ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart35e04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY123420.1| Triticum aestivum putative 40S ribosomal protein ... 426 e-116
2gb|AF479033.1| Triticum aestivum 40S ribosomal protein mRNA, par... 317 2e-83
3gb|AY107461.1| Zea mays PCO108959 mRNA sequence 167 4e-38
4ref|XM_463024.1| Oryza sativa (japonica cultivar-group), OSJNBa0... 157 4e-35
5dbj|AK099146.1| Oryza sativa (japonica cultivar-group) cDNA clon... 157 4e-35
6dbj|AK061051.1| Oryza sativa (japonica cultivar-group) cDNA clon... 157 4e-35
7gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 121 2e-24
8dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 121 2e-24
9gb|AC146468.1| Oryza sativa (japonica cultivar-group) chromosome... 121 2e-24
10ref|NM_122944.2| Arabidopsis thaliana structural constituent of ... 115 1e-22
11gb|AY098949.1| Arabidopsis thaliana AT5g35530/MOK9_14 mRNA, comp... 115 1e-22
12gb|AY058057.1| Arabidopsis thaliana AT5g35530/MOK9_14 mRNA, comp... 115 1e-22
13gb|AY084320.1| Arabidopsis thaliana clone 10394 mRNA, complete s... 115 1e-22
14dbj|AB091077.1| Zinnia elegans ZeRPS3 mRNA for putative ribosoma... 107 4e-20
15gb|AY106013.1| Zea mays PCO066457 mRNA sequence 88 3e-14
16dbj|AB015477.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 84 5e-13
17gb|DQ241842.1| Solanum tuberosum clone 182H03 unknown mRNA 84 5e-13
18ref|XM_479106.1| Oryza sativa (japonica cultivar-group), mRNA 80 8e-12
19dbj|AK066905.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 8e-12
20emb|BX831845.1|CNS0A14G Arabidopsis thaliana Full-length cDNA Co... 78 3e-11
21gb|BT012908.1| Lycopersicon esculentum clone 114026F, mRNA sequence 76 1e-10
22gb|DQ294256.1| Solanum tuberosum clone 084G12 40S ribosomal prot... 76 1e-10
23ref|NM_128718.3| Arabidopsis thaliana structural constituent of ... 66 1e-07
24gb|AY091208.1| Arabidopsis thaliana putative 40S ribosomal prote... 66 1e-07
25gb|AY046041.1| Arabidopsis thaliana putative 40S ribosomal prote... 66 1e-07
26gb|AY081517.1| Arabidopsis thaliana 40S ribosomal protein; conta... 66 1e-07
27gb|AY054622.1| Arabidopsis thaliana 40S ribosomal protein (At2g3... 66 1e-07
28gb|AY052749.1| Arabidopsis thaliana At2g31610/T9H9.13 mRNA, comp... 66 1e-07
29gb|AF378887.1|AF378887 Arabidopsis thaliana At2g31610/T9H9.13 mR... 66 1e-07
30emb|BX819975.1|CNS0A8H0 Arabidopsis thaliana Full-length cDNA Co... 66 1e-07
31dbj|AP004944.1| Lotus japonicus genomic DNA, chromosome 1, clone... 62 2e-06
32gb|AC007071.7| Arabidopsis thaliana chromosome 2 clone T9H9 map ... 60 7e-06
33emb|BX820098.1|CNS0A8HS Arabidopsis thaliana Full-length cDNA Co... 60 7e-06
34ref|NM_115247.2| Arabidopsis thaliana nucleic acid binding / str... 56 1e-04
35gb|AY059090.1| Arabidopsis thaliana putative ribosomal protein S... 56 1e-04
36gb|AY035022.1| Arabidopsis thaliana putative ribosomal protein S... 56 1e-04
37emb|AL132960.2|ATF5K20 Arabidopsis thaliana DNA chromosome 3, BA... 56 1e-04
38gb|AF428405.1|AF428405 Arabidopsis thaliana AT3g53870/F5K20_170 ... 56 1e-04
39emb|BX824880.1|CNS0A5OP Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
40emb|BX823126.1|CNS0A5V8 Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
41gb|AY088808.1| Arabidopsis thaliana clone 9568 mRNA, complete se... 56 1e-04
42ref|XM_566546.1| Cryptococcus neoformans var. neoformans JEC21 r... 52 0.002
43ref|XM_745219.1| Aspergillus fumigatus Af293 40s ribosomal prote... 50 0.007
44ref|XM_754010.1| Ustilago maydis 521 hypothetical protein (UM029... 48 0.028
45gb|AC079038.3|AC079038 Oryza sativa chromosome 7 clone OSJNBb002... 48 0.028
46dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.028
47dbj|AP006458.4| Oryza sativa (japonica cultivar-group) genomic D... 48 0.028
48dbj|AP005895.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.028
49gb|AY394937.1| Danio rerio clone RK045A1H03 ribosomal protein S3... 46 0.11
50ref|NM_201153.1| Danio rerio ribosomal protein S3 (rps3), mRNA 46 0.11
51gb|AF538200.1| Monadenium ellenbeckii NADH dehydrogenase subunit... 46 0.11
52gb|AF538193.1| Euphorbia poissonii NADH dehydrogenase subunit F ... 46 0.11
53gb|AF538191.1| Euphorbia drupifera NADH dehydrogenase subunit F ... 46 0.11
54gb|AF538154.1| Euphorbia fulgens NADH dehydrogenase subunit F (n... 46 0.11
55gb|BC045902.1| Danio rerio ribosomal protein S3, mRNA (cDNA clon... 46 0.11
56gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chr... 44 0.44
57gb|BC061265.1| Xenopus tropicalis ribosomal protein S3, mRNA (cD... 44 0.44
58emb|V01441.1|XLRIB4 Fragment of Xenopus laevis mRNA for ribosoma... 44 0.44
59ref|NM_203788.1| Xenopus tropicalis ribosomal protein S3 (MGC756... 44 0.44
60dbj|D38596.1|RICRPS3A Oryza sativa mRNA, partial homologous to ... 44 0.44
61emb|Z34529.1|XLRIBS1R X.laevis rpS1b mRNA for ribosomal protein S1 44 0.44
62emb|CR848247.2| Xenopus tropicalis finished cDNA, clone TTpA010a01 44 0.44
63gb|CP000153.1| Thiomicrospira denitrificans ATCC 33889, complete... 42 1.8
64gb|AC166830.3| Mus musculus BAC clone RP23-246O1 from chromosome... 42 1.8
65ref|XM_527224.1| PREDICTED: Pan troglodytes similar to ribosomal... 42 1.8
66gb|BC078664.1| Homo sapiens cDNA clone IMAGE:3941503, containing... 42 1.8
67gb|BC034149.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clo... 42 1.8
68gb|BC003137.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clo... 42 1.8
69ref|XM_656599.1| Aspergillus nidulans FGSC A4 hypothetical prote... 42 1.8
70gb|AC161000.5| Mus musculus BAC clone RP23-51A9 from chromosome ... 42 1.8
71gb|BC100284.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clo... 42 1.8
72gb|AE017199.1| Nanoarchaeum equitans Kin4-M, complete genome 42 1.8
73gb|BC017103.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clo... 42 1.8
