ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart35f03
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_478842.1| Oryza sativa (japonica cultivar-group), mRNA 270 4e-69
2gb|AY104319.1| Zea mays PCO131533 mRNA sequence 240 3e-60
3dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 174 2e-40
4dbj|AP003804.3| Oryza sativa (japonica cultivar-group) genomic D... 174 2e-40
5emb|BX830319.1|CNS09ZZW Arabidopsis thaliana Full-length cDNA Co... 92 2e-15
6gb|AC157350.29| Medicago truncatula clone mth2-143n6, complete s... 88 3e-14
7ref|NM_122231.2| Arabidopsis thaliana catalytic/ succinate-CoA l... 84 5e-13
8gb|DQ235193.1| Solanum tuberosum clone 167F09 succinyl-CoA ligas... 84 5e-13
9gb|AY114607.1| Arabidopsis thaliana succinyl-CoA synthetase alph... 84 5e-13
10gb|AY092994.1| Arabidopsis thaliana succinyl-CoA synthetase, alp... 84 5e-13
11gb|AY087899.1| Arabidopsis thaliana clone 39462 mRNA, complete s... 80 7e-12
12ref|NM_120913.3| Arabidopsis thaliana catalytic/ succinate-CoA l... 68 3e-08
13emb|AJ001807.1|ATSCLAS Arabidopsis thaliana mRNA for Succinyl-Co... 68 3e-08
14gb|AY114613.1| Arabidopsis thaliana succinyl-CoA-ligase alpha su... 68 3e-08
15gb|AY072333.1| Arabidopsis thaliana succinyl-CoA-ligase alpha su... 68 3e-08
16emb|BX830929.1|CNS09ZGH Arabidopsis thaliana Full-length cDNA Co... 68 3e-08
17emb|BX831587.1|CNS09YP8 Arabidopsis thaliana Full-length cDNA Co... 68 3e-08
18gb|AY084298.1| Arabidopsis thaliana clone 10292 mRNA, complete s... 68 3e-08
19gb|AY167586.1| Lycopersicon esculentum succinyl-CoA ligase alpha... 68 3e-08
20emb|X69138.1|ATSCOALA A.thaliana mRNA for succinate--CoA ligase ... 66 1e-07
21dbj|AB007648.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 66 1e-07
22emb|AL392174.1|ATF8L15 Arabidopsis thaliana DNA chromosome 5, BA... 62 2e-06
23gb|BT012809.1| Lycopersicon esculentum clone 113829R, mRNA sequence 58 3e-05
24gb|AY650029.1| Lycopersicon esculentum cultivar TA496 succinyl-C... 58 3e-05
25dbj|AK114572.1| Ciona intestinalis cDNA, clone:cieg007a19, full ... 50 0.006
26gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 48 0.025
27gb|AE006470.1| Chlorobium tepidum TLS, complete genome 48 0.025
28gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complet... 44 0.39
29gb|AC122025.3| Mus musculus BAC clone RP24-388G8 from 12, comple... 44 0.39
30gb|AC109461.3| Homo sapiens chromosome 5 clone RP11-269G2, compl... 44 0.39
31gb|AC159274.2| Mus musculus BAC clone RP23-405C6 from chromosome... 44 0.39
32ref|NM_104276.1| Arabidopsis thaliana carboxylic ester hydrolase... 42 1.6
33gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Ph... 42 1.6
34gb|AC102342.10| Mus musculus chromosome 18, clone RP23-250K3, co... 42 1.6
35gb|AC121827.3| Mus musculus BAC clone RP23-476B3 from chromosome... 42 1.6
36gb|AC130719.3| Mus musculus BAC clone RP24-107M5 from chromosome... 42 1.6
37gb|AC142453.3| Mus musculus BAC clone RP23-398A2 from chromosome... 42 1.6
38gb|AC136023.5| Mus musculus BAC clone RP24-501J4 from chromosome... 42 1.6
39gb|AC102769.11| Mus musculus chromosome 17, clone RP23-89A3, com... 42 1.6
40gb|AC127324.4| Mus musculus BAC clone RP23-244I2 from chromosome... 42 1.6
41gb|AC122796.3| Mus musculus BAC clone RP24-347J6 from chromosome... 42 1.6
42gb|AC126273.3| Mus musculus BAC clone RP23-99P15 from 7, complet... 42 1.6
43gb|AC124545.4| Mus musculus BAC clone RP23-272D9 from 7, complet... 42 1.6
44gb|AC157595.4| Mus musculus BAC clone RP23-238F18 from chromosom... 42 1.6
45gb|AC012588.14| Homo sapiens chromosome 18, clone RP11-17A19, co... 42 1.6
46gb|AC156566.3| Mus musculus BAC clone RP23-337B16 from chromosom... 42 1.6
47emb|BX539312.7| Mouse DNA sequence from clone RP24-164C21 on chr... 42 1.6
48gb|AC155925.2| Mus musculus BAC clone RP24-248C21 from 9, comple... 42 1.6
49gb|AY899808.1| Mus musculus potassium channel tetramerization do... 42 1.6
50gb|AC006577.2|F15I1 Sequence of BAC F15I1 from Arabidopsis thali... 42 1.6
51gb|AC172890.2| Mus musculus BAC clone RP24-337A4 from chromosome... 42 1.6
52gb|AC127238.5| Mus musculus BAC clone RP24-378P20 from 7, comple... 42 1.6
53gb|AC150684.2| Mus musculus BAC clone RP23-268G6 from 7, complet... 42 1.6
54gb|AC173484.2| Mus musculus BAC clone RP23-250N1 from chromosome... 42 1.6
55emb|CT010437.15| Mouse DNA sequence from clone RP23-333O22 on ch... 42 1.6
56gb|AC173478.1| Mus musculus BAC clone RP24-81N9 from chromosome ... 42 1.6
57gb|AC172366.1| Mus musculus BAC clone RP24-499J10 from chromosom... 42 1.6
58gb|AC110816.7| Mus musculus BAC clone RP23-20P15 from chromosome... 40 6.2
59gb|AE007300.1| Sinorhizobium meliloti 1021 plasmid pSymA section... 40 6.2
60gb|AC161509.8| Mus musculus chromosome 7, clone RP23-53O17, comp... 40 6.2
61gb|AC132270.3| Mus musculus BAC clone RP24-338C23 from chromosom... 40 6.2
62gb|AC147241.2| Mus musculus BAC clone RP23-417C21 from chromosom... 40 6.2
63gb|AC121828.3| Mus musculus BAC clone RP23-478K4 from chromosome... 40 6.2
64gb|AC112146.3| Mus musculus BAC clone RP23-101G11 from 12, compl... 40 6.2
65ref|XM_546508.2| PREDICTED: Canis familiaris beta-site APP-cleav... 40 6.2
66ref|XM_533492.2| PREDICTED: Canis familiaris similar to thrombos... 40 6.2
67gb|AC111092.10| Mus musculus chromosome 12, clone RP23-168O9, co... 40 6.2
68gb|AC109152.13| Mus musculus chromosome 18, clone RP23-166J4, co... 40 6.2
69emb|CR788268.5| Human DNA sequence from clone RP11-24B13 on chro... 40 6.2
70emb|BX005040.12| Human DNA sequence from clone RP11-101E5 on chr... 40 6.2
71emb|BX005195.5| Human DNA sequence from clone RP11-203I2 on chro... 40 6.2
72emb|AL772262.4| Human DNA sequence from clone RP11-444C24 on chr... 40 6.2
73emb|AL592525.10| Human DNA sequence from clone RP11-111G23 on ch... 40 6.2
74emb|AL353729.17| Human DNA sequence from clone RP11-290L7 on chr... 40 6.2
75emb|AL160037.17| Human DNA sequence from clone RP11-289G11 on ch... 40 6.2
76emb|AL161454.10| Human DNA sequence from clone RP11-72B4 on chro... 40 6.2
77gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 40 6.2
78emb|CR385085.9| Zebrafish DNA sequence from clone CH211-195A16, ... 40 6.2
79gb|AC010030.10| Drosophila melanogaster 3L BAC RP98-2C14 (Roswel... 40 6.2
80gb|AC108877.2| Drosophila melanogaster 3L BAC RP98-17L24 (Roswel... 40 6.2
81gb|AC023751.3| Drosophila melanogaster 3L BAC RP98-31C17 (Roswel... 40 6.2
82gb|AC092713.2| Homo sapiens chromosome 17, clone CTC-780D20, com... 40 6.2
83ref|NM_168102.1| Drosophila melanogaster Guanine nucleotide exch... 40 6.2
84gb|AY064174.1| Drosophila melanogaster rho GTPase guanine nucleo... 40 6.2
85gb|CP000264.1| Jannaschia sp. CCS1, complete genome 40 6.2
86gb|AY060795.1| Drosophila melanogaster GH26207 full length cDNA 40 6.2
87emb|BX470204.13| Zebrafish DNA sequence from clone CH211-63C23 i... 40 6.2
88gb|AC026955.10|AC026955 Homo sapiens chromosome 17, clone RP11-5... 40 6.2
89gb|AC022509.21|AC022509 Homo sapiens 12 BAC RP11-283G6 (Roswell ... 40 6.2
90gb|AC019183.3|AC019183 Homo sapiens BAC clone RP11-291G24 from 1... 40 6.2
91emb|BX005463.5| Zebrafish DNA sequence from clone CH211-177H19 i... 40 6.2
92emb|BX293568.7| Zebrafish DNA sequence from clone CH211-215F13 i... 40 6.2
93gb|AE003546.4| Drosophila melanogaster chromosome 3L, section 39... 40 6.2
94gb|AE003482.4| Drosophila melanogaster chromosome 3L, section 16... 40 6.2
95gb|U51244.1|U51244 Homo sapiens BAC clone 1D9 from 2p21, complet... 40 6.2
96gb|AC116556.14| Mus musculus strain C57BL/6J chromosome 8 clone ... 40 6.2
97gb|AC102117.13| Mus musculus chromosome 7, clone RP23-154P9, com... 40 6.2
98emb|AJ509645.1|AME509645 Apis mellifera microsatellite marker Am... 40 6.2
99emb|AL591704.7| Human DNA sequence from clone RP1-128L15 on chro... 40 6.2
100emb|AL672074.19| Mouse DNA sequence from clone RP23-404I18 on ch... 40 6.2
101gb|AC145948.5| Gallus gallus BAC clone CH261-24O17 from chromoso... 40 6.2
102gb|AC132618.3| Mus musculus BAC clone RP23-238K12 from 6, comple... 40 6.2
103emb|AL731829.10| Mouse DNA sequence from clone RP23-383P24 on ch... 40 6.2
104tpd|BR000043.1| TPA: TPA_exp: Homo sapiens S100 calcium binding ... 40 6.2
105emb|AL611970.11| Mouse DNA sequence from clone RP23-413K17 on ch... 40 6.2
106gb|AC034198.7| Homo sapiens chromosome 3 clone RP11-767C1 map 3p... 40 6.2
107gb|AC018836.5| Homo sapiens chromosome 3 clone RP11-588P9 map 3p... 40 6.2 
>ref|XM_478842.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 996

