sbjct: 954  ccagcctgctccattaggaatgacatggggaaaacttcataaaggacacggagctttcca 895

                                        
Query: 460  ttggggctcttcttgtccgcggggtaca 487
            || |||||||||| ||| || |||||||
Sbjct: 894  tttgggctcttctggtcagcagggtaca 867
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 65/71 (91%)
 Strand = Plus / Minus

                                                                            
Query: 378      tttgccggtgaaagattggcctccggcttgctccatcaggaatgacatggggaaaacctc 437
                |||||| |||||||| |||||||| || ||||||||||||||||||||||||||||| ||
Sbjct: 37515196 tttgcctgtgaaagactggcctccagcctgctccatcaggaatgacatggggaaaacttc 37515137

                           
Query: 438      gtacagaacac 448
                 ||||||||||
Sbjct: 37515136 atacagaacac 37515126
to top
>dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0505D12
          Length = 146951

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 65/71 (91%)
 Strand = Plus / Minus

                                                                          
Query: 378    tttgccggtgaaagattggcctccggcttgctccatcaggaatgacatggggaaaacctc 437
              |||||| |||||||| |||||||| || ||||||||||||||||||||||||||||| ||
Sbjct: 109733 tttgcctgtgaaagactggcctccagcctgctccatcaggaatgacatggggaaaacttc 109674

                         
Query: 438    gtacagaacac 448
               ||||||||||
Sbjct: 109673 atacagaacac 109663
to top
>gb|AF378183.1|AF378183 Oryza sativa cultivar Milyang23 cytosolic fructose-1 mRNA, partial
           cds
          Length = 504

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 70/79 (88%)
 Strand = Plus / Minus

                                                                       
Query: 409 tccatcaggaatgacatggggaaaacctcgtacagaacacgaagctttccgttggggctc 468
           ||||| |||||||||||||||||||| || ||||||||||| || ||||| || ||||||
Sbjct: 500 tccattaggaatgacatggggaaaacttcatacagaacacggagttttccatttgggctc 441

                              
Query: 469 ttcttgtccgcggggtaca 487
           |||||||| || |||||||
Sbjct: 440 ttcttgtctgcagggtaca 422
to top
>gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0042J17, complete sequence
          Length = 124139

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 69/78 (88%)
 Strand = Plus / Plus

                                                                         
Query: 371   cccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgacatgggga 430
             |||| |||||||| ||||||| ||| ||||| ||||||||||||| ||||||||| ||||
Sbjct: 67584 cccgttgtttgcctgtgaaagcttgtcctccagcttgctccatcaagaatgacattggga 67643

                               
Query: 431   aaacctcgtacagaacac 448
             | || |||||||||||||
Sbjct: 67644 acacttcgtacagaacac 67661
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 69/78 (88%)
 Strand = Plus / Plus

                                                                            
Query: 371      cccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgacatgggga 430
                |||| |||||||| ||||||| ||| ||||| ||||||||||||| ||||||||| ||||
Sbjct: 21350262 cccgttgtttgcctgtgaaagcttgtcctccagcttgctccatcaagaatgacattggga 21350321

                                  
Query: 431      aaacctcgtacagaacac 448
                | || |||||||||||||
Sbjct: 21350322 acacttcgtacagaacac 21350339
to top
>emb|X61690.1|SOFBPY S.olearacea Scytfbpy gene for fructose-1,6-bisphosphatase
          Length = 1585

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                        
Query: 364  tcaagggcccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgac 423
            ||||| ||||| ||||||||||| |||| ||| || || ||||| ||||| | ||| |||
Sbjct: 1189 tcaagtgcccgttgtttgccggtaaaagcttgtccgccagcttgttccattaagaaggac 1130

                                                              
Query: 424  atggggaaaacctcgtacagaacacgaagctttccgttggggctcttctt 473
            || || || |||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 1129 attggaaagacctcgtagagaactcttagttttccgttggggctcttctt 1080
to top
>gb|AY093594.1| Pisum sativum cytoplasmic fructose-1,6-bisphosphatase mRNA,
           complete cds
          Length = 1062

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                       
Query: 364 tcaagggcccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgac 423
           ||||| ||||| ||||||||||| |||| ||| || || ||||| ||||| | ||| |||
Sbjct: 920 tcaagtgcccgttgtttgccggtaaaagcttgtccgccagcttgttccattaagaaggac 861

                                                             
Query: 424 atggggaaaacctcgtacagaacacgaagctttccgttggggctcttctt 473
           || || || |||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 860 attggaaagacctcgtagagaactcttagttttccgttggggctcttctt 811
to top
>gb|M80597.1|BEUF16BPP Beta vulgaris cytosolic fructose-1,6-bisphosphatase mRNA, complete
           cds
          Length = 1278

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                       
Query: 364 tcaagggcccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgac 423
           ||||| ||||| |||| ||| || |||| ||| || || ||||||||||| | |||||||
Sbjct: 961 tcaagtgcccgttgttcgccagtaaaagcttgtccacctgcttgctccattaagaatgac 902