74gb|BC029981.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clo... 42 1.8
75ref|NM_001005.3| Homo sapiens ribosomal protein S3 (RPS3), mRNA 42 1.8
76emb|CR861393.1| Pongo pygmaeus mRNA; cDNA DKFZp459J022 (from clo... 42 1.8
77gb|AF402810.1| Ictalurus punctatus 40S ribosomal protein S3 mRNA... 42 1.8
78emb|CR623585.1| full-length cDNA clone CS0DA007YC19 of Neuroblas... 42 1.8
79emb|CR620902.1| full-length cDNA clone CS0DJ012YN02 of T cells (... 42 1.8
80emb|CR620201.1| full-length cDNA clone CS0DL012YJ20 of B cells (... 42 1.8
81emb|CR619698.1| full-length cDNA clone CS0DL005YA23 of B cells (... 42 1.8
82emb|CR617487.1| full-length cDNA clone CS0DK010YL21 of HeLa cell... 42 1.8
83emb|CR611679.1| full-length cDNA clone CS0DB002YE09 of Neuroblas... 42 1.8
84emb|CR610898.1| full-length cDNA clone CS0DD004YP10 of Neuroblas... 42 1.8
85emb|CR610850.1| full-length cDNA clone CS0DH003YE11 of T cells (... 42 1.8
86emb|CR611021.1| full-length cDNA clone CS0DL002YG06 of B cells (... 42 1.8
87emb|CR609618.1| full-length cDNA clone CS0DI083YP04 of Placenta ... 42 1.8
88emb|CR607881.1| full-length cDNA clone CS0DF032YC19 of Fetal bra... 42 1.8
89emb|CR608382.1| full-length cDNA clone CS0DM008YP04 of Fetal liv... 42 1.8
90emb|CR606914.1| full-length cDNA clone CS0DN003YN07 of Adult bra... 42 1.8
91emb|CR599459.1| full-length cDNA clone CS0DA012YB22 of Neuroblas... 42 1.8
92emb|CR599018.1| full-length cDNA clone CS0DK010YN19 of HeLa cell... 42 1.8
93emb|CR598363.1| full-length cDNA clone CS0CAP007YJ19 of Thymus o... 42 1.8
94emb|CR598084.1| full-length cDNA clone CS0DD009YH06 of Neuroblas... 42 1.8
95emb|CR597126.1| full-length cDNA clone CS0DK011YF16 of HeLa cell... 42 1.8
96emb|CR595698.1| full-length cDNA clone CS0DL005YD17 of B cells (... 42 1.8
97emb|CR593831.1| full-length cDNA clone CS0DI031YM23 of Placenta ... 42 1.8
98emb|CR591204.1| full-length cDNA clone CS0DC019YA14 of Neuroblas... 42 1.8
99gb|S42658.1| S3 ribosomal protein [human, colon, mRNA, 826 nt] 42 1.8
100gb|BC013196.1|BC013196 Homo sapiens, clone IMAGE:4347401, mRNA, ... 42 1.8
101gb|BC003577.1|BC003577 Homo sapiens, clone IMAGE:3544292, mRNA, ... 42 1.8
102emb|BX818844.1|CNS0A8YC Arabidopsis thaliana Full-length cDNA Co... 42 1.8
103dbj|AK223048.1| Homo sapiens mRNA for ribosomal protein S3 varia... 42 1.8
104ref|NM_001009239.1| Rattus norvegicus ribosomal protein S3 (Rps3... 42 1.8
105gb|AC131235.4| Homo sapiens 3 BAC RP11-778D9 (Roswell Park Cance... 42 1.8
106ref|XM_575143.1| PREDICTED: Rattus norvegicus similar to 40S rib... 42 1.8
107gb|AY892063.1| Synthetic construct Homo sapiens clone FLH027749.... 42 1.8
108gb|BC071917.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clo... 42 1.8
109emb|X51536.1|RRRPS3 Rat mRNA for ribosomal protein S3 42 1.8
110gb|DQ206605.1| Monosiga brevicollis isolate TOA26 ribosomal prot... 42 1.8
111gb|BC013231.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clo... 42 1.8
112gb|U14992.1|HSU14992 Human IMR-90 ribosomal protein S3 (rpS3) mR... 42 1.8
113gb|U14991.1|HSU14991 Human XP2NE ribosomal protein S3 (rpS3) mRN... 42 1.8
114gb|U14990.1|HSU14990 Human XP1PO ribosomal protein S3 (rpS3) mRN... 42 1.8
115gb|BC088450.1| Rattus norvegicus ribosomal protein S3, mRNA (cDN... 42 1.8
116emb|X55715.1|HSHUMS3 Human Hums3 mRNA for 40S ribosomal protein s3 42 1.8
117gb|AC078872.13| Homo sapiens 12q BAC RP11-542G14 (Roswell Park C... 42 1.8
118dbj|AB062288.1| Homo sapiens OK/SW-cl.26 mRNA for IMR-90 ribosom... 42 1.8
119ref|XM_593742.2| PREDICTED: Bos taurus similar to serologically ... 40 6.9
120gb|AC093458.6| Homo sapiens BAC clone RP11-445N20 from 7, comple... 40 6.9
121gb|AC004986.2| Homo sapiens PAC clone RP5-1166A24 from 7, comple... 40 6.9
122emb|BX957326.8| Zebrafish DNA sequence from clone DKEY-31B16 in ... 40 6.9
123ref|XM_784326.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 6.9
124emb|AL513332.9| Human DNA sequence from clone RP11-58B8 on chrom... 40 6.9
125ref|XM_502846.1| Yarrowia lipolytica CLIB122, YALI0D15114g predi... 40 6.9
126emb|AL356954.16| Human DNA sequence from clone RP11-520F24 on ch... 40 6.9
127gb|AC134516.1| Oryza sativa (japonica cultivar-group) chromosome... 40 6.9
128ref|XM_788097.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 6.9
129emb|BX842627.1| Neurospora crassa DNA linkage group I BAC clone ... 40 6.9
130gb|AC007286.18| Homo sapiens 12q15 BAC RPCI11-298M11 (Roswell Pa... 40 6.9
131gb|AC114764.5| Homo sapiens BAC clone RP11-374M14 from 4, comple... 40 6.9
132gb|AC116926.1| Genomic sequence for Oryza sativa (japonica culti... 40 6.9
133gb|AE016826.1| Buchnera aphidicola str. Bp (Baizongia pistaciae)... 40 6.9
134gb|AC023163.25| Homo sapiens 12 BAC RP11-239B4 (Roswell Park Can... 40 6.9
135gb|AE010300.1| Leptospira interrogans serovar lai str. 56601 chr... 40 6.9
136dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
137dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
138dbj|AP003257.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
139gb|AC006582.13|AC006582 Pan troglodytes 12cp12 BAC RPCI43-77C18 ... 40 6.9
140emb|AL133247.1|CNS01DUK BAC sequence from the SPG4 candidate reg... 40 6.9
141emb|CR555302.7| Zebrafish DNA sequence from clone CH211-212C19 i... 40 6.9
142gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. F... 40 6.9
143gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 6.9
144emb|AL928672.14| Zebrafish DNA sequence from clone CH211-136O4, ... 40 6.9
145emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 40 6.9
146gb|AY884245.1| Homo sapiens steroid-5-alpha-reductase, alpha pol... 40 6.9 
>gb|AY123420.1| Triticum aestivum putative 40S ribosomal protein S3 mRNA, complete
           cds
          Length = 1004