 Score =  270 bits (136), Expect = 4e-69
 Identities = 211/236 (89%)
 Strand = Plus / Minus

                                                                       
Query: 222 tctaccatcccgcgctgcttgaaaatttcaaacatggtcgaaccaatcttagctggtgac 281
           |||| ||| ||||| |||||||||||||| ||||| || ||||||||||| |||||||||
Sbjct: 992 tctaacattccgcgttgcttgaaaatttcgaacatagttgaaccaatcttcgctggtgac 933

                                                                       
Query: 282 tcgacaacagttaccccagcctccctgagtgccttgatcttgtcttgggcagtacccttg 341
           || |||||||| ||||||||||| ||||| |||||||| |||||||| || |||||||||
Sbjct: 932 tcaacaacagtaaccccagcctctctgagagccttgattttgtcttgtgccgtacccttg 873

                                                                       
Query: 342 ccccctgacacaattgctccagcatggcccatgcgacggcccgggggtgcagtaagtcca 401
           |||||||||||||||||||||||||| ||||||||||| || || || ||||| ||||||
Sbjct: 872 ccccctgacacaattgctccagcatgacccatgcgacgcccaggtggagcagtgagtcca 813

                                                                   
Query: 402 gctatgaatgcaacgacaggcttttctgttttgctctcccggataaaggctgcagc 457
           |||||||||||||| |||||||||| ||||||||||||| | || |||||||||||
Sbjct: 812 gctatgaatgcaacaacaggcttttgtgttttgctctcctgaatgaaggctgcagc 757
to top
>gb|AY104319.1| Zea mays PCO131533 mRNA sequence
          Length = 1619

 Score =  240 bits (121), Expect = 3e-60
 Identities = 202/229 (88%)
 Strand = Plus / Minus

                                                                        
Query: 217  tctactctaccatcccgcgctgcttgaaaatttcaaacatggtcgaaccaatcttagctg 276
            |||| |||||||| || ||||||||||| |||||||||||||| || |||||||| || |
Sbjct: 1152 tctattctaccattccacgctgcttgaagatttcaaacatggtagagccaatcttcgccg 1093

                                                                        
Query: 277  gtgactcgacaacagttaccccagcctccctgagtgccttgatcttgtcttgggcagtac 336
            ||||||||||||| || || || ||||| |||||||||||||| ||||| ||||||||||
Sbjct: 1092 gtgactcgacaacggtaacacctgcctctctgagtgccttgattttgtcctgggcagtac 1033

                                                                        
Query: 337  ccttgccccctgacacaattgctccagcatggcccatgcgacggcccgggggtgcagtaa 396
            |||| || |||| ||| || ||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 1032 cctttcctcctgccacgatagctccagcatgacccatgcgacggcccgggggtgccgtaa 973

                                                             
Query: 397  gtccagctatgaatgcaacgacaggcttttctgttttgctctcccggat 445
            ||||||| ||||||||||| |||||||||| ||||||||| ||| ||||
Sbjct: 972  gtccagcaatgaatgcaacaacaggcttttgtgttttgctttcctggat 924
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  174 bits (88), Expect = 2e-40
 Identities = 145/164 (88%)
 Strand = Plus / Minus

                                                                            
Query: 196      tctactggaccatttcttctctctactctaccatcccgcgctgcttgaaaatttcaaaca 255
                ||||||| |||||||  |||| ||| |||| ||| ||||| |||||||||||||| ||||
Sbjct: 23312031 tctactgtaccatttgctctccctattctaacattccgcgttgcttgaaaatttcgaaca 23311972

                                                                            
Query: 256      tggtcgaaccaatcttagctggtgactcgacaacagttaccccagcctccctgagtgcct 315
                | || ||||||||||| ||||||||||| |||||||| ||||||||||| ||||| ||||
Sbjct: 23311971 tagttgaaccaatcttcgctggtgactcaacaacagtaaccccagcctctctgagagcct 23311912

                                                            
Query: 316      tgatcttgtcttgggcagtacccttgccccctgacacaattgct 359
                |||| |||||||| || |||||||||||||||||||||||||||
Sbjct: 23311911 tgattttgtcttgtgccgtacccttgccccctgacacaattgct 23311868



 Score =  101 bits (51), Expect = 2e-18
 Identities = 75/83 (90%)
 Strand = Plus / Minus

                                                                            
Query: 358      ctccagcatggcccatgcgacggcccgggggtgcagtaagtccagctatgaatgcaacga 417
                |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||| |
Sbjct: 23311266 ctccagcatgacccatgcgacgcccaggtggagcagtgagtccagctatgaatgcaacaa 23311207