                                                             
Query: 424 atggggaaaacctcgtacagaacacgaagctttccgttggggctcttctt 473
           ||||| || ||||| || ||||| || || |||||||| |||||||||||
Sbjct: 901 atgggaaagacctcataaagaactcgtagttttccgttagggctcttctt 852
to top
>gb|AF317553.1|AF317553 Beta vulgaris cytosolic fructose-1,6-bisphosphatase mRNA, complete
           cds
          Length = 1279

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                       
Query: 364 tcaagggcccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgac 423
           ||||| ||||| |||| ||| || |||| ||| || || ||||||||||| | |||||||
Sbjct: 962 tcaagtgcccgttgttcgccagtaaaagcttgtccacctgcttgctccattaagaatgac 903

                                                             
Query: 424 atggggaaaacctcgtacagaacacgaagctttccgttggggctcttctt 473
           ||||| || ||||| || ||||| || || |||||||| |||||||||||
Sbjct: 902 atgggaaagacctcataaagaactcgtagttttccgttagggctcttctt 853
to top
>emb|AJ243392.1|PSA243392 Pisum sativum mRNA for cytosolic fructose-1,6-bisphosphatase
          Length = 990

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 90/109 (82%)
 Strand = Plus / Minus

                                                                       
Query: 379 ttgccggtgaaagattggcctccggcttgctccatcaggaatgacatggggaaaacctcg 438
           |||||||||||||| || |||||||| || ||||||| ||| ||||| ||||| || || 
Sbjct: 869 ttgccggtgaaagactgtcctccggcctgttccatcaagaaggacattgggaagacttca 810

                                                            
Query: 439 tacagaacacgaagctttccgttggggctcttcttgtccgcggggtaca 487
           ||||  |||||||| ||||| || || ||||| ||||| || |||||||
Sbjct: 809 tacaatacacgaagttttccatttggactctttttgtcagcagggtaca 761
to top
>ref|NM_103492.3| Arabidopsis thaliana fructose-bisphosphatase/ phosphoric ester
           hydrolase AT1G43670 mRNA, complete cds
          Length = 1253

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 76/91 (83%)
 Strand = Plus / Minus

                                                                       
Query: 397 cctccggcttgctccatcaggaatgacatggggaaaacctcgtacagaacacgaagcttt 456
           |||||||||||||||||||  || ||||| |||||||| || ||||  ||||| |  |||
Sbjct: 964 cctccggcttgctccatcaaaaacgacatcgggaaaacttcatacaagacacgcaatttt 905

                                          
Query: 457 ccgttggggctcttcttgtccgcggggtaca 487
           || |||||||| |||||||| || |||||||
Sbjct: 904 ccattggggcttttcttgtcagccgggtaca 874



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                         
Query: 291  tttaatctcctccacatcatcgtagctcccgaggaatatcggaga 335
            ||||||||| || |||||||||||||| || || |||||||||||
Sbjct: 1070 tttaatctcttctacatcatcgtagctaccaagaaatatcggaga 1026
to top
>ref|XM_364050.1| Magnaporthe grisea 70-15 hypothetical protein (MG08895.4) partial
           cds
          Length = 1035

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 435 ctcgtacagaacacgaagctttccgttggggctcttcttgtccgcggggta 485
           |||||||| || ||||||||| || ||||||||||||||||| ||||||||
Sbjct: 873 ctcgtacaaaatacgaagcttgcccttggggctcttcttgtcggcggggta 823
to top
>gb|BT000470.1| Arabidopsis thaliana fructose 1,6-bisphosphatase, putative
           (At1g43670) mRNA, complete cds
          Length = 1200

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 76/91 (83%)
 Strand = Plus / Minus

                                                                       
Query: 397 cctccggcttgctccatcaggaatgacatggggaaaacctcgtacagaacacgaagcttt 456
           |||||||||||||||||||  || ||||| |||||||| || ||||  ||||| |  |||
Sbjct: 934 cctccggcttgctccatcaaaaacgacatcgggaaaacttcatacaagacacgcaatttt 875

                                          
Query: 457 ccgttggggctcttcttgtccgcggggtaca 487
           || |||||||| |||||||| || |||||||
Sbjct: 874 ccattggggcttttcttgtcagccgggtaca 844



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                         
Query: 291  tttaatctcctccacatcatcgtagctcccgaggaatatcggaga 335
            ||||||||| || |||||||||||||| || || |||||||||||
Sbjct: 1040 tttaatctcttctacatcatcgtagctaccaagaaatatcggaga 996
to top
>gb|BT008732.1| Arabidopsis thaliana At1g43670 gene, complete cds
          Length = 1026

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 76/91 (83%)
 Strand = Plus / Minus

                                                                       
Query: 397 cctccggcttgctccatcaggaatgacatggggaaaacctcgtacagaacacgaagcttt 456
           |||||||||||||||||||  || ||||| |||||||| || ||||  ||||| |  |||
Sbjct: 887 cctccggcttgctccatcaaaaacgacatcgggaaaacttcatacaagacacgcaatttt 828