 Score =  426 bits (215), Expect = e-116
 Identities = 281/302 (93%), Gaps = 2/302 (0%)
 Strand = Plus / Minus

                                                                       
Query: 213 aggtaaccaaacgttgcatagcccac--ttgtcacaaggataggaaacaagctaggacca 270
           |||||||||| ||||||||||||| |  || ||||| |||||| |||| ||||| |||||
Sbjct: 873 aggtaaccaagcgttgcatagccctcgcttatcacagggatagaaaactagctacgacca 814

                                                                       
Query: 271 aaatgatgtgccgtttcatggtctgcttgcactactgggagtttagacctcaatcaaagc 330
           |||||||||| ||||||||||||||||||| ||||||||| |||||||||||| ||||||
Sbjct: 813 aaatgatgtgacgtttcatggtctgcttgctctactgggactttagacctcaaccaaagc 754

                                                                       
Query: 331 cggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcagggg 390
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 753 cggggggcgcagctcgttctcctccttcggggggtggatggtgacgaggtcaggcagcgg 694

                                                                       
Query: 391 ggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatacc 450
            |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 693 agtggtagggccaagcttgcccttggggtcccagtcaagcataatcttcaccttgatacc 634

                                                                       
Query: 451 aagaacgccctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacggg 510
           ||||||||||||||||||||||||||| ||||| || |||||||||||||| ||||||||
Sbjct: 633 aagaacgccctgtctgagaagaacgtgcctaactgcagcatcaatgtactcgttgacggg 574

             
Query: 511 ct 512
           ||
Sbjct: 573 ct 572



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 144 aaacttagtttaaacgaaattaaaatggcagcataacatagaa 186
           ||||||||||||||||||||||| || ||||||| ||| ||||
Sbjct: 941 aaacttagtttaaacgaaattaacatagcagcattacacagaa 899



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 177 taacatagaagcattacacataaacttttgt 207
           |||||||| ||||||||||| ||||||||||
Sbjct: 921 taacatagcagcattacacagaaacttttgt 891
to top
>gb|AF479033.1| Triticum aestivum 40S ribosomal protein mRNA, partial cds
          Length = 240

 Score =  317 bits (160), Expect = 2e-83
 Identities = 190/200 (95%)
 Strand = Plus / Minus

                                                                       
Query: 313 ttagacctcaatcaaagccggggggcgcagctcgtcctcctccttcggggggtggatggt 372
           ||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 240 ttagacctcaaccaaagccggtgggcgcagctcgtcctcctccttcggggggtggatggt 181

                                                                       
Query: 373 gacgaggtcaggcaggggggtggtagggccaagtttgcccttggggtcccagtcaagcat 432
           ||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 180 gacaaggtcaggcagcggggtggtagggccaagcttgcccttggggtcccagtcaagcat 121

                                                                       
Query: 433 aatcttcaccttgataccaagaacgccctgtctgagaagaacgtgtctaacagctgcatc 492
           ||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||
Sbjct: 120 aatcttcaccttgataccaagaacgccctgtctgagaagaacgtgcctaactgcagcatc 61

                               
Query: 493 aatgtactcattgacgggct 512
           ||||||||| || |||||||
Sbjct: 60  aatgtactcgttaacgggct 41
to top
>gb|AY107461.1| Zea mays PCO108959 mRNA sequence
          Length = 794

 Score =  167 bits (84), Expect = 4e-38
 Identities = 150/172 (87%)
 Strand = Plus / Minus

                                                                       
Query: 330 ccggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcaggg 389
           |||| |||||| |||||||||| |||||||||| ||||||||| || ||||| || || |
Sbjct: 478 ccggagggcgcggctcgtcctcgtccttcggggtgtggatggtcaccaggtccggaagag 419

                                                                       
Query: 390 gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 449
           | ||| | |||||||  |||||||| ||||||||||||||||| ||||||||||||||||
Sbjct: 418 gagtgatcgggccaaccttgcccttcgggtcccagtcaagcatgatcttcaccttgatac 359

                                                               
Query: 450 caagaacgccctgtctgagaagaacgtgtctaacagctgcatcaatgtactc 501
           | ||||| ||||||||||||||||||||||| ||||| |  |||||||||||
Sbjct: 358 cgagaacaccctgtctgagaagaacgtgtctcacagccgagtcaatgtactc 307
to top
>ref|XM_463024.1| Oryza sativa (japonica cultivar-group), OSJNBa0008D12.4 mRNA
          Length = 1112

 Score =  157 bits (79), Expect = 4e-35
 Identities = 157/183 (85%)
 Strand = Plus / Minus

                                                                       
Query: 330 ccggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcaggg 389
           |||| ||||||||||| ||||||||||| || |  |||||||| || || || ||||| |
Sbjct: 780 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 721

                                                                       
Query: 390 gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 449
           ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 720 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 661

                                                                       
Query: 450 caagaacgccctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgg 509
           ||||||| |||||||| || || |||||||| ||||| |  ||||||||||||||||| |
Sbjct: 660 caagaacaccctgtctcaggagcacgtgtctcacagccgagtcaatgtactcattgactg 601

              
Query: 510 gct 512
           |||
Sbjct: 600 gct 598
to top
>dbj|AK099146.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023061B16, full
           insert sequence
          Length = 1054

