>gb|AF149851.2| Pseudomonas stutzeri KC hypothetical protein, putative cell membrane
            protein, MoeB-like protein, putative protein, MoaD-like
            protein, putative oxidoreductase, and putative AMP ligase
            genes, complete cds; and putative outer membrane receptor
            gene, partial cds
          Length = 8274

 Score = 44.1 bits (22), Expect = 0.075
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 36   attgttggacatgggcatgcag 57
            ||||||||||||||||||||||
Sbjct: 1749 attgttggacatgggcatgcag 1770

>gb|AF196567.2| Pseudomonas stutzeri pdt locus, partial sequence
          Length = 25746

 Score = 44.1 bits (22), Expect = 0.075
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 36   attgttggacatgggcatgcag 57
            ||||||||||||||||||||||
Sbjct: 5789 attgttggacatgggcatgcag 5810

>gb|AC183801.3| Pan troglodytes BAC clone CH251-162F3 from chromosome 19, complete
              sequence
          Length = 193838

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 17     tctggataggggaaaataca 36
              ||||||||||||||||||||
Sbjct: 179775 tctggataggggaaaataca 179794



 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 18    ctggataggggaaaataca 36
             |||||||||||||||||||
Sbjct: 72295 ctggataggggaaaataca 72313



 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 18    ctggataggggaaaataca 36
             |||||||||||||||||||
Sbjct: 46633 ctggataggggaaaataca 46651



 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 18   ctggataggggaaaataca 36
            |||||||||||||||||||
Sbjct: 4039 ctggataggggaaaataca 4057

>emb|AL161722.9| Human DNA sequence from clone RP11-497J7 on chromosome X Contains a
             melanoma antigen family B 4 pseudogene and a nuclear
             transcription factor Y, gamma (NFYC) pseudogene, complete
             sequence
          Length = 154594

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 50    gcatgcagttgatgttatgttttt 73
             ||||||||||||||||| ||||||
Sbjct: 81664 gcatgcagttgatgttaggttttt 81641

>gb|AC009368.8| Drosophila melanogaster 3L BAC RP98-4F7 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 158816

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 46    atgggcatgcagttgatgtt 65
             ||||||||||||||||||||
Sbjct: 95332 atgggcatgcagttgatgtt 95351

>gb|AC022509.21|AC022509 Homo sapiens 12 BAC RP11-283G6 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 204228

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 40    ttggacatgggcatgcagtt 59
             ||||||||||||||||||||
Sbjct: 67482 ttggacatgggcatgcagtt 67501

>gb|AE003520.4| Drosophila melanogaster chromosome 3L, section 65 of 83 of the complete
             sequence
          Length = 275124

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 46    atgggcatgcagttgatgtt 65
             ||||||||||||||||||||
Sbjct: 18100 atgggcatgcagttgatgtt 18119

>gb|AC183301.4| Pan troglodytes BAC clone CH251-243F23 from chromosome 19, complete
            sequence
          Length = 157473

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 18   ctggataggggaaaataca 36
            |||||||||||||||||||
Sbjct: 4022 ctggataggggaaaataca 4040

>gb|AC005392.2| Homo sapiens chromosome 19 clone CTC-490G23, complete sequence
          Length = 243197

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 18     ctggataggggaaaataca 36
              |||||||||||||||||||
Sbjct: 117278 ctggataggggaaaataca 117260



 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 18    ctggataggggaaaataca 36
             |||||||||||||||||||
Sbjct: 53353 ctggataggggaaaataca 53335

>gb|AC093055.3| Homo sapiens chromosome 19 clone LLNLF-157B1, complete sequence
          Length = 8499

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 18   ctggataggggaaaataca 36
            |||||||||||||||||||
Sbjct: 2627 ctggataggggaaaataca 2609

>gb|AC183545.2| Pan troglodytes BAC clone CH251-233G24 from chromosome 19, complete
             sequence
          Length = 151627

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 18    ctggataggggaaaataca 36
             |||||||||||||||||||
Sbjct: 29621 ctggataggggaaaataca 29639

>gb|AC092825.5| Homo sapiens 3 BAC RP11-171G7 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 157842

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 55    cagttgatgttatgttttt 73
             |||||||||||||||||||
Sbjct: 42459 cagttgatgttatgttttt 42477

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 58       ttgatgttatgtttttgct 76
                |||||||||||||||||||
Sbjct: 10965371 ttgatgttatgtttttgct 10965389

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8,
              complete sequence
          Length = 28434780

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 55     cagttgatgttatgttttt 73
              |||||||||||||||||||
Sbjct: 454526 cagttgatgttatgttttt 454508

>gb|AY087953.1| Arabidopsis thaliana clone 3988 mRNA, complete sequence
          Length = 1450

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 27  ggaaaatacattgttggac 45
           |||||||||||||||||||
Sbjct: 585 ggaaaatacattgttggac 603

>dbj|AP005400.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0698G06
          Length = 138282

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 58     ttgatgttatgtttttgct 76
              |||||||||||||||||||
Sbjct: 105076 ttgatgttatgtttttgct 105094

>dbj|AP004584.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0007D08
          Length = 183142

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 55    cagttgatgttatgttttt 73
             |||||||||||||||||||
Sbjct: 44486 cagttgatgttatgttttt 44468

>gb|AF106547.1|HOM4PSG1 Homo sapiens pregnancy-specific beta-1-glycoprotein 4 precursor
            (PSG4) gene, exon 1
          Length = 1194

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 18   ctggataggggaaaataca 36
            |||||||||||||||||||
Sbjct: 1156 ctggataggggaaaataca 1174

>gb|AF106541.1|HOMOP1SG1 Homo sapiens pregnancy-specific beta-1 glycoprotein 1 (PSG1) gene,
            exon 1 sequence
          Length = 1247

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 18   ctggataggggaaaataca 36
            |||||||||||||||||||
Sbjct: 1062 ctggataggggaaaataca 1080

>gb|AC005238.1|AC005238 Homo sapiens chromosome 19, cosmid F25173, complete sequence
          Length = 43690

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 18    ctggataggggaaaataca 36
             |||||||||||||||||||
Sbjct: 30887 ctggataggggaaaataca 30869



 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 18   ctggataggggaaaataca 36
            |||||||||||||||||||
Sbjct: 6919 ctggataggggaaaataca 6901

>gb|AC005260.1|AC005260 Homo sapiens chromosome 19, cosmid F21645, complete sequence
          Length = 40910

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 18    ctggataggggaaaataca 36
             |||||||||||||||||||
Sbjct: 23077 ctggataggggaaaataca 23059

>gb|AC004784.1|AC004784 Homo sapiens chromosome 19, cosmid R26425, complete sequence
          Length = 44760

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 18   ctggataggggaaaataca 36
            |||||||||||||||||||
Sbjct: 9413 ctggataggggaaaataca 9395

>gb|AC004654.1|AC004654 Homo sapiens chromosome 19, cosmid F19434, complete sequence
          Length = 42139

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 18    ctggataggggaaaataca 36
             |||||||||||||||||||
Sbjct: 10285 ctggataggggaaaataca 10267


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 993,109
Number of Sequences: 3902068
Number of extensions: 993109
Number of successful extensions: 89644
Number of sequences better than 10.0: 24
Number of HSP's better than 10.0 without gapping: 24
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 89558
Number of HSP's gapped (non-prelim): 86
length of query: 104
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 83
effective length of database: 17,151,101,840
effective search space: 1423541452720
effective search space used: 1423541452720
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)