                                       
Query: 418      caggcttttctgttttgctctcc 440
                ||||||||| |||||||||||||
Sbjct: 23311206 caggcttttgtgttttgctctcc 23311184
to top
>dbj|AP003804.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1065_B06
          Length = 113170

 Score =  174 bits (88), Expect = 2e-40
 Identities = 145/164 (88%)
 Strand = Plus / Minus

                                                                         
Query: 196   tctactggaccatttcttctctctactctaccatcccgcgctgcttgaaaatttcaaaca 255
             ||||||| |||||||  |||| ||| |||| ||| ||||| |||||||||||||| ||||
Sbjct: 67289 tctactgtaccatttgctctccctattctaacattccgcgttgcttgaaaatttcgaaca 67230

                                                                         
Query: 256   tggtcgaaccaatcttagctggtgactcgacaacagttaccccagcctccctgagtgcct 315
             | || ||||||||||| ||||||||||| |||||||| ||||||||||| ||||| ||||
Sbjct: 67229 tagttgaaccaatcttcgctggtgactcaacaacagtaaccccagcctctctgagagcct 67170

                                                         
Query: 316   tgatcttgtcttgggcagtacccttgccccctgacacaattgct 359
             |||| |||||||| || |||||||||||||||||||||||||||
Sbjct: 67169 tgattttgtcttgtgccgtacccttgccccctgacacaattgct 67126



 Score =  101 bits (51), Expect = 2e-18
 Identities = 75/83 (90%)
 Strand = Plus / Minus

                                                                         
Query: 358   ctccagcatggcccatgcgacggcccgggggtgcagtaagtccagctatgaatgcaacga 417
             |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||| |
Sbjct: 66524 ctccagcatgacccatgcgacgcccaggtggagcagtgagtccagctatgaatgcaacaa 66465

                                    
Query: 418   caggcttttctgttttgctctcc 440
             ||||||||| |||||||||||||
Sbjct: 66464 caggcttttgtgttttgctctcc 66442
to top
>emb|BX830319.1|CNS09ZZW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB73ZB09 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1350

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 148/182 (81%)
 Strand = Plus / Minus

                                                                        
Query: 249  tcaaacatggtcgaaccaatcttagctggtgactcgacaacagttaccccagcctccctg 308
            |||||||| | || ||||||||||||||||||||| || ||  | || || || || || 
Sbjct: 1056 tcaaacatcgccgcaccaatcttagctggtgactcaaccaccttaactcctgcgtctctt 997

                                                                        
Query: 309  agtgccttgatcttgtcttgggcagtacccttgccccctgacacaattgctccagcatgg 368
            ||   ||| ||||||||||| || || ||||| || || || ||||| ||||| ||||| 
Sbjct: 996  aggctctttatcttgtcttgagccgtgcccttaccaccggaaacaatggctcccgcatga 937

                                                                        
Query: 369  cccatgcgacggcccgggggtgcagtaagtccagctatgaatgcaacgacaggcttttct 428
            ||||| ||||| || || |||||||||||||| |||||||| ||||| ||||||||||||
Sbjct: 936  cccatacgacgccctggtggtgcagtaagtccggctatgaaagcaactacaggcttttct 877

              
Query: 429  gt 430
            ||
Sbjct: 876  gt 875
to top
>gb|AC157350.29| Medicago truncatula clone mth2-143n6, complete sequence
          Length = 131960

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 101/120 (84%)
 Strand = Plus / Plus

                                                                         
Query: 236   ctgcttgaaaatttcaaacatggtcgaaccaatcttagctggtgactcgacaacagttac 295
             |||||||||||||||||||||||  |  ||||| |||||||| ||||| ||||| || ||
Sbjct: 52027 ctgcttgaaaatttcaaacatggcagctccaattttagctggggactccacaactgtcac 52086

                                                                         
Query: 296   cccagcctccctgagtgccttgatcttgtcttgggcagtacccttgccccctgacacaat 355
              ||||| |||||||| |   |||| |||||||| |||||||||||||| || ||||||||
Sbjct: 52087 tccagcttccctgagggtgctgattttgtcttgagcagtacccttgccacccgacacaat 52146
to top
>ref|NM_122231.2| Arabidopsis thaliana catalytic/ succinate-CoA ligase (GDP-forming)
            AT5G23250 mRNA, complete cds
          Length = 1449

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 147/182 (80%)
 Strand = Plus / Minus

                                                                        
Query: 249  tcaaacatggtcgaaccaatcttagctggtgactcgacaacagttaccccagcctccctg 308
            |||||||| | || ||||||||||||||||||||| || ||  | || || || || || 
Sbjct: 1066 tcaaacatcgccgcaccaatcttagctggtgactcaaccaccttaactcctgcgtctctt 1007

                                                                        
Query: 309  agtgccttgatcttgtcttgggcagtacccttgccccctgacacaattgctccagcatgg 368
            ||   ||| ||||||||||| || || ||||| || || || ||||| ||||| ||||| 
Sbjct: 1006 aggctctttatcttgtcttgagccgtgcccttaccaccggaaacaatggctcccgcatga 947

                                                                        
Query: 369  cccatgcgacggcccgggggtgcagtaagtccagctatgaatgcaacgacaggcttttct 428
            ||||| ||||| || || |||||||||||||| |||||||| ||||| |||||||| |||
Sbjct: 946  cccatacgacgccctggtggtgcagtaagtccggctatgaaagcaactacaggcttgtct 887

              
Query: 429  gt 430
            ||
Sbjct: 886  gt 885
to top
>gb|DQ235193.1| Solanum tuberosum clone 167F09 succinyl-CoA ligase alpha 1
           subunit-like mRNA, complete cds
          Length = 1389

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 99/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 309 agtgccttgatcttgtcttgggcagtacccttgccccctgacacaattgctccagcatgg 368
           ||||||||||| ||||||||||| || ||||| ||||| || ||||| ||||||||||| 
Sbjct: 990 agtgccttgattttgtcttgggctgttccctttccccccgatacaatagctccagcatga 931

                                                                     
Query: 369 cccatgcgacggcccgggggtgcagtaagtccagctatgaatgcaacgacaggctttt 426
           ||||| || || || ||||| ||||| | |||||| || || ||||| ||||||||||
Sbjct: 930 cccattcgccgtccagggggagcagtcaatccagcaataaaagcaactacaggctttt 873
to top
>gb|AY114607.1| Arabidopsis thaliana succinyl-CoA synthetase alpha subunit
           (At5g23250) mRNA, complete cds
          Length = 1119

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 147/182 (80%)
 Strand = Plus / Minus

                                                                       
Query: 249 tcaaacatggtcgaaccaatcttagctggtgactcgacaacagttaccccagcctccctg 308
           |||||||| | || ||||||||||||||||||||| || ||  | || || || || || 
Sbjct: 995 tcaaacatcgccgcaccaatcttagctggtgactcaaccaccttaactcctgcgtctctt 936

                                                                       
Query: 309 agtgccttgatcttgtcttgggcagtacccttgccccctgacacaattgctccagcatgg 368
           ||   ||| ||||||||||| || || ||||| || || || ||||| ||||| ||||| 
Sbjct: 935 aggctctttatcttgtcttgagccgtgcccttaccaccggaaacaatggctcccgcatga 876

                                                                       
Query: 369 cccatgcgacggcccgggggtgcagtaagtccagctatgaatgcaacgacaggcttttct 428
           ||||| ||||| || || |||||||||||||| |||||||| ||||| |||||||| |||
Sbjct: 875 cccatacgacgccctggtggtgcagtaagtccggctatgaaagcaactacaggcttgtct 816