 Score =  157 bits (79), Expect = 4e-35
 Identities = 157/183 (85%)
 Strand = Plus / Minus

                                                                       
Query: 330 ccggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcaggg 389
           |||| ||||||||||| ||||||||||| || |  |||||||| || || || ||||| |
Sbjct: 790 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 731

                                                                       
Query: 390 gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 449
           ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 730 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 671

                                                                       
Query: 450 caagaacgccctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgg 509
           ||||||| |||||||| || || |||||||| ||||| |  ||||||||||||||||| |
Sbjct: 670 caagaacaccctgtctcaggagcacgtgtctcacagccgagtcaatgtactcattgactg 611

              
Query: 510 gct 512
           |||
Sbjct: 610 gct 608
to top
>dbj|AK061051.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-G04, full
           insert sequence
          Length = 1084

 Score =  157 bits (79), Expect = 4e-35
 Identities = 157/183 (85%)
 Strand = Plus / Minus

                                                                       
Query: 330 ccggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcaggg 389
           |||| ||||||||||| ||||||||||| || |  |||||||| || || || ||||| |
Sbjct: 792 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 733

                                                                       
Query: 390 gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 449
           ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 732 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 673

                                                                       
Query: 450 caagaacgccctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgg 509
           ||||||| |||||||| || || |||||||| ||||| |  ||||||||||||||||| |
Sbjct: 672 caagaacaccctgtctcaggagcacgtgtctcacagccgagtcaatgtactcattgactg 613

              
Query: 510 gct 512
           |||
Sbjct: 612 gct 610
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  121 bits (61), Expect = 2e-24
 Identities = 115/133 (86%)
 Strand = Plus / Plus

                                                                            
Query: 330      ccggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcaggg 389
                |||| ||||||||||| ||||||||||| || |  |||||||| || || || ||||| |
Sbjct: 20905760 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 20905819

                                                                            
Query: 390      gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 449
                ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 20905820 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 20905879

                             
Query: 450      caagaacgccctg 462
                ||||||| |||||
Sbjct: 20905880 caagaacaccctg 20905892



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                      
Query: 459      cctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgggct 512
                ||||||| || || |||||||| ||||| |  ||||||||||||||||| ||||
Sbjct: 20905975 cctgtctcaggagcacgtgtctcacagccgagtcaatgtactcattgactggct 20906028
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  121 bits (61), Expect = 2e-24
 Identities = 115/133 (86%)
 Strand = Plus / Plus

                                                                            
Query: 330      ccggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcaggg 389
                |||| ||||||||||| ||||||||||| || |  |||||||| || || || ||||| |
Sbjct: 20898789 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 20898848

                                                                            
Query: 390      gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 449
                ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 20898849 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 20898908

                             
Query: 450      caagaacgccctg 462
                ||||||| |||||
Sbjct: 20898909 caagaacaccctg 20898921



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                      
Query: 459      cctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgggct 512
                ||||||| || || |||||||| ||||| |  ||||||||||||||||| ||||
Sbjct: 20899004 cctgtctcaggagcacgtgtctcacagccgagtcaatgtactcattgactggct 20899057
to top
>gb|AC146468.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0008D12
             map MAP_LOC, complete sequence
          Length = 167323

 Score =  121 bits (61), Expect = 2e-24
 Identities = 115/133 (86%)
 Strand = Plus / Minus

                                                                         
Query: 330   ccggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcaggg 389
             |||| ||||||||||| ||||||||||| || |  |||||||| || || || ||||| |
Sbjct: 17163 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 17104

                                                                         
Query: 390   gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 449
             ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 17103 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 17044

                          
Query: 450   caagaacgccctg 462
             ||||||| |||||
Sbjct: 17043 caagaacaccctg 17031



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                   
Query: 459   cctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgggct 512
             ||||||| || || |||||||| ||||| |  ||||||||||||||||| ||||
Sbjct: 16948 cctgtctcaggagcacgtgtctcacagccgagtcaatgtactcattgactggct 16895
to top
>ref|NM_122944.2| Arabidopsis thaliana structural constituent of ribosome AT5G35530
           mRNA, complete cds
          Length = 1028

 Score =  115 bits (58), Expect = 1e-22
 Identities = 85/94 (90%)
 Strand = Plus / Minus

                                                                       
Query: 405 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 464
           |||||||||||||||||||||||||||| ||||||||||||| |||||| || |||||||
Sbjct: 657 gtttgcccttggggtcccagtcaagcatgatcttcaccttgagaccaagcacaccctgtc 598

                                             
Query: 465 tgagaagaacgtgtctaacagctgcatcaatgta 498
           | |||||||| || ||||| || |||||||||||
Sbjct: 597 taagaagaacatgcctaactgcagcatcaatgta 564
to top
>gb|AY098949.1| Arabidopsis thaliana AT5g35530/MOK9_14 mRNA, complete cds
          Length = 747

 Score =  115 bits (58), Expect = 1e-22
 Identities = 85/94 (90%)
 Strand = Plus / Minus

                                                                       
Query: 405 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 464
           |||||||||||||||||||||||||||| ||||||||||||| |||||| || |||||||
Sbjct: 592 gtttgcccttggggtcccagtcaagcatgatcttcaccttgagaccaagcacaccctgtc 533

                                             
Query: 465 tgagaagaacgtgtctaacagctgcatcaatgta 498
           | |||||||| || ||||| || |||||||||||
Sbjct: 532 taagaagaacatgcctaactgcagcatcaatgta 499
to top
>gb|AY058057.1| Arabidopsis thaliana AT5g35530/MOK9_14 mRNA, complete cds
          Length = 955

 Score =  115 bits (58), Expect = 1e-22
 Identities = 85/94 (90%)
 Strand = Plus / Minus

                                                                       
Query: 405 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 464
           |||||||||||||||||||||||||||| ||||||||||||| |||||| || |||||||
Sbjct: 656 gtttgcccttggggtcccagtcaagcatgatcttcaccttgagaccaagcacaccctgtc 597

                                             
Query: 465 tgagaagaacgtgtctaacagctgcatcaatgta 498
           | |||||||| || ||||| || |||||||||||
Sbjct: 596 taagaagaacatgcctaactgcagcatcaatgta 563
to top
>gb|AY084320.1| Arabidopsis thaliana clone 10394 mRNA, complete sequence
          Length = 985

 Score =  115 bits (58), Expect = 1e-22
 Identities = 85/94 (90%)
 Strand = Plus / Minus

                                                                       
Query: 405 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 464
           |||||||||||||||||||||||||||| ||||||||||||| |||||| || |||||||
Sbjct: 657 gtttgcccttggggtcccagtcaagcatgatcttcaccttgagaccaagcacaccctgtc 598