                                          
Query: 457 ccgttggggctcttcttgtccgcggggtaca 487
           || |||||||| |||||||| || |||||||
Sbjct: 827 ccattggggcttttcttgtcagccgggtaca 797



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 291 tttaatctcctccacatcatcgtagctcccgaggaatatcggaga 335
           ||||||||| || |||||||||||||| || || |||||||||||
Sbjct: 993 tttaatctcttctacatcatcgtagctaccaagaaatatcggaga 949
to top
>gb|BC012927.1| Homo sapiens fructose-1,6-bisphosphatase 1, mRNA (cDNA clone
            MGC:21278 IMAGE:4517633), complete cds
          Length = 1513

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 451  agctttccgttggggctcttcttgtccgcggggtacagaaa 491
            |||||||| ||||||||||||||||  ||||||||||||||
Sbjct: 1024 agctttccattggggctcttcttgttagcggggtacagaaa 984
to top
>ref|NM_000507.2| Homo sapiens fructose-1,6-bisphosphatase 1 (FBP1), mRNA
          Length = 1527

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 451  agctttccgttggggctcttcttgtccgcggggtacagaaa 491
            |||||||| ||||||||||||||||  ||||||||||||||
Sbjct: 1038 agctttccattggggctcttcttgttagcggggtacagaaa 998
to top
>gb|AF378182.1|AF378182 Oryza sativa cultivar Stejaree45 cytosolic fructose-1 mRNA, partial
           cds
          Length = 461

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 439 tacagaacacgaagctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||||||||| |||||||| ||||||||||  ||||| |||||||
Sbjct: 461 tacagaacacgaagttttccgtttgggctcttctgatccgcagggtaca 413
to top
>dbj|AK223395.1| Homo sapiens mRNA for fructose-1,6-bisphosphatase 1 variant, clone:
            FCC107D09
          Length = 1557

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 451  agctttccgttggggctcttcttgtccgcggggtacagaaa 491
            |||||||| ||||||||||||||||  ||||||||||||||
Sbjct: 1102 agctttccattggggctcttcttgttagcggggtacagaaa 1062
to top
>gb|AF073475.1|AF073475 Homo sapiens fructose-1,6-bisphosphatase (FBP1) mRNA, partial cds
          Length = 1011

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 451 agctttccgttggggctcttcttgtccgcggggtacagaaa 491
           |||||||| ||||||||||||||||  ||||||||||||||
Sbjct: 824 agctttccattggggctcttcttgttagcggggtacagaaa 784
to top
>dbj|D26054.1|HUMF16B1 Homo sapiens mRNA for fructose-1,6-bisphosphatase, complete cds
          Length = 1051

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 451 agctttccgttggggctcttcttgtccgcggggtacagaaa 491
           |||||||| ||||||||||||||||  ||||||||||||||
Sbjct: 833 agctttccattggggctcttcttgttagcggggtacagaaa 793
to top
>gb|AY544122.1| Homo sapiens growth-inhibiting protein 17 mRNA, complete cds
          Length = 1145

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 451 agctttccgttggggctcttcttgtccgcggggtacagaaa 491
           |||||||| ||||||||||||||||  ||||||||||||||
Sbjct: 914 agctttccattggggctcttcttgttagcggggtacagaaa 874
to top
>gb|L10320.1|HUMF16BPA Human fructose-1,6-bisphosphatase homotetramer gene, complete cds
          Length = 1401

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 451 agctttccgttggggctcttcttgtccgcggggtacagaaa 491
           |||||||| ||||||||||||||||  ||||||||||||||
Sbjct: 969 agctttccattggggctcttcttgttagcggggtacagaaa 929
to top
>gb|M19922.1|HUMALD Human fructose 1,6-bisphosphatase mRNA, complete cds
          Length = 1382

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 451  agctttccgttggggctcttcttgtccgcggggtacagaaa 491
            |||||||| ||||||||||||||||  ||||||||||||||
Sbjct: 1025 agctttccattggggctcttcttgttagcggggtacagaaa 985
to top
>dbj|D26056.1|HUMF16B3 Human mRNA for fructose-1,6-bisphosphatase, complete cds
          Length = 1051

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 451 agctttccgttggggctcttcttgtccgcggggtacagaaa 491
           |||||||| ||||||||||||||||  ||||||||||||||
Sbjct: 833 agctttccattggggctcttcttgttagcggggtacagaaa 793
to top
>dbj|D26055.1|HUMF16B2 Human mRNA for fructose-1,6-bisphosphatase, complete cds
          Length = 1051

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 451 agctttccgttggggctcttcttgtccgcggggtacagaaa 491
           |||||||| ||||||||||||||||  ||||||||||||||
Sbjct: 833 agctttccattggggctcttcttgttagcggggtacagaaa 793
to top
>ref|XM_520717.1| PREDICTED: Pan troglodytes similar to Fructose-1,6-bisphosphatase
            (D-fructose-1,6-bisphosphate 1-phosphohydrolase) (FBPase)
            (LOC465260), mRNA
          Length = 2142