             
Query: 429 gt 430
           ||
Sbjct: 815 gt 814
to top
>gb|AY092994.1| Arabidopsis thaliana succinyl-CoA synthetase, alpha subunit
            (At5g23250) mRNA, complete cds
          Length = 1234

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 147/182 (80%)
 Strand = Plus / Minus

                                                                        
Query: 249  tcaaacatggtcgaaccaatcttagctggtgactcgacaacagttaccccagcctccctg 308
            |||||||| | || ||||||||||||||||||||| || ||  | || || || || || 
Sbjct: 1006 tcaaacatcgccgcaccaatcttagctggtgactcaaccaccttaactcctgcgtctctt 947

                                                                        
Query: 309  agtgccttgatcttgtcttgggcagtacccttgccccctgacacaattgctccagcatgg 368
            ||   ||| ||||||||||| || || ||||| || || || ||||| ||||| ||||| 
Sbjct: 946  aggctctttatcttgtcttgagccgtgcccttaccaccggaaacaatggctcccgcatga 887

                                                                        
Query: 369  cccatgcgacggcccgggggtgcagtaagtccagctatgaatgcaacgacaggcttttct 428
            ||||| ||||| || || |||||||||||||| |||||||| ||||| |||||||| |||
Sbjct: 886  cccatacgacgccctggtggtgcagtaagtccggctatgaaagcaactacaggcttgtct 827

              
Query: 429  gt 430
            ||
Sbjct: 826  gt 825
to top
>gb|AY087899.1| Arabidopsis thaliana clone 39462 mRNA, complete sequence
          Length = 1345

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 tcttgtcttgggcagtacccttgccccctgacacaattgctccagcatggcccatgcgac 378
           |||||||||| || || ||||| || || || ||||| ||||| ||||| ||||| ||||
Sbjct: 996 tcttgtcttgagccgtgcccttaccaccggaaacaatggctcccgcatgacccatacgac 937

                                                               
Query: 379 ggcccgggggtgcagtaagtccagctatgaatgcaacgacaggcttttctgt 430
           | || || |||||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 936 gccctggtggtgcagtaagtccggctatgaaagcaactacaggcttgtctgt 885
to top
>ref|NM_120913.3| Arabidopsis thaliana catalytic/ succinate-CoA ligase (GDP-forming)
            AT5G08300 mRNA, complete cds
          Length = 1398

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                        
Query: 351  acaattgctccagcatggcccatgcgacggcccgggggtgcagtaagtccagctatgaat 410
            ||||| ||||| ||||| ||||| ||||| ||||| ||||||||||||||||| || || 
Sbjct: 1017 acaatggctccggcatgacccattcgacgacccggtggtgcagtaagtccagcaataaaa 958

                          
Query: 411  gcaacgacaggctt 424
            ||||| ||||||||
Sbjct: 957  gcaacaacaggctt 944
to top
>emb|AJ001807.1|ATSCLAS Arabidopsis thaliana mRNA for Succinyl-CoA-ligase alpha subunit
          Length = 1153

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 acaattgctccagcatggcccatgcgacggcccgggggtgcagtaagtccagctatgaat 410
           ||||| ||||| ||||| ||||| ||||| ||||| ||||||||||||||||| || || 
Sbjct: 966 acaatggctccggcatgacccattcgacgacccggtggtgcagtaagtccagcaataaaa 907

                         
Query: 411 gcaacgacaggctt 424
           ||||| ||||||||
Sbjct: 906 gcaacaacaggctt 893
to top
>gb|AY114613.1| Arabidopsis thaliana succinyl-CoA-ligase alpha subunit (At5g08300)
           mRNA, complete cds
          Length = 1167

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 acaattgctccagcatggcccatgcgacggcccgggggtgcagtaagtccagctatgaat 410
           ||||| ||||| ||||| ||||| ||||| ||||| ||||||||||||||||| || || 
Sbjct: 908 acaatggctccggcatgacccattcgacgacccggtggtgcagtaagtccagcaataaaa 849

                         
Query: 411 gcaacgacaggctt 424
           ||||| ||||||||
Sbjct: 848 gcaacaacaggctt 835
to top
>gb|AY072333.1| Arabidopsis thaliana succinyl-CoA-ligase alpha subunit (At5g08300)
           mRNA, complete cds
          Length = 1285

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 acaattgctccagcatggcccatgcgacggcccgggggtgcagtaagtccagctatgaat 410
           ||||| ||||| ||||| ||||| ||||| ||||| ||||||||||||||||| || || 
Sbjct: 984 acaatggctccggcatgacccattcgacgacccggtggtgcagtaagtccagcaataaaa 925

                         
Query: 411 gcaacgacaggctt 424
           ||||| ||||||||
Sbjct: 924 gcaacaacaggctt 911
to top
>emb|BX830929.1|CNS09ZGH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS3ZF06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1326

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 acaattgctccagcatggcccatgcgacggcccgggggtgcagtaagtccagctatgaat 410
           ||||| ||||| ||||| ||||| ||||| ||||| ||||||||||||||||| || || 
Sbjct: 970 acaatggctccggcatgacccattcgacgacccggtggtgcagtaagtccagcaataaaa 911

                         
Query: 411 gcaacgacaggctt 424
           ||||| ||||||||
Sbjct: 910 gcaacaacaggctt 897
to top
>emb|BX831587.1|CNS09YP8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH17ZA06 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1404

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                        
Query: 351  acaattgctccagcatggcccatgcgacggcccgggggtgcagtaagtccagctatgaat 410
            ||||| ||||| ||||| ||||| ||||| ||||| ||||||||||||||||| || || 
Sbjct: 1017 acaatggctccggcatgacccattcgacgacccggtggtgcagtaagtccagcaataaaa 958

                          
Query: 411  gcaacgacaggctt 424
            ||||| ||||||||
Sbjct: 957  gcaacaacaggctt 944
to top
>gb|AY084298.1| Arabidopsis thaliana clone 10292 mRNA, complete sequence
          Length = 1299

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 acaattgctccagcatggcccatgcgacggcccgggggtgcagtaagtccagctatgaat 410
           ||||| ||||| ||||| ||||| ||||| ||||| ||||||||||||||||| || || 
Sbjct: 987 acaatggctccggcatgacccattcgacgacccggtggtgcagtaagtccagcaataaaa 928

                         
Query: 411 gcaacgacaggctt 424
           ||||| ||||||||
Sbjct: 927 gcaacaacaggctt 914
to top
>gb|AY167586.1| Lycopersicon esculentum succinyl-CoA ligase alpha 1 subunit (SCOA)
           mRNA, complete cds; nuclear gene for mitochondrial
           product
          Length = 1164

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 97/118 (82%)
 Strand = Plus / Minus

                                                                       
Query: 309 agtgccttgatcttgtcttgggcagtacccttgccccctgacacaattgctccagcatgg 368
           ||||||||||| ||||||||||| || || || ||||| || ||||| ||||||||||| 
Sbjct: 975 agtgccttgattttgtcttgggctgttccttttccccccgatacaatagctccagcatga 916

                                                                     
Query: 369 cccatgcgacggcccgggggtgcagtaagtccagctatgaatgcaacgacaggctttt 426
           ||||| || || || || || ||||| | |||||| || || ||||| ||||||||||
Sbjct: 915 cccattcgccgtccaggtggagcagtcaatccagcaataaaagcaactacaggctttt 858
to top
>emb|X69138.1|ATSCOALA A.thaliana mRNA for succinate--CoA ligase (GCP-forming)
          Length = 1393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 93/113 (82%)
 Strand = Plus / Minus

                                                                       
Query: 318 atcttgtcttgggcagtacccttgccccctgacacaattgctccagcatggcccatgcga 377
           ||||||||||| || || ||||| || || || |||||   ||| ||||| ||||| |||
Sbjct: 939 atcttgtcttgagccgtgcccttaccaccggaaacaatgcgtcccgcatgacccatacga 880