                                             
Query: 465 tgagaagaacgtgtctaacagctgcatcaatgta 498
           | |||||||| || ||||| || |||||||||||
Sbjct: 597 taagaagaacatgcctaactgcagcatcaatgta 564
to top
>dbj|AB091077.1| Zinnia elegans ZeRPS3 mRNA for putative ribosomal protein S3,
           partial cds
          Length = 509

 Score =  107 bits (54), Expect = 4e-20
 Identities = 96/110 (87%)
 Strand = Plus / Minus

                                                                       
Query: 398 gggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacg 457
           ||||||||||||||  | ||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 172 gggccaagtttgccagtcgggtcccagtcaagcatgatcttaaccttgataccaagaaca 113

                                                             
Query: 458 ccctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgac 507
           |||||||| ||||| |||||||| ||||| |  || |||||||| |||||
Sbjct: 112 ccctgtctaagaagcacgtgtctcacagcagagtcgatgtactctttgac 63
to top
>gb|AY106013.1| Zea mays PCO066457 mRNA sequence
          Length = 819

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 407 ttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtctg 466
           |||||||| || |||||||| ||||||||||| |||||||||||||| || |||||||| 
Sbjct: 643 ttgccctttggatcccagtccagcataatcttaaccttgataccaagcacaccctgtctc 584

                                           
Query: 467 agaagaacgtgtctaacagctgcatcaatgta 498
           |  ||||| ||||| ||||||| |||||||||
Sbjct: 583 aatagaacatgtctcacagctgaatcaatgta 552
to top
>dbj|AB015477.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOK9
          Length = 87459

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 54/58 (93%)
 Strand = Plus / Plus

                                                                       
Query: 405   gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctg 462
             |||||||||||||||||||||||||||| ||||||||||||| |||||| || |||||
Sbjct: 49326 gtttgcccttggggtcccagtcaagcatgatcttcaccttgagaccaagcacaccctg 49383



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                     
Query: 459   cctgtctgagaagaacgtgtctaacagctgcatcaatgta 498
             ||||||| |||||||| || ||||| || |||||||||||
Sbjct: 49471 cctgtctaagaagaacatgcctaactgcagcatcaatgta 49510
to top
>gb|DQ241842.1| Solanum tuberosum clone 182H03 unknown mRNA
          Length = 938

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 405 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 464
           |||| ||||| || |||||||||||||| ||||| || ||||||||||| |||||||| |
Sbjct: 628 gtttacccttaggatcccagtcaagcatgatcttgactttgataccaagcacgccctgcc 569

                                             
Query: 465 tgagaagaacgtgtctaacagctgcatcaatgta 498
           | || || || || ||||||||||||||||||||
Sbjct: 568 taagtagcacatgcctaacagctgcatcaatgta 535
to top
>ref|XM_479106.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 926

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 407 ttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtctg 466
           |||||||| || ||||| |||||||||||||| ||||| ||||| || || |||||||| 
Sbjct: 678 ttgcccttcggatcccaatcaagcataatcttgaccttaatacccagcacaccctgtctc 619

                               
Query: 467 agaagaacgtgtctaacagc 486
           |||||||| |||||||||||
Sbjct: 618 agaagaacatgtctaacagc 599
to top
>dbj|AK066905.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013092O21, full
           insert sequence
          Length = 926

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 407 ttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtctg 466
           |||||||| || ||||| |||||||||||||| ||||| ||||| || || |||||||| 
Sbjct: 678 ttgcccttcggatcccaatcaagcataatcttgaccttaatacccagcacaccctgtctc 619

                               
Query: 467 agaagaacgtgtctaacagc 486
           |||||||| |||||||||||
Sbjct: 618 agaagaacatgtctaacagc 599
to top
>emb|BX831845.1|CNS0A14G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH33ZB11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 82/95 (86%), Gaps = 1/95 (1%)
 Strand = Plus / Minus

                                                                       
Query: 405 gtttgcccttggggtcccagtcaagcataatcttcaccttga-taccaagaacgccctgt 463
           ||||||||||||||||||||| |||||| |||||||||||||  || ||| || ||||||
Sbjct: 642 gtttgcccttggggtcccagtaaagcatgatcttcaccttgagaacaaagcacaccctgt 583

                                              
Query: 464 ctgagaagaacgtgtctaacagctgcatcaatgta 498
           || |||||||| || || || || |||||||||||
Sbjct: 582 ctaagaagaacatgcctcactgcagcatcaatgta 548
to top
>gb|BT012908.1| Lycopersicon esculentum clone 114026F, mRNA sequence
          Length = 999

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 80/94 (85%)
 Strand = Plus / Minus

                                                                       
Query: 405 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 464
           |||| ||||| || |||||||||||||| ||||| || ||||||||||| || ||||| |
Sbjct: 678 gtttacccttaggatcccagtcaagcatgatcttgactttgataccaagcacaccctgcc 619

                                             
Query: 465 tgagaagaacgtgtctaacagctgcatcaatgta 498
           | || ||||| || || |||||||||||||||||
Sbjct: 618 ttagtagaacatgccttacagctgcatcaatgta 585
to top
>gb|DQ294256.1| Solanum tuberosum clone 084G12 40S ribosomal protein-like protein
           mRNA, complete cds
          Length = 968

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 405 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 464
           |||| ||||| || |||||||||||||| ||||| || ||||||||||| |||||||| |
Sbjct: 631 gtttacccttaggatcccagtcaagcatgatcttgactttgataccaagcacgccctgcc 572

                                         
Query: 465 tgagaagaacgtgtctaacagctgcatcaa 494
           | || || || || ||||||||||||||||
Sbjct: 571 taagtagcacatgcctaacagctgcatcaa 542
to top
>ref|NM_128718.3| Arabidopsis thaliana structural constituent of ribosome AT2G31610
           mRNA, complete cds
          Length = 1077

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 78/93 (83%)
 Strand = Plus / Minus

                                                                       
Query: 406 tttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtct 465
           ||||||| | ||||||||||||||||| |||||||||||||| || |  || ||||||||
Sbjct: 662 tttgcccgtagggtcccagtcaagcatgatcttcaccttgattcccaacaccccctgtct 603

                                            
Query: 466 gagaagaacgtgtctaacagctgcatcaatgta 498
           ||| | ||| ||||| || || ||||| |||||
Sbjct: 602 gagcaaaacatgtctcactgcagcatcgatgta 570
to top
>gb|AY091208.1| Arabidopsis thaliana putative 40S ribosomal protein (At2g31610)
           mRNA, complete cds
          Length = 784