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 452  gctttccgttggggctcttcttgtccgcggggtacagaaa 491
            ||||||| ||||||||||||||||  ||||||||||||||
Sbjct: 1830 gctttccattggggctcttcttgttagcggggtacagaaa 1791
to top
>ref|XM_324153.1| Neurospora crassa OR74A hypothetical protein (NCU04797.1) partial
           mRNA
          Length = 1053

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 435 ctcgtacagaacacgaagctttccgttggggctcttcttgtccgcggggtac 486
           ||||||||||| ||| ||||| || ||||||||||||||||| || ||||||
Sbjct: 885 ctcgtacagaatacgcagcttgcccttggggctcttcttgtctgccgggtac 834
to top
>ref|XM_955330.1| Neurospora crassa OR74A hypothetical protein (NCU04797.1) partial
           mRNA
          Length = 1053

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 435 ctcgtacagaacacgaagctttccgttggggctcttcttgtccgcggggtac 486
           ||||||||||| ||| ||||| || ||||||||||||||||| || ||||||
Sbjct: 885 ctcgtacagaatacgcagcttgcccttggggctcttcttgtctgccgggtac 834
to top
>gb|AY866483.1| Homo sapiens fructose-1,6-bisphosphatase 1 (FBP1) gene, complete cds
          Length = 40644

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                    
Query: 453   ctttccgttggggctcttcttgtccgcggggtacagaaa 491
             |||||| ||||||||||||||||  ||||||||||||||
Sbjct: 36326 ctttccattggggctcttcttgttagcggggtacagaaa 36288
to top
>gb|BT012957.1| Lycopersicon esculentum clone 114145F, mRNA sequence
          Length = 1463

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 75/91 (82%)
 Strand = Plus / Minus

                                                                       
Query: 397 cctccggcttgctccatcaggaatgacatggggaaaacctcgtacagaacacgaagcttt 456
           ||||| ||||| |||||||| ||||||||||| || || || || ||||| |  ||||| 
Sbjct: 905 cctcctgcttgttccatcagaaatgacatgggaaatacttcatagagaaccctcagcttc 846

                                          
Query: 457 ccgttggggctcttcttgtccgcggggtaca 487
           ||||||||||| ||||| ||  |||||||||
Sbjct: 845 ccgttggggcttttcttatctccggggtaca 815
to top
>gb|BT013377.1| Lycopersicon esculentum clone 135407F, mRNA sequence
          Length = 641

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 75/91 (82%)
 Strand = Plus / Minus

                                                                       
Query: 397 cctccggcttgctccatcaggaatgacatggggaaaacctcgtacagaacacgaagcttt 456
           ||||| ||||| |||||||| ||||||||||| || || || || ||||| || ||||| 
Sbjct: 297 cctcctgcttgttccatcagaaatgacatgggaaatacttcatagagaacccgtagcttc 238

                                          
Query: 457 ccgttggggctcttcttgtccgcggggtaca 487
           || |||||||| ||||| || || |||||||
Sbjct: 237 ccattggggcttttcttatcagctgggtaca 207



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 295 atctcctccacatcatcgtagctcccgaggaatat 329
           |||||||||||||||||||| || || ||||||||
Sbjct: 399 atctcctccacatcatcgtaactaccaaggaatat 365
to top
>emb|AL161728.25| Human DNA sequence from clone RP11-342C23 on chromosome 9 Contains the
             FBP1 gene for Fructose-1,6-bisphosphatase 1, a novel gene,
             the FBP2 gene for Fructose-1,6-bisphosphatase 2, a  gene
             for a putative novel protein and one CpG island, complete
             sequence
          Length = 170532

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                    
Query: 453   ctttccgttggggctcttcttgtccgcggggtacagaaa 491
             |||||| ||||||||||||||||  ||||||||||||||
Sbjct: 85908 ctttccattggggctcttcttgttagcggggtacagaaa 85870
to top
>emb|X76946.1|STCYF1 S.tuberosum cy-F1 mRNA for cytosolic fructose-1,6-biphosphatase
          Length = 1487

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 78/95 (82%)
 Strand = Plus / Minus

                                                                        
Query: 393  ttggcctccggcttgctccatcaggaatgacatggggaaaacctcgtacagaacacgaag 452
            ||||||||| ||||| |||||||| ||||||||||| || || || || ||||| |  ||
Sbjct: 1089 ttggcctcctgcttgttccatcagaaatgacatgggaaatacttcatagagaaccctcag 1030

                                               
Query: 453  ctttccgttggggctcttcttgtccgcggggtaca 487
             || ||||||||||| ||||| ||  |||||||||
Sbjct: 1029 tttcccgttggggcttttcttatctccggggtaca 995
to top
>gb|AY035554.1| Oryza sativa cytosolic fructose-1,6-bisphosphatase mRNA, partial
           cds
          Length = 459