                                                                
Query: 378 cggcccgggggtgcagtaagtccagctatgaatgcaacgacaggcttttctgt 430
           || || || |||||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 879 cgccctggtggtgcagtaagtccggctatgaaagcaactacaggcttgtctgt 827
to top
>dbj|AB007648.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MKD15
          Length = 76329

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                         
Query: 358   ctccagcatggcccatgcgacggcccgggggtgcagtaagtccagctatgaatgcaacga 417
             |||| ||||| ||||| ||||| || || |||||||||||||| |||||||| ||||| |
Sbjct: 43386 ctcccgcatgacccatacgacgccctggtggtgcagtaagtccggctatgaaagcaacta 43327

                          
Query: 418   caggcttttctgt 430
             ||||||| |||||
Sbjct: 43326 caggcttgtctgt 43314



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 249   tcaaacatggtcgaaccaatcttagctggtgactc 283
             |||||||| | || |||||||||||||||||||||
Sbjct: 43589 tcaaacatcgccgcaccaatcttagctggtgactc 43555
to top
>emb|AL392174.1|ATF8L15 Arabidopsis thaliana DNA chromosome 5, BAC clone F8L15 (ESSA project)
          Length = 125411

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                         
Query: 358   ctccagcatggcccatgcgacggcccgggggtgcagtaagtccagctatgaatgcaacga 417
             |||| ||||| ||||| ||||| ||||| ||||||||||||||||| || || ||||| |
Sbjct: 33257 ctccggcatgacccattcgacgacccggtggtgcagtaagtccagcaataaaagcaacaa 33198

                    
Query: 418   caggctt 424
             |||||||
Sbjct: 33197 caggctt 33191
to top
>gb|BT012809.1| Lycopersicon esculentum clone 113829R, mRNA sequence
          Length = 1311

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 107/133 (80%)
 Strand = Plus / Minus

                                                                       
Query: 294 accccagcctccctgagtgccttgatcttgtcttgggcagtacccttgccccctgacaca 353
           |||||||| ||| |||| || ||||||||||| || || || ||||| || || || |||
Sbjct: 990 accccagcttccttgagagctttgatcttgtcctgtgctgtcccctttccaccagataca 931

                                                                       
Query: 354 attgctccagcatggcccatgcgacggcccgggggtgcagtaagtccagctatgaatgca 413
           || || |||||||| ||||| || || || || || ||||| |||||||| || ||||||
Sbjct: 930 atggccccagcatgacccattcgtcgtccaggaggagcagttagtccagcaataaatgca 871

                        
Query: 414 acgacaggctttt 426
           || || |||||||
Sbjct: 870 acaacgggctttt 858
to top
>gb|AY650029.1| Lycopersicon esculentum cultivar TA496 succinyl-CoA ligase alpha 2
           subunit mRNA, complete cds
          Length = 1322

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 107/133 (80%)
 Strand = Plus / Minus

                                                                       
Query: 294 accccagcctccctgagtgccttgatcttgtcttgggcagtacccttgccccctgacaca 353
           |||||||| ||| |||| || ||||||||||| || || || ||||| || || || |||
Sbjct: 998 accccagcttccttgagagctttgatcttgtcctgtgctgtcccctttccaccagataca 939

                                                                       
Query: 354 attgctccagcatggcccatgcgacggcccgggggtgcagtaagtccagctatgaatgca 413
           || || |||||||| ||||| || || || || || ||||| |||||||| || ||||||
Sbjct: 938 atggccccagcatgacccattcgtcgtccaggaggagcagttagtccagcaataaatgca 879

                        
Query: 414 acgacaggctttt 426
           || || |||||||
Sbjct: 878 acaacgggctttt 866
to top
>dbj|AK114572.1| Ciona intestinalis cDNA, clone:cieg007a19, full insert sequence
          Length = 1059

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 357 gctccagcatggcccatgcgacggcccgggggtgcagtaagtccagctatgaa 409
           ||||||||||| |||||||| | ||| || ||||||||||| ||||| |||||
Sbjct: 559 gctccagcatgccccatgcgcctgccaggtggtgcagtaagaccagcaatgaa 507
to top
>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome
          Length = 3345170

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                       
Query: 336     cccttgccccctgacacaattgctccagcatggcccatgcgacggcccgggggtgc 391
               |||||||| || ||||| || || || |||||||||||||| |||||||| |||||
Sbjct: 2342442 cccttgccgcccgacacgatcgcgccggcatggcccatgcggcggcccggcggtgc 2342497
to top
>gb|AE006470.1| Chlorobium tepidum TLS, complete genome
          Length = 2154946

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 60/72 (83%)
 Strand = Plus / Minus

                                                                          
Query: 311    tgccttgatcttgtcttgggcagtacccttgccccctgacacaattgctccagcatggcc 370
              |||||||||||| |||| ||| || || ||||| ||||| || || ||||| || || ||
Sbjct: 282912 tgccttgatcttctcttcggcggtgcctttgccgcctgaaacgatcgctcccgcgtgacc 282853

                          
Query: 371    catgcgacggcc 382
              ||||||||||||
Sbjct: 282852 catgcgacggcc 282841
to top
>gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complete sequence
          Length = 2580084

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 360    ccagcatggcccatgcgacggcccgg 385
              ||||||||||||||||| ||||||||
Sbjct: 806288 ccagcatggcccatgcggcggcccgg 806313
to top
>gb|AC122025.3| Mus musculus BAC clone RP24-388G8 from 12, complete sequence
          Length = 202612

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 73    gggagaggaaaaggaaaaaggg 94
             ||||||||||||||||||||||
Sbjct: 56146 gggagaggaaaaggaaaaaggg 56125
to top
>gb|AC109461.3| Homo sapiens chromosome 5 clone RP11-269G2, complete sequence
          Length = 89234

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 295   ccccagcctccctgagtgcctt 316
             ||||||||||||||||||||||
Sbjct: 48023 ccccagcctccctgagtgcctt 48002
to top
>gb|AC159274.2| Mus musculus BAC clone RP23-405C6 from chromosome 12, complete sequence
          Length = 200974

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 73     gggagaggaaaaggaaaaaggg 94
              ||||||||||||||||||||||
Sbjct: 129765 gggagaggaaaaggaaaaaggg 129744
to top
>ref|NM_104276.1| Arabidopsis thaliana carboxylic ester hydrolase/ hydrolase, acting
           on ester bonds / lipase AT1G53990 mRNA, complete cds
          Length = 1104

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 167 acaaaaagaagtttcccgatgtttt 191
           |||| ||||||||||||||||||||
Sbjct: 737 acaacaagaagtttcccgatgtttt 761
to top
>gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Philadelphia 1, complete
              genome
          Length = 3397754

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 353    aattgctccagcatggcccat 373
              |||||||||||||||||||||
Sbjct: 578569 aattgctccagcatggcccat 578549
to top
>gb|AC102342.10| Mus musculus chromosome 18, clone RP23-250K3, complete sequence
          Length = 168009

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 73    gggagaggaaaaggaaaaagggact 97
             |||||||||||||||||| ||||||
Sbjct: 43484 gggagaggaaaaggaaaaggggact 43460
to top
>gb|AC121827.3| Mus musculus BAC clone RP23-476B3 from chromosome 7, complete sequence
          Length = 183470

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 189   tttcttttctactggaccatttctt 213
             |||||||| ||||||||||||||||
Sbjct: 78613 tttcttttgtactggaccatttctt 78589
to top
>gb|AC130719.3| Mus musculus BAC clone RP24-107M5 from chromosome 7, complete sequence
          Length = 143584

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 189   tttcttttctactggaccatttctt 213
             |||||||| ||||||||||||||||
Sbjct: 96670 tttcttttgtactggaccatttctt 96694
to top
>gb|AC142453.3| Mus musculus BAC clone RP23-398A2 from chromosome 7, complete sequence
          Length = 188249