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 78/93 (83%)
 Strand = Plus / Minus

                                                                       
Query: 406 tttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtct 465
           ||||||| | ||||||||||||||||| |||||||||||||| || |  || ||||||||
Sbjct: 591 tttgcccgtagggtcccagtcaagcatgatcttcaccttgattcccaacaccccctgtct 532

                                            
Query: 466 gagaagaacgtgtctaacagctgcatcaatgta 498
           ||| | ||| ||||| || || ||||| |||||
Sbjct: 531 gagcaaaacatgtctcactgcagcatcgatgta 499
to top
>gb|AY046041.1| Arabidopsis thaliana putative 40S ribosomal protein; contains
           C-terminal domain (At2g31610) mRNA, complete cds
          Length = 987

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 78/93 (83%)
 Strand = Plus / Minus

                                                                       
Query: 406 tttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtct 465
           ||||||| | ||||||||||||||||| |||||||||||||| || |  || ||||||||
Sbjct: 662 tttgcccgtagggtcccagtcaagcatgatcttcaccttgattcccaacaccccctgtct 603

                                            
Query: 466 gagaagaacgtgtctaacagctgcatcaatgta 498
           ||| | ||| ||||| || || ||||| |||||
Sbjct: 602 gagcaaaacatgtctcactgcagcatcgatgta 570
to top
>gb|AY081517.1| Arabidopsis thaliana 40S ribosomal protein; contains C-terminal
           domain (At2g31610) mRNA, complete cds
          Length = 863

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 78/93 (83%)
 Strand = Plus / Minus

                                                                       
Query: 406 tttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtct 465
           ||||||| | ||||||||||||||||| |||||||||||||| || |  || ||||||||
Sbjct: 591 tttgcccgtagggtcccagtcaagcatgatcttcaccttgattcccaacaccccctgtct 532

                                            
Query: 466 gagaagaacgtgtctaacagctgcatcaatgta 498
           ||| | ||| ||||| || || ||||| |||||
Sbjct: 531 gagcaaaacatgtctcactgcagcatcgatgta 499
to top
>gb|AY054622.1| Arabidopsis thaliana 40S ribosomal protein (At2g31610; T9H9.13)
           mRNA, complete cds
          Length = 992

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 78/93 (83%)
 Strand = Plus / Minus

                                                                       
Query: 406 tttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtct 465
           ||||||| | ||||||||||||||||| |||||||||||||| || |  || ||||||||
Sbjct: 662 tttgcccgtagggtcccagtcaagcatgatcttcaccttgattcccaacaccccctgtct 603

                                            
Query: 466 gagaagaacgtgtctaacagctgcatcaatgta 498
           ||| | ||| ||||| || || ||||| |||||
Sbjct: 602 gagcaaaacatgtctcactgcagcatcgatgta 570
to top
>gb|AY052749.1| Arabidopsis thaliana At2g31610/T9H9.13 mRNA, complete cds
          Length = 753

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 78/93 (83%)
 Strand = Plus / Minus

                                                                       
Query: 406 tttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtct 465
           ||||||| | ||||||||||||||||| |||||||||||||| || |  || ||||||||
Sbjct: 591 tttgcccgtagggtcccagtcaagcatgatcttcaccttgattcccaacaccccctgtct 532

                                            
Query: 466 gagaagaacgtgtctaacagctgcatcaatgta 498
           ||| | ||| ||||| || || ||||| |||||
Sbjct: 531 gagcaaaacatgtctcactgcagcatcgatgta 499
to top
>gb|AF378887.1|AF378887 Arabidopsis thaliana At2g31610/T9H9.13 mRNA, complete cds
          Length = 956

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 78/93 (83%)
 Strand = Plus / Minus

                                                                       
Query: 406 tttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtct 465
           ||||||| | ||||||||||||||||| |||||||||||||| || |  || ||||||||
Sbjct: 662 tttgcccgtagggtcccagtcaagcatgatcttcaccttgattcccaacaccccctgtct 603

                                            
Query: 466 gagaagaacgtgtctaacagctgcatcaatgta 498
           ||| | ||| ||||| || || ||||| |||||
Sbjct: 602 gagcaaaacatgtctcactgcagcatcgatgta 570
to top
>emb|BX819975.1|CNS0A8H0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS55ZF11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1056

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 78/93 (83%)
 Strand = Plus / Minus

                                                                       
Query: 406 tttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtct 465
           ||||||| | ||||||||||||||||| |||||||||||||| || |  || ||||||||
Sbjct: 640 tttgcccgtagggtcccagtcaagcatgatcttcaccttgattcccaacaccccctgtct 581

                                            
Query: 466 gagaagaacgtgtctaacagctgcatcaatgta 498
           ||| | ||| ||||| || || ||||| |||||
Sbjct: 580 gagcaaaacatgtctcactgcagcatcgatgta 548
to top
>dbj|AP004944.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT43B20, TM0117a,
             complete sequence
          Length = 33359

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                                
Query: 419   tcccagtcaagcataatcttcaccttgataccaag 453
             |||||||||||||||||||| ||||||||||||||
Sbjct: 28359 tcccagtcaagcataatcttaaccttgataccaag 28393
to top
>gb|AC007071.7| Arabidopsis thaliana chromosome 2 clone T9H9 map nga361, complete
             sequence
          Length = 79734

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                       
Query: 406   tttgcccttggggtcccagtcaagcataatcttcaccttgat 447
             ||||||| | ||||||||||||||||| ||||||||||||||
Sbjct: 40251 tttgcccgtagggtcccagtcaagcatgatcttcaccttgat 40210
to top
>emb|BX820098.1|CNS0A8HS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS73ZG08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1228

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                       
Query: 417 ggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtctgagaagaacgt 476
           |||||||||||||||| |||||||||||||| || |  || ||||||||||| | ||| |
Sbjct: 916 ggtcccagtcaagcatgatcttcaccttgattcccaacaccccctgtctgagcaaaacat 857

                                 
Query: 477 gtctaacagctgcatcaatgta 498
           |||| || || ||||| |||||
Sbjct: 856 gtctcactgcagcatcgatgta 835
to top
>ref|NM_115247.2| Arabidopsis thaliana nucleic acid binding / structural constituent
           of ribosome AT3G53870 mRNA, complete cds
          Length = 976

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 408 tgcccttggggtcccagtcaagcataatcttcaccttgat 447
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 642 tgcccttagggtcccaatcaagcataaccttcaccttgat 603
to top
>gb|AY059090.1| Arabidopsis thaliana putative ribosomal protein S3a homolog
           (At3g53870) mRNA, complete cds
          Length = 781