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 441 cagaacacgaagctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||||||| |||||||| ||||||||||  ||||| |||||||
Sbjct: 459 cagaacacgaagttttccgtttgggctcttctgatccgcagggtaca 413
to top
>gb|U21930.1|HSLFBPS6 Human fructose-1,6-biphosphatase (FBP1) gene, exon 6
          Length = 1314

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 453  ctttccgttggggctcttcttgtccgcggggtacagaaa 491
            |||||| ||||||||||||||||  ||||||||||||||
Sbjct: 1014 ctttccattggggctcttcttgttagcggggtacagaaa 976
to top
>gb|AC009526.4|AC009526 Arabidopsis thaliana chromosome I BAC F2J6 genomic sequence, complete
             sequence
          Length = 108061

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                          
Query: 291   tttaatctcctccacatcatcgtagctcccgaggaatatcggaga 335
             ||||||||| || |||||||||||||| || || |||||||||||
Sbjct: 28726 tttaatctcttctacatcatcgtagctaccaagaaatatcggaga 28682



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 397   cctccggcttgctccatcaggaatgacatggggaaaac 434
             |||||||||||||||||||  || ||||| ||||||||
Sbjct: 28534 cctccggcttgctccatcaaaaacgacatcgggaaaac 28497
to top
>gb|DQ165552.1| Brassica rapa subsp. pekinensis fructose 1,6-bisphosphatase mRNA,
            complete cds
          Length = 1377

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                        
Query: 397  cctccggcttgctccatcaggaatgacatggggaaaacctcgtacagaacacgaagcttt 456
            ||||| ||||||||||||| ||| | ||| ||||| || || ||||| ||||| |  || 
Sbjct: 1110 cctccagcttgctccatcaagaacgccattgggaagacttcatacaggacacgcaatttc 1051

                                            
Query: 457  ccgttggggctcttcttgtccgcggggtacag 488
            || |||||||| |||||||| || ||||||||
Sbjct: 1050 ccattggggcttttcttgtcagccgggtacag 1019
to top
>ref|XM_533503.2| PREDICTED: Canis familiaris similar to fructose-1,6-bisphosphatase
           1, transcript variant 1 (LOC476299), mRNA
          Length = 1174

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 453 ctttccgttggggctcttcttgtccgcggggtacag 488
           |||||| |||||||||||||||| ||| ||||||||
Sbjct: 745 ctttcccttggggctcttcttgttcgctgggtacag 710
to top
>ref|XM_850754.1| PREDICTED: Canis familiaris similar to fructose-1,6-bisphosphatase
           1, transcript variant 4 (LOC476299), mRNA
          Length = 1259

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 453 ctttccgttggggctcttcttgtccgcggggtacag 488
           |||||| |||||||||||||||| ||| ||||||||
Sbjct: 832 ctttcccttggggctcttcttgttcgctgggtacag 797
to top
>ref|XM_843213.1| PREDICTED: Canis familiaris similar to fructose-1,6-bisphosphatase 1,
            transcript variant 3 (LOC476299), mRNA
          Length = 1492

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 453  ctttccgttggggctcttcttgtccgcggggtacag 488
            |||||| |||||||||||||||| ||| ||||||||
Sbjct: 1063 ctttcccttggggctcttcttgttcgctgggtacag 1028
to top
>gb|AF130251.1|AF130251 Musa acuminata cytosolic fructose-1,6-bisphosphatase (FBPban1)
           mRNA, complete cds
          Length = 1237

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 93/116 (80%)
 Strand = Plus / Minus

                                                                       
Query: 370 gcccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgacatgggg 429
           ||||| || ||||| || |||| ||| || || ||||| ||||||||||||||||| || 
Sbjct: 973 gcccgttgcttgccagtaaaagcttgaccccctgcttgttccatcaggaatgacattgga 914

                                                                   
Query: 430 aaaacctcgtacagaacacgaagctttccgttggggctcttcttgtccgcggggta 485
           || || || || |||||||| || || || || || |||||||| ||||| |||||
Sbjct: 913 aatacttcatatagaacacgtagtttcccatttggactcttcttatccgcagggta 858
to top
>gb|U20179.1|BNU20179 Brassica napus fructose 1,6-bisphosphatase mRNA, complete cds
          Length = 1132

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 397 cctccggcttgctccatcaggaatgacatggggaaaacctcgtacagaacacgaagcttt 456
           ||||| ||||||||||||| ||| | ||| ||||| || || ||||| ||||| |  || 
Sbjct: 918 cctccagcttgctccatcaagaacgccattgggaagacttcatacaggacacgcaatttc 859

                                           
Query: 457 ccgttggggctcttcttgtccgcggggtacag 488
           || |||||||| |||||||| || ||||||||
Sbjct: 858 ccattggggcttttcttgtcagccgggtacag 827
to top
>gb|AY692816.1| Saccharomyces cerevisiae clone FLH113339.01X YLR377C gene, complete
           cds
          Length = 1047