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 189    tttcttttctactggaccatttctt 213
              |||||||| ||||||||||||||||
Sbjct: 108435 tttcttttgtactggaccatttctt 108459
to top
>gb|AC136023.5| Mus musculus BAC clone RP24-501J4 from chromosome 7, complete sequence
          Length = 138729

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 189   tttcttttctactggaccatttctt 213
             |||||||| ||||||||||||||||
Sbjct: 61192 tttcttttgtactggaccatttctt 61216
to top
>gb|AC102769.11| Mus musculus chromosome 17, clone RP23-89A3, complete sequence
          Length = 162417

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 63    acttaagacagggagaggaaa 83
             |||||||||||||||||||||
Sbjct: 41720 acttaagacagggagaggaaa 41700
to top
>gb|AC127324.4| Mus musculus BAC clone RP23-244I2 from chromosome 7, complete sequence
          Length = 176387

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 189   tttcttttctactggaccatttctt 213
             |||||||| ||||||||||||||||
Sbjct: 43992 tttcttttgtactggaccatttctt 43968
to top
>gb|AC122796.3| Mus musculus BAC clone RP24-347J6 from chromosome 7, complete sequence
          Length = 166768

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 189    tttcttttctactggaccatttctt 213
              |||||||| ||||||||||||||||
Sbjct: 104397 tttcttttgtactggaccatttctt 104373
to top
>gb|AC126273.3| Mus musculus BAC clone RP23-99P15 from 7, complete sequence
          Length = 182698

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 189    tttcttttctactggaccatttctt 213
              |||||||| ||||||||||||||||
Sbjct: 159326 tttcttttgtactggaccatttctt 159302
to top
>gb|AC124545.4| Mus musculus BAC clone RP23-272D9 from 7, complete sequence
          Length = 169442

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 189   tttcttttctactggaccatttctt 213
             |||||||| ||||||||||||||||
Sbjct: 15518 tttcttttgtactggaccatttctt 15494
to top
>gb|AC157595.4| Mus musculus BAC clone RP23-238F18 from chromosome 7, complete sequence
          Length = 196922

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 189   tttcttttctactggaccatttctt 213
             |||||||| ||||||||||||||||
Sbjct: 94360 tttcttttgtactggaccatttctt 94384
to top
>gb|AC012588.14| Homo sapiens chromosome 18, clone RP11-17A19, complete sequence
          Length = 148738

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 73    gggagaggaaaaggaaaaagggact 97
             |||||||||||||||||| ||||||
Sbjct: 72143 gggagaggaaaaggaaaaggggact 72119
to top
>gb|AC156566.3| Mus musculus BAC clone RP23-337B16 from chromosome 7, complete sequence
          Length = 198071

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 189    tttcttttctactggaccatttctt 213
              |||||||| ||||||||||||||||
Sbjct: 110905 tttcttttgtactggaccatttctt 110881
to top
>emb|BX539312.7| Mouse DNA sequence from clone RP24-164C21 on chromosome 7, complete
             sequence
          Length = 123224

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 189   tttcttttctactggaccatttctt 213
             |||||||| ||||||||||||||||
Sbjct: 48706 tttcttttgtactggaccatttctt 48730
to top
>gb|AC155925.2| Mus musculus BAC clone RP24-248C21 from 9, complete sequence
          Length = 171521

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 68    agacagggagaggaaaaggaa 88
             |||||||||||||||||||||
Sbjct: 65125 agacagggagaggaaaaggaa 65145
to top
>gb|AY899808.1| Mus musculus potassium channel tetramerization domain containing 1
           (Kctd1) mRNA, complete cds
          Length = 1787

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 73  gggagaggaaaaggaaaaagggact 97
           |||||||||||||||||| ||||||
Sbjct: 76  gggagaggaaaaggaaaaggggact 100
to top
>gb|AC006577.2|F15I1 Sequence of BAC F15I1 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 89035

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 167   acaaaaagaagtttcccgatgtttt 191
             |||| ||||||||||||||||||||
Sbjct: 12630 acaacaagaagtttcccgatgtttt 12654
to top
>gb|AC172890.2| Mus musculus BAC clone RP24-337A4 from chromosome 7, complete sequence
          Length = 182879

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 189    tttcttttctactggaccatttctt 213
              |||||||| ||||||||||||||||
Sbjct: 143283 tttcttttgtactggaccatttctt 143259
to top
>gb|AC127238.5| Mus musculus BAC clone RP24-378P20 from 7, complete sequence
          Length = 224224

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 189    tttcttttctactggaccatttctt 213
              |||||||| ||||||||||||||||
Sbjct: 202743 tttcttttgtactggaccatttctt 202719
to top
>gb|AC150684.2| Mus musculus BAC clone RP23-268G6 from 7, complete sequence
          Length = 193525

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 189    tttcttttctactggaccatttctt 213
              |||||||| ||||||||||||||||
Sbjct: 184584 tttcttttgtactggaccatttctt 184560



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 189   tttcttttctactggaccatttctt 213
             |||||||| ||||||||||||||||
Sbjct: 23514 tttcttttgtactggaccatttctt 23490
to top
>gb|AC173484.2| Mus musculus BAC clone RP23-250N1 from chromosome 7, complete sequence
          Length = 207692

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 189   tttcttttctactggaccatttctt 213
             |||||||| ||||||||||||||||
Sbjct: 83360 tttcttttgtactggaccatttctt 83336
to top
>emb|CT010437.15| Mouse DNA sequence from clone RP23-333O22 on chromosome 17, complete
             sequence
          Length = 172696

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 63    acttaagacagggagaggaaa 83
             |||||||||||||||||||||
Sbjct: 42327 acttaagacagggagaggaaa 42347
to top
>gb|AC173478.1| Mus musculus BAC clone RP24-81N9 from chromosome 7, complete sequence
          Length = 208133

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 189    tttcttttctactggaccatttctt 213
              |||||||| ||||||||||||||||
Sbjct: 132579 tttcttttgtactggaccatttctt 132555
to top
>gb|AC172366.1| Mus musculus BAC clone RP24-499J10 from chromosome 7, complete sequence
          Length = 171297

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 189    tttcttttctactggaccatttctt 213
              |||||||| ||||||||||||||||
Sbjct: 146901 tttcttttgtactggaccatttctt 146925
to top
>gb|AC110816.7| Mus musculus BAC clone RP23-20P15 from chromosome 12, complete sequence
          Length = 216095

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 76    agaggaaaaggaaaaaggga 95
             ||||||||||||||||||||
Sbjct: 46566 agaggaaaaggaaaaaggga 46585
to top
>gb|AE007300.1| Sinorhizobium meliloti 1021 plasmid pSymA section 106 of 121 of the
             complete plasmid sequence
          Length = 10911

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 411   gcaacgacaggcttttctgttttg 434
             ||||||||||||| ||||||||||
Sbjct: 10124 gcaacgacaggctcttctgttttg 10147
to top
>gb|AC161509.8| Mus musculus chromosome 7, clone RP23-53O17, complete sequence
          Length = 196638

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 194   tttctactggaccatttcttctct 217
             |||||||||| |||||||||||||
Sbjct: 26574 tttctactggcccatttcttctct 26551
to top
>gb|AC132270.3| Mus musculus BAC clone RP24-338C23 from chromosome 5, complete sequence
          Length = 145471

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 74    ggagaggaaaaggaaaaagg 93
             ||||||||||||||||||||
Sbjct: 57035 ggagaggaaaaggaaaaagg 57016
to top
>gb|AC147241.2| Mus musculus BAC clone RP23-417C21 from chromosome 12, complete
             sequence
          Length = 199956

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cagggagaggaaaaggaaaa 90
             ||||||||||||||||||||
Sbjct: 45412 cagggagaggaaaaggaaaa 45431
to top
>gb|AC121828.3| Mus musculus BAC clone RP23-478K4 from chromosome 1, complete sequence
          Length = 179626