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 408 tgcccttggggtcccagtcaagcataatcttcaccttgat 447
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 589 tgcccttagggtcccaatcaagcataaccttcaccttgat 550
to top
>gb|AY035022.1| Arabidopsis thaliana putative ribosomal protein S3a homolog
           (At3g53870) mRNA, complete cds
          Length = 957

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 408 tgcccttggggtcccagtcaagcataatcttcaccttgat 447
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 642 tgcccttagggtcccaatcaagcataaccttcaccttgat 603
to top
>emb|AL132960.2|ATF5K20 Arabidopsis thaliana DNA chromosome 3, BAC clone F5K20
          Length = 119407

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                     
Query: 408   tgcccttggggtcccagtcaagcataatcttcaccttgat 447
             ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 55130 tgcccttagggtcccaatcaagcataaccttcaccttgat 55091
to top
>gb|AF428405.1|AF428405 Arabidopsis thaliana AT3g53870/F5K20_170 mRNA, complete cds
          Length = 926

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 408 tgcccttggggtcccagtcaagcataatcttcaccttgat 447
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 642 tgcccttagggtcccaatcaagcataaccttcaccttgat 603
to top
>emb|BX824880.1|CNS0A5OP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH7ZC06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 883

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 408 tgcccttggggtcccagtcaagcataatcttcaccttgat 447
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 622 tgcccttagggtcccaatcaagcataaccttcaccttgat 583
to top
>emb|BX823126.1|CNS0A5V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB91ZH06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 907

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 408 tgcccttggggtcccagtcaagcataatcttcaccttgat 447
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 625 tgcccttagggtcccaatcaagcataaccttcaccttgat 586
to top
>gb|AY088808.1| Arabidopsis thaliana clone 9568 mRNA, complete sequence
          Length = 970

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 408 tgcccttggggtcccagtcaagcataatcttcaccttgat 447
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 643 tgcccttagggtcccaatcaagcataaccttcaccttgat 604
to top
>ref|XM_566546.1| Cryptococcus neoformans var. neoformans JEC21 ribosomal protein S3
           (CNA01060) partial mRNA
          Length = 901

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 430 cataatcttcaccttgataccaagaacgccctgtctgagaagaacgtgtc 479
           ||||||||| ||||||||||| || || ||||||| ||| ||||||||||
Sbjct: 621 cataatcttgaccttgataccgagcacaccctgtcggaggagaacgtgtc 572
to top
>ref|XM_745219.1| Aspergillus fumigatus Af293 40s ribosomal protein S3 (Afu1g05630)
           partial mRNA
          Length = 801

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 429 gcataatcttcaccttgataccaagaacgccctgtctgagaagaacgtg 477
           |||| ||||| ||||||||||||||||| ||||| | |||||| |||||
Sbjct: 577 gcatgatcttgaccttgataccaagaacaccctggcggagaaggacgtg 529
to top
>ref|XM_754010.1| Ustilago maydis 521 hypothetical protein (UM02956.1) partial mRNA
          Length = 720

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 415 ggggtcccagtcaagcataatcttcaccttgataccaagaacgccctg 462
           |||||||||| |  |||| ||||| ||||||||||||||||| |||||
Sbjct: 552 ggggtcccagccctgcatgatcttgaccttgataccaagaacaccctg 505
to top
>gb|AC079038.3|AC079038 Oryza sativa chromosome 7 clone OSJNBb0024A20, complete sequence
          Length = 129838

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                          
Query: 407    ttgcccttggggtcccagtcaagcataatcttcaccttgatacc 450
              |||||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 122878 ttgcccttcggatcccaatcaagcataatcttgaccttaatacc 122835



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 459    cctgtctgagaagaacgtgtctaacagc 486
              ||||||| |||||||| |||||||||||
Sbjct: 122733 cctgtctcagaagaacatgtctaacagc 122706
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                            
Query: 407      ttgcccttggggtcccagtcaagcataatcttcaccttgatacc 450
                |||||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 24966275 ttgcccttcggatcccaatcaagcataatcttgaccttaatacc 24966318



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 459      cctgtctgagaagaacgtgtctaacagc 486
                ||||||| |||||||| |||||||||||
Sbjct: 24966420 cctgtctcagaagaacatgtctaacagc 24966447
to top
>dbj|AP006458.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OSJNBa0072I06
          Length = 162411

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                          
Query: 407    ttgcccttggggtcccagtcaagcataatcttcaccttgatacc 450
              |||||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 149907 ttgcccttcggatcccaatcaagcataatcttgaccttaatacc 149950



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 459    cctgtctgagaagaacgtgtctaacagc 486
              ||||||| |||||||| |||||||||||
Sbjct: 150052 cctgtctcagaagaacatgtctaacagc 150079
to top
>dbj|AP005895.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
            clone:OSJNBb0018L13
          Length = 131155

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 407  ttgcccttggggtcccagtcaagcataatcttcaccttgatacc 450
            |||||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 6955 ttgcccttcggatcccaatcaagcataatcttgaccttaatacc 6998



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 459  cctgtctgagaagaacgtgtctaacagc 486
            ||||||| |||||||| |||||||||||
Sbjct: 7100 cctgtctcagaagaacatgtctaacagc 7127
to top
>gb|AY394937.1| Danio rerio clone RK045A1H03 ribosomal protein S3 mRNA, complete
           cds
          Length = 821

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 414 tggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 464
           |||| ||||||  |||||| |||||||||||||| ||||| || |||||||
Sbjct: 584 tgggatcccagggaagcatgatcttcaccttgattccaagcacaccctgtc 534
to top
>ref|NM_201153.1| Danio rerio ribosomal protein S3 (rps3), mRNA
          Length = 850

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 414 tggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 464
           |||| ||||||  |||||| |||||||||||||| ||||| || |||||||
Sbjct: 610 tgggatcccagggaagcatgatcttcaccttgattccaagcacaccctgtc 560
to top
>gb|AF538200.1| Monadenium ellenbeckii NADH dehydrogenase subunit F (ndhF) gene,
           partial cds; chloroplast gene for chloroplast product
          Length = 1416

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 22  aaagaagtatcaaaaacatttaacaaa 48
           ||||||| |||||||||||||||||||
Sbjct: 785 aaagaaggatcaaaaacatttaacaaa 811
to top
>gb|AF538193.1| Euphorbia poissonii NADH dehydrogenase subunit F (ndhF) gene,
           partial cds; chloroplast gene for chloroplast product
          Length = 1410

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 22  aaagaagtatcaaaaacatttaacaaa 48
           ||||||||||||||||| |||||||||
Sbjct: 785 aaagaagtatcaaaaacgtttaacaaa 811
to top
>gb|AF538191.1| Euphorbia drupifera NADH dehydrogenase subunit F (ndhF) gene,
           partial cds; chloroplast gene for chloroplast product
          Length = 1410