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 454 tttccgttggggctcttcttgtc 476
           |||||||||||||||||||||||
Sbjct: 857 tttccgttggggctcttcttgtc 835
to top
>ref|XM_389456.1| Gibberella zeae PH-1 chromosome 4 conserved hypothetical protein
           (FG09280.1) partial mRNA
          Length = 1029

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 451 agctttccgttggggctcttcttgtccgcggggta 485
           ||||| || ||||||||||||||||| ||||||||
Sbjct: 851 agcttgcccttggggctcttcttgtcggcggggta 817
to top
>emb|Y00754.1|SCFBP1 Yeast FBP1 gene for fructose-1.6-bisphosphatase (EC 3.1.3.11)
          Length = 1869

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 454  tttccgttggggctcttcttgtc 476
            |||||||||||||||||||||||
Sbjct: 1175 tttccgttggggctcttcttgtc 1153
to top
>gb|U19103.1|YSCL8039 Saccharomyces cerevisiae chromosome XII cosmid 8039
          Length = 31806

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 454   tttccgttggggctcttcttgtc 476
             |||||||||||||||||||||||
Sbjct: 29703 tttccgttggggctcttcttgtc 29725
to top
>gb|J03207.1|YSCFBPA S.cerevisiae fructose-1,6-bisphosphatase (FBP) gene, complete cds
          Length = 2202

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 454  tttccgttggggctcttcttgtc 476
            |||||||||||||||||||||||
Sbjct: 1498 tttccgttggggctcttcttgtc 1476
to top
>emb|AL115150.1|CNS01C6U Botrytis cinerea strain T4 cDNA library
          Length = 540

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 460 ttggggctcttcttgtccgcggggta 485
           ||||||||||| ||||||||||||||
Sbjct: 283 ttggggctctttttgtccgcggggta 258
to top
>emb|AL113555.1|CNS01AYJ Botrytis cinerea strain T4 cDNA library
          Length = 708

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 460 ttggggctcttcttgtccgcggggta 485
           ||||||||||| ||||||||||||||
Sbjct: 429 ttggggctctttttgtccgcggggta 404
to top
>ref|XM_977287.1| PREDICTED: Mus musculus hypothetical protein LOC621809 (LOC621809),
           mRNA
          Length = 923

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 134 ggtgaatgttttctaaacatcaccc 158
           |||||||| ||||||||||||||||
Sbjct: 148 ggtgaatggtttctaaacatcaccc 124
to top
>ref|XM_988157.1| PREDICTED: Mus musculus hypothetical protein LOC621809 (LOC621809),
           mRNA
          Length = 923

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 134 ggtgaatgttttctaaacatcaccc 158
           |||||||| ||||||||||||||||
Sbjct: 148 ggtgaatggtttctaaacatcaccc 124
to top
>ref|XM_896651.2| PREDICTED: Mus musculus hypothetical protein LOC621809 (LOC621809),
           mRNA
          Length = 923

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 134 ggtgaatgttttctaaacatcaccc 158
           |||||||| ||||||||||||||||
Sbjct: 148 ggtgaatggtttctaaacatcaccc 124
to top
>emb|CR731123.2|CNS0GR2W Tetraodon nigroviridis full-length cDNA
          Length = 1218

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 875 agctttcccttggggctcttctcgttggcggggtaca 839
to top
>emb|CR729935.2|CNS0GQ5X Tetraodon nigroviridis full-length cDNA
          Length = 1216

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 872 agctttcccttggggctcttctcgttggcggggtaca 836
to top
>emb|CR729491.2|CNS0GPTL Tetraodon nigroviridis full-length cDNA
          Length = 1283

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 940 agctttcccttggggctcttctcgttggcggggtaca 904
to top
>emb|CR727752.2|CNS0GOHA Tetraodon nigroviridis full-length cDNA
          Length = 1280

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 936 agctttcccttggggctcttctcgttggcggggtaca 900
to top
>emb|CR727289.2|CNS0GO4F Tetraodon nigroviridis full-length cDNA
          Length = 1217

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 874 agctttcccttggggctcttctcgttggcggggtaca 838
to top
>emb|CR726696.1|CNS0GNNY Tetraodon nigroviridis full-length cDNA
          Length = 1270

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 933 agctttcccttggggctcttctcgttggcggggtaca 897
to top
>emb|CR723913.2|CNS0GLIN Tetraodon nigroviridis full-length cDNA
          Length = 1224

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 877 agctttcccttggggctcttctcgttggcggggtaca 841
to top
>emb|CR701043.2|CNS0G3VJ Tetraodon nigroviridis full-length cDNA
          Length = 1214

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 875 agctttcccttggggctcttctcgttggcggggtaca 839
to top
>emb|CR688453.2|CNS0FU5T Tetraodon nigroviridis full-length cDNA
          Length = 1214

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 874 agctttcccttggggctcttctcgttggcggggtaca 838
to top
>emb|CR689786.1|CNS0FV6U Tetraodon nigroviridis full-length cDNA
          Length = 1185

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 863 agctttcccttggggctcttctcgttggcggggtaca 827
to top
>emb|CR688620.2|CNS0FUAG Tetraodon nigroviridis full-length cDNA
          Length = 1199