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 422    cttttctgttttgctctccc 441
              ||||||||||||||||||||
Sbjct: 143906 cttttctgttttgctctccc 143887
to top
>gb|AC112146.3| Mus musculus BAC clone RP23-101G11 from 12, complete sequence
          Length = 188819

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cagggagaggaaaaggaaaa 90
              ||||||||||||||||||||
Sbjct: 155312 cagggagaggaaaaggaaaa 155331
to top
>ref|XM_546508.2| PREDICTED: Canis familiaris beta-site APP-cleaving enzyme 1 (BACE1),
            mRNA
          Length = 2445

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 179  ttcccgatgttttcttttct 198
            ||||||||||||||||||||
Sbjct: 2020 ttcccgatgttttcttttct 2039
to top
>ref|XM_533492.2| PREDICTED: Canis familiaris similar to thrombospondin, type I,
           domain containing 2 (LOC476287), mRNA
          Length = 888

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  agggagaggaaaaggaaaaa 91
           ||||||||||||||||||||
Sbjct: 706 agggagaggaaaaggaaaaa 725
to top
>gb|AC111092.10| Mus musculus chromosome 12, clone RP23-168O9, complete sequence
          Length = 211926

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 205    ccatttcttctctctactct 224
              ||||||||||||||||||||
Sbjct: 180392 ccatttcttctctctactct 180373
to top
>gb|AC109152.13| Mus musculus chromosome 18, clone RP23-166J4, complete sequence
          Length = 206894

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 74     ggagaggaaaaggaaaaagg 93
              ||||||||||||||||||||
Sbjct: 115842 ggagaggaaaaggaaaaagg 115861
to top
>emb|CR788268.5| Human DNA sequence from clone RP11-24B13 on chromosome 9 Contains the 3'
              end of the gene for a novel protein similar to contactin
              associated protein-like 3 (CNTNAP3) and an RNA binding
              motif protein 17 (RBM17) pseudogene, complete sequence
          Length = 164026

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 80     gaaaaggaaaaagggactga 99
              ||||||||||||||||||||
Sbjct: 112709 gaaaaggaaaaagggactga 112728
to top
>emb|BX005040.12| Human DNA sequence from clone RP11-101E5 on chromosome 9 Contains two
              novel genes, a novel protein similar to chromosome 9 open
              reading frame 36 (C9orf36), a 6-pyruvoyltetrahydropterin
              synthase (PTS) pseudogene, the 5' end of a pseudogene
              similar to part of contactin associated protein-like
              family, a novel pseudogene and a CpG island, complete
              sequence
          Length = 171762

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 80     gaaaaggaaaaagggactga 99
              ||||||||||||||||||||
Sbjct: 169148 gaaaaggaaaaagggactga 169167
to top
>emb|BX005195.5| Human DNA sequence from clone RP11-203I2 on chromosome 9 Contains the
             3' end of a pseudogene similar to part of contactin
             associated protein-like family and a pseudogene similar to
             part of a vomeronasal receptor, complete sequence
          Length = 174843

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 80    gaaaaggaaaaagggactga 99
             ||||||||||||||||||||
Sbjct: 52753 gaaaaggaaaaagggactga 52772
to top
>emb|AL772262.4| Human DNA sequence from clone RP11-444C24 on chromosome X, complete
             sequence
          Length = 147079

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 72    agggagaggaaaaggaaaaa 91
             ||||||||||||||||||||
Sbjct: 57961 agggagaggaaaaggaaaaa 57942
to top
>emb|AL592525.10| Human DNA sequence from clone RP11-111G23 on chromosome 9 Contains a
             pseudogene similar to part of contactin associated
             protein-like 3 (CNTNAP3) and a pseudogene similar to part
             of vomeronasal 2 family, complete sequence
          Length = 142805

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 80    gaaaaggaaaaagggactga 99
             ||||||||||||||||||||
Sbjct: 29278 gaaaaggaaaaagggactga 29297
to top
>emb|AL353729.17| Human DNA sequence from clone RP11-290L7 on chromosome 9 Contains the
             3' end of the CNTNAP3 gene for contactin associated
             protein-like 3, a TGF beta-inducible nuclear protein 1
             (TINP1) pseudogene and a RNA binding motif protein 17
             (RBM17) pseudogene, complete sequence
          Length = 195668

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 80    gaaaaggaaaaagggactga 99
             ||||||||||||||||||||
Sbjct: 88672 gaaaaggaaaaagggactga 88691
to top
>emb|AL160037.17| Human DNA sequence from clone RP11-289G11 on chromosome 6 Contains the 5'
              end of a novel gene and a novel gene, complete sequence
          Length = 135714

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 72     agggagaggaaaaggaaaaa 91
              ||||||||||||||||||||
Sbjct: 103367 agggagaggaaaaggaaaaa 103348
to top
>emb|AL161454.10| Human DNA sequence from clone RP11-72B4 on chromosome 9 Contains the
             gene for a novel protein similar to putative repair and
             recombination helicase RAD26L (LOC56959), a parkinson
             disease 7 (PARK7) pseudogene, the 5' end of a novel gene
             and a CpG island, complete sequence
          Length = 144536

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 69    gacagggagaggaaaaggaa 88
             ||||||||||||||||||||
Sbjct: 17072 gacagggagaggaaaaggaa 17091
to top
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 98      gagtagctcagctcagcggccagc 121
               ||||||||||| ||||||||||||
Sbjct: 5650055 gagtagctcaggtcagcggccagc 5650032
to top
>emb|CR385085.9| Zebrafish DNA sequence from clone CH211-195A16, complete sequence
          Length = 211060

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 23    ttgaacatttgaaatgagca 42
             ||||||||||||||||||||
Sbjct: 89711 ttgaacatttgaaatgagca 89730
to top
>gb|AC010030.10| Drosophila melanogaster 3L BAC RP98-2C14 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 200859

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 124   tgggggcactaccgacgtattgct 147
             ||||||||||||| ||||||||||
Sbjct: 81148 tgggggcactaccaacgtattgct 81171
to top
>gb|AC108877.2| Drosophila melanogaster 3L BAC RP98-17L24 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 163709

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 148   cgctattaaccaacgagcaa 167
             ||||||||||||||||||||
Sbjct: 12851 cgctattaaccaacgagcaa 12870
to top
>gb|AC023751.3| Drosophila melanogaster 3L BAC RP98-31C17 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 187437

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 148   cgctattaaccaacgagcaa 167
             ||||||||||||||||||||
Sbjct: 96670 cgctattaaccaacgagcaa 96689
to top
>gb|AC092713.2| Homo sapiens chromosome 17, clone CTC-780D20, complete sequence
          Length = 142087

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   catttcttctctctactcta 225
             ||||||||||||||||||||
Sbjct: 71022 catttcttctctctactcta 71041
to top
>ref|NM_168102.1| Drosophila melanogaster Guanine nucleotide exchange factor GEF64C
            CG32239-RA (Gef64C), mRNA
          Length = 7283

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 148  cgctattaaccaacgagcaa 167
            ||||||||||||||||||||
Sbjct: 7073 cgctattaaccaacgagcaa 7092
to top
>gb|AY064174.1| Drosophila melanogaster rho GTPase guanine nucleotide exchange factor
            GEF64C (Gef64c) mRNA, complete cds
          Length = 7304

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 148  cgctattaaccaacgagcaa 167
            ||||||||||||||||||||
Sbjct: 7081 cgctattaaccaacgagcaa 7100
to top
>gb|CP000264.1| Jannaschia sp. CCS1, complete genome
          Length = 4317977