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 866 agctttcccttggggctcttctcgttggcggggtaca 830
to top
>emb|CR681314.1|CNS0FONI Tetraodon nigroviridis full-length cDNA
          Length = 1191

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 865 agctttcccttggggctcttctcgttggcggggtaca 829
to top
>emb|CR679766.2|CNS0FNGI Tetraodon nigroviridis full-length cDNA
          Length = 1183

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 858 agctttcccttggggctcttctcgttggcggggtaca 822
to top
>emb|CR679267.2|CNS0FN2N Tetraodon nigroviridis full-length cDNA
          Length = 1213

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 875 agctttcccttggggctcttctcgttggcggggtaca 839
to top
>emb|CR678962.2|CNS0FMU6 Tetraodon nigroviridis full-length cDNA
          Length = 1213

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 873 agctttcccttggggctcttctcgttggcggggtaca 837
to top
>emb|CR679150.1|CNS0FMZE Tetraodon nigroviridis full-length cDNA
          Length = 1200

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 863 agctttcccttggggctcttctcgttggcggggtaca 827
to top
>emb|CR677858.1|CNS0FLZU Tetraodon nigroviridis full-length cDNA
          Length = 1199

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 863 agctttcccttggggctcttctcgttggcggggtaca 827
to top
>emb|CR677925.2|CNS0FM1P Tetraodon nigroviridis full-length cDNA
          Length = 1440

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 873 agctttcccttggggctcttctcgttggcggggtaca 837
to top
>emb|CR676053.2|CNS0FKM3 Tetraodon nigroviridis full-length cDNA
          Length = 1212

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 873 agctttcccttggggctcttctcgttggcggggtaca 837
to top
>emb|CR675016.2|CNS0FJTA Tetraodon nigroviridis full-length cDNA
          Length = 1219

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 875 agctttcccttggggctcttctcgttggcggggtaca 839
to top
>emb|CR674539.2|CNS0FJG1 Tetraodon nigroviridis full-length cDNA
          Length = 1218

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 874 agctttcccttggggctcttctcgttggcggggtaca 838
to top
>emb|CR674763.1|CNS0FJM9 Tetraodon nigroviridis full-length cDNA
          Length = 1199

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 874 agctttcccttggggctcttctcgttggcggggtaca 838
to top
>emb|CR674395.2|CNS0FJC1 Tetraodon nigroviridis full-length cDNA
          Length = 1239

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 898 agctttcccttggggctcttctcgttggcggggtaca 862
to top
>emb|CR673987.2|CNS0FJ0P Tetraodon nigroviridis full-length cDNA
          Length = 1216

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 875 agctttcccttggggctcttctcgttggcggggtaca 839
to top
>emb|CR673697.2|CNS0FISN Tetraodon nigroviridis full-length cDNA
          Length = 1217

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 874 agctttcccttggggctcttctcgttggcggggtaca 838
to top
>emb|CR672580.2|CNS0FHXM Tetraodon nigroviridis full-length cDNA
          Length = 1218

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 921 agctttcccttggggctcttctcgttggcggggtaca 885
to top
>emb|CR672777.1|CNS0FI33 Tetraodon nigroviridis full-length cDNA
          Length = 1521

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 871 agctttcccttggggctcttctcgttggcggggtaca 835
to top
>emb|CR671973.2|CNS0FHGR Tetraodon nigroviridis full-length cDNA
          Length = 1210

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 873 agctttcccttggggctcttctcgttggcggggtaca 837
to top
>emb|CR671920.2|CNS0FHFA Tetraodon nigroviridis full-length cDNA
          Length = 1280

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 937 agctttcccttggggctcttctcgttggcggggtaca 901
to top
>emb|CR670679.2|CNS0FGGT Tetraodon nigroviridis full-length cDNA
          Length = 1215

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 896 agctttcccttggggctcttctcgttggcggggtaca 860
to top
>emb|CR670270.2|CNS0FG5G Tetraodon nigroviridis full-length cDNA
          Length = 1199

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 868 agctttcccttggggctcttctcgttggcggggtaca 832
to top
>emb|CR666565.2|CNS0FDAJ Tetraodon nigroviridis full-length cDNA
          Length = 1222

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 897 agctttcccttggggctcttctcgttggcggggtaca 861
to top
>emb|CR666528.2|CNS0FD9I Tetraodon nigroviridis full-length cDNA
          Length = 1210

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 873 agctttcccttggggctcttctcgttggcggggtaca 837
to top
>emb|CR664928.2|CNS0FC12 Tetraodon nigroviridis full-length cDNA
          Length = 1210

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 873 agctttcccttggggctcttctcgttggcggggtaca 837
to top
>emb|CR664903.2|CNS0FC0D Tetraodon nigroviridis full-length cDNA
          Length = 1205

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 874 agctttcccttggggctcttctcgttggcggggtaca 838
to top
>emb|CR663156.2|CNS0FANU Tetraodon nigroviridis full-length cDNA
          Length = 1239

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 900 agctttcccttggggctcttctcgttggcggggtaca 864
to top
>emb|CR662062.2|CNS0F9TG Tetraodon nigroviridis full-length cDNA
          Length = 1190

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 848 agctttcccttggggctcttctcgttggcggggtaca 812
to top
>emb|CR661920.2|CNS0F9PI Tetraodon nigroviridis full-length cDNA
          Length = 1158

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 860 agctttcccttggggctcttctcgttggcggggtaca 824
to top
>emb|CR661599.2|CNS0F9GL Tetraodon nigroviridis full-length cDNA
          Length = 1207

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 870 agctttcccttggggctcttctcgttggcggggtaca 834
to top
>emb|CR660832.2|CNS0F8VA Tetraodon nigroviridis full-length cDNA
          Length = 1561

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 876 agctttcccttggggctcttctcgttggcggggtaca 840
to top
>emb|CR660718.2|CNS0F8S4 Tetraodon nigroviridis full-length cDNA
          Length = 1163

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 866 agctttcccttggggctcttctcgttggcggggtaca 830
to top
>emb|CR659043.2|CNS0F7HL Tetraodon nigroviridis full-length cDNA
          Length = 1216

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 877 agctttcccttggggctcttctcgttggcggggtaca 841
to top
>emb|CR659356.1|CNS0F7QA Tetraodon nigroviridis full-length cDNA
          Length = 1224

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 900 agctttcccttggggctcttctcgttggcggggtaca 864
to top
>emb|CR658470.2|CNS0F71O Tetraodon nigroviridis full-length cDNA
          Length = 1220

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 876 agctttcccttggggctcttctcgttggcggggtaca 840
to top
>emb|CR658127.2|CNS0F6S5 Tetraodon nigroviridis full-length cDNA
          Length = 1200

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 866 agctttcccttggggctcttctcgttggcggggtaca 830
to top
>emb|CR657521.2|CNS0F6BB Tetraodon nigroviridis full-length cDNA
          Length = 1210

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 872 agctttcccttggggctcttctcgttggcggggtaca 836
to top
>emb|CR657430.2|CNS0F68S Tetraodon nigroviridis full-length cDNA
          Length = 1203

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 865 agctttcccttggggctcttctcgttggcggggtaca 829
to top
>emb|CR656919.1|CNS0F5UL Tetraodon nigroviridis full-length cDNA
          Length = 1200

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 868 agctttcccttggggctcttctcgttggcggggtaca 832
to top
>emb|CR655445.2|CNS0F4PN Tetraodon nigroviridis full-length cDNA
          Length = 533

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487
           |||||||| ||||||||||||| ||  ||||||||||
Sbjct: 194 agctttcccttggggctcttctcgttggcggggtaca 158
to top
>ref|XM_777318.1| PREDICTED: Strongylocentrotus purpuratus similar to
           fructose-1,6-bisphosphatase 1, like (LOC577064), mRNA
          Length = 1100

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 451 agctttccgttggggctcttcttgt 475
           |||||||| ||||||||||||||||
Sbjct: 913 agctttcccttggggctcttcttgt 889
to top
>dbj|AK043613.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length
           enriched library, clone:A830012D13
           product:unclassifiable, full insert sequence
          Length = 925

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 134 ggtgaatgttttctaaacatcaccc 158
           |||||||| ||||||||||||||||
Sbjct: 150 ggtgaatggtttctaaacatcaccc 126
to top
>gb|AC157819.5| Mus musculus chromosome 3, clone RP24-273H20, complete sequence
          Length = 151601

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 134   ggtgaatgttttctaaacatcaccc 158
             |||||||| ||||||||||||||||
Sbjct: 45664 ggtgaatggtttctaaacatcaccc 45640
to top
>gb|AC103937.16| Mus musculus chromosome 3, clone RP23-229C5, complete sequence
          Length = 179805

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 134    ggtgaatgttttctaaacatcaccc 158
              |||||||| ||||||||||||||||
Sbjct: 118921 ggtgaatggtttctaaacatcaccc 118897
to top
>gb|AC093267.2| Homo sapiens chromosome 5 clone RP11-280F11, complete sequence
          Length = 170999

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 201   tgaacataacttttcctttt 220
             ||||||||||||||||||||
Sbjct: 36201 tgaacataacttttcctttt 36182
to top
>emb|CT010516.6| Mouse DNA sequence from clone RP23-276H24 on chromosome 14, complete
             sequence
          Length = 194815

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 453   ctttccgttggggctcttct 472
             ||||||||||||||||||||
Sbjct: 47339 ctttccgttggggctcttct 47358


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,193,951
Number of Sequences: 3902068
Number of extensions: 3193951
Number of successful extensions: 49772
Number of sequences better than 10.0: 114
Number of HSP's better than 10.0 without gapping: 114
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49606
Number of HSP's gapped (non-prelim): 165
length of query: 491
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 469
effective length of database: 17,147,199,772
effective search space: 8042036693068
effective search space used: 8042036693068
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top