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 366    tggcccatgcgacggcccgg 385
              ||||||||||||||||||||
Sbjct: 783322 tggcccatgcgacggcccgg 783303
to top
>gb|AY060795.1| Drosophila melanogaster GH26207 full length cDNA
          Length = 2479

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 148  cgctattaaccaacgagcaa 167
            ||||||||||||||||||||
Sbjct: 2252 cgctattaaccaacgagcaa 2271
to top
>emb|BX470204.13| Zebrafish DNA sequence from clone CH211-63C23 in linkage group 10,
             complete sequence
          Length = 185190

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 67    aagacagggagaggaaaaggaaaa 90
             |||||||||||| |||||||||||
Sbjct: 31596 aagacagggagaagaaaaggaaaa 31619
to top
>gb|AC026955.10|AC026955 Homo sapiens chromosome 17, clone RP11-585D22, complete sequence
          Length = 176258

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 206    catttcttctctctactcta 225
              ||||||||||||||||||||
Sbjct: 161687 catttcttctctctactcta 161706
to top
>gb|AC022509.21|AC022509 Homo sapiens 12 BAC RP11-283G6 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 204228

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 192    cttttctactggaccatttc 211
              ||||||||||||||||||||
Sbjct: 188421 cttttctactggaccatttc 188402
to top
>gb|AC019183.3|AC019183 Homo sapiens BAC clone RP11-291G24 from 18, complete sequence
          Length = 183082

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 21     tattgaacatttgaaatgag 40
              ||||||||||||||||||||
Sbjct: 166029 tattgaacatttgaaatgag 166010
to top
>emb|BX005463.5| Zebrafish DNA sequence from clone CH211-177H19 in linkage group 6,
              complete sequence
          Length = 163804

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 23     ttgaacatttgaaatgagca 42
              ||||||||||||||||||||
Sbjct: 115705 ttgaacatttgaaatgagca 115686
to top
>emb|BX293568.7| Zebrafish DNA sequence from clone CH211-215F13 in linkage group 20,
              complete sequence
          Length = 221849

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 12     aatatgtcttattgaacatt 31
              ||||||||||||||||||||
Sbjct: 148534 aatatgtcttattgaacatt 148553
to top
>gb|AE003546.4| Drosophila melanogaster chromosome 3L, section 39 of 83 of the
            complete sequence
          Length = 281589

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 124  tgggggcactaccgacgtattgct 147
            ||||||||||||| ||||||||||
Sbjct: 9762 tgggggcactaccaacgtattgct 9785
to top
>gb|AE003482.4| Drosophila melanogaster chromosome 3L, section 16 of 83 of the complete
              sequence
          Length = 302417

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 148    cgctattaaccaacgagcaa 167
              ||||||||||||||||||||
Sbjct: 169680 cgctattaaccaacgagcaa 169699
to top
>gb|U51244.1|U51244 Homo sapiens BAC clone 1D9 from 2p21, complete sequence
          Length = 67571

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 67    aagacagggagaggaaaagg 86
             ||||||||||||||||||||
Sbjct: 53563 aagacagggagaggaaaagg 53544
to top
>gb|AC116556.14| Mus musculus strain C57BL/6J chromosome 8 clone rp23-184i13, complete
              sequence
          Length = 239958

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 422    cttttctgttttgctctccc 441
              ||||||||||||||||||||
Sbjct: 220381 cttttctgttttgctctccc 220400
to top
>gb|AC102117.13| Mus musculus chromosome 7, clone RP23-154P9, complete sequence
          Length = 196717

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 194    tttctactggaccatttcttctct 217
              |||||||||| |||||||||||||
Sbjct: 127470 tttctactggcccatttcttctct 127447
to top
>emb|AJ509645.1|AME509645 Apis mellifera microsatellite marker Am0414=Ac047
          Length = 330

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 74 ggagaggaaaaggaaaaagg 93
          ||||||||||||||||||||
Sbjct: 12 ggagaggaaaaggaaaaagg 31
to top
>emb|AL591704.7| Human DNA sequence from clone RP1-128L15 on chromosome 1q21.1-21.3
             Contains the 5' end of the gene for peptidoglycan
             recognition protein-I-alpha (PGLYRPIalpha), the PGLYRP4
             gene for peptidoglycan recognition protein 4, the S100A9
             gene for S100 calcium binding protein A9 (calgranulin B),
             the S100A12 gene for S100 calcium binding protein A12
             (calgranulin C), a LAPTM4B (lysosomal associated protein
             transmembrane 4 beta) pseudogene, the S100A8 gene for S100
             calcium binding protein A8 (calgranulin A), a S100
             calcium-binding protein pseudogene, the S100A15 gene for
             S100 calcium binding protein A15, a S100 calcium-binding
             protein pseudogene, the gene for a novel S100
             calcium-binding protein and the S100A7 gene for S100
             calcium binding protein A7 (psoriasin 1), complete
             sequence
          Length = 164144

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 73    gggagaggaaaaggaaaaag 92
             ||||||||||||||||||||
Sbjct: 90686 gggagaggaaaaggaaaaag 90705
to top
>emb|AL672074.19| Mouse DNA sequence from clone RP23-404I18 on chromosome X, complete
              sequence
          Length = 171593

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 74     ggagaggaaaaggaaaaagg 93
              ||||||||||||||||||||
Sbjct: 119636 ggagaggaaaaggaaaaagg 119655
to top
>gb|AC145948.5| Gallus gallus BAC clone CH261-24O17 from chromosome unknown, complete
              sequence
          Length = 242530

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 23     ttgaacatttgaaatgagca 42
              ||||||||||||||||||||
Sbjct: 190653 ttgaacatttgaaatgagca 190634
to top
>gb|AC132618.3| Mus musculus BAC clone RP23-238K12 from 6, complete sequence
          Length = 155828

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 67    aagacagggagaggaaaagg 86
             ||||||||||||||||||||
Sbjct: 43403 aagacagggagaggaaaagg 43422
to top
>emb|AL731829.10| Mouse DNA sequence from clone RP23-383P24 on chromosome 4 Contains part
              of the Astn2 gene for astrotactin 2 and a CpG island,
              complete sequence
          Length = 199452

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 208    tttcttctctctactctacc 227
              ||||||||||||||||||||
Sbjct: 191726 tttcttctctctactctacc 191707
to top
>tpd|BR000043.1| TPA: TPA_exp: Homo sapiens S100 calcium binding protein A7-like gene
             duplications, clone RP1-128L15, chromosome 1q21.1-21.3
          Length = 164144

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 73    gggagaggaaaaggaaaaag 92
             ||||||||||||||||||||
Sbjct: 90686 gggagaggaaaaggaaaaag 90705
to top
>emb|AL611970.11| Mouse DNA sequence from clone RP23-413K17 on chromosome 4, complete
             sequence
          Length = 61588

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 296   cccagcctccctgagtgcct 315
             ||||||||||||||||||||
Sbjct: 53835 cccagcctccctgagtgcct 53854
to top
>gb|AC034198.7| Homo sapiens chromosome 3 clone RP11-767C1 map 3p, complete sequence
          Length = 169005

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 77     gaggaaaaggaaaaagggac 96
              ||||||||||||||||||||
Sbjct: 103187 gaggaaaaggaaaaagggac 103206
to top
>gb|AC018836.5| Homo sapiens chromosome 3 clone RP11-588P9 map 3p, complete sequence
          Length = 184716

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 77     gaggaaaaggaaaaagggac 96
              ||||||||||||||||||||
Sbjct: 181827 gaggaaaaggaaaaagggac 181846


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,552,897
Number of Sequences: 3902068
Number of extensions: 5552897
Number of successful extensions: 120224
Number of sequences better than 10.0: 107
Number of HSP's better than 10.0 without gapping: 107
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 119904
Number of HSP's gapped (non-prelim): 320
length of query: 457
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 435
effective length of database: 17,147,199,772
effective search space: 7459031900820
effective search space used: 7459031900820
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top