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 22  aaagaagtatcaaaaacatttaacaaa 48
           ||||||||||||||||| |||||||||
Sbjct: 785 aaagaagtatcaaaaacgtttaacaaa 811
to top
>gb|AF538154.1| Euphorbia fulgens NADH dehydrogenase subunit F (ndhF) gene, partial
           cds; chloroplast gene for chloroplast product
          Length = 1484

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 22  aaagaagtatcaaaaacatttaacaaa 48
           ||||||| |||||||||||||||||||
Sbjct: 859 aaagaaggatcaaaaacatttaacaaa 885
to top
>gb|BC045902.1| Danio rerio ribosomal protein S3, mRNA (cDNA clone MGC:56088
           IMAGE:5410588), complete cds
          Length = 850

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 414 tggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtc 464
           |||| ||||||  |||||| |||||||||||||| ||||| || |||||||
Sbjct: 610 tgggatcccagggaagcatgatcttcaccttgattccaagcacaccctgtc 560
to top
>gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete
              sequence
          Length = 2300533

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                            
Query: 434    atcttcaccttgataccaagaacgccctgtctgagaagaacgtgtc 479
              ||||| ||||||||||| || || ||||||| ||| ||||||||||
Sbjct: 291022 atcttgaccttgataccgagcacaccctgtcggaggagaacgtgtc 290977
to top
>gb|BC061265.1| Xenopus tropicalis ribosomal protein S3, mRNA (cDNA clone MGC:75699
           IMAGE:5380544), complete cds
          Length = 882

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 427 aagcataatcttcaccttgataccaagaacgccctgtctgag 468
           |||||||||||| |||||||| ||||| || ||||| |||||
Sbjct: 605 aagcataatctttaccttgattccaaggacaccctgcctgag 564
to top
>emb|V01441.1|XLRIB4 Fragment of Xenopus laevis mRNA for ribosomal protein S1
          Length = 382

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 427 aagcataatcttcaccttgataccaagaacgccctgtctgag 468
           |||||||||||| |||||||| || ||||| ||||| |||||
Sbjct: 190 aagcataatctttaccttgattcccagaacaccctgcctgag 149
to top
>ref|NM_203788.1| Xenopus tropicalis ribosomal protein S3 (MGC75699), mRNA
          Length = 882

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 427 aagcataatcttcaccttgataccaagaacgccctgtctgag 468
           |||||||||||| |||||||| ||||| || ||||| |||||
Sbjct: 605 aagcataatctttaccttgattccaaggacaccctgcctgag 564
to top
>dbj|D38596.1|RICRPS3A Oryza sativa mRNA, partial  homologous to ribosomal protein S3
           coding sequence
          Length = 368

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 459 cctgtctgagaagaacgtgtctaacagctgcatcaatgtactcattgacgggct 512
           ||||||| || || |||||||| ||||| |  ||||||||||||||||| ||||
Sbjct: 212 cctgtctcaggagcacgtgtctcacagccgagtcaatgtactcattgactggct 159



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 411 ccttggggtcccagtcaagcataatcttc 439
           |||||||||||||||| ||||| ||||||
Sbjct: 346 ccttggggtcccagtcgagcatgatcttc 318
to top
>emb|Z34529.1|XLRIBS1R X.laevis rpS1b mRNA for ribosomal protein S1
          Length = 842

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 427 aagcataatcttcaccttgataccaagaacgccctgtctgag 468
           |||||||||||| |||||||| || ||||| ||||| |||||
Sbjct: 596 aagcataatctttaccttgattcccagaacaccctgcctgag 555
to top
>emb|CR848247.2| Xenopus tropicalis finished cDNA, clone TTpA010a01
          Length = 892

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 427 aagcataatcttcaccttgataccaagaacgccctgtctgag 468
           |||||||||||| |||||||| ||||| || ||||| |||||
Sbjct: 576 aagcataatctttaccttgattccaaggacaccctgcctgag 535
to top
>gb|CP000153.1| Thiomicrospira denitrificans ATCC 33889, complete genome
          Length = 2201561

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 22     aaagaagtatcaaaaacattt 42
              |||||||||||||||||||||
Sbjct: 211313 aaagaagtatcaaaaacattt 211333
to top
>gb|AC166830.3| Mus musculus BAC clone RP23-246O1 from chromosome 13, complete sequence
          Length = 213487

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 17     ttttgaaagaagtatcaaaaa 37
              |||||||||||||||||||||
Sbjct: 195899 ttttgaaagaagtatcaaaaa 195879
to top
>ref|XM_527224.1| PREDICTED: Pan troglodytes similar to ribosomal protein S3; 40S
            ribosomal protein S3; IMR-90 ribosomal protein S3
            (LOC471846), mRNA
          Length = 1200

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 428  agcataatcttcaccttgataccaagaacgccctgtctgag 468
            ||||| |||||||||||||| || || || |||||||||||
Sbjct: 1040 agcatgatcttcaccttgatgcccagcacaccctgtctgag 1000
to top
>gb|BC078664.1| Homo sapiens cDNA clone IMAGE:3941503, containing frame-shift errors
          Length = 4397

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                     
Query: 428  agcataatcttcaccttgataccaagaacgccctgtctgag 468
            ||||| |||||||||||||| || || || |||||||||||
Sbjct: 2030 agcatgatcttcaccttgatgcccagcacaccctgtctgag 2070
to top
>gb|BC034149.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clone MGC:32779
           IMAGE:4665438), complete cds
          Length = 872

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 599 agcatgatcttcaccttgatgcccagcacaccctgtctgag 559
to top
>gb|BC003137.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clone MGC:3657
           IMAGE:2906158), complete cds
          Length = 832

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 575 agcatgatcttcaccttgatgcccagcacaccctgtctgag 535
to top
>ref|XM_656599.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4087.2), mRNA
          Length = 795

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 429 gcataatcttcaccttgataccaagaacgccctgtctgagaagaacgtg 477
           |||| ||||| |||||||||||||| || ||||| | ||| ||||||||
Sbjct: 571 gcatgatcttgaccttgataccaaggacaccctggcggaggagaacgtg 523
to top
>gb|AC161000.5| Mus musculus BAC clone RP23-51A9 from chromosome 13, complete sequence
          Length = 216751

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 17    ttttgaaagaagtatcaaaaa 37
             |||||||||||||||||||||
Sbjct: 83945 ttttgaaagaagtatcaaaaa 83925
to top
>gb|BC100284.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clone MGC:117338
           IMAGE:6160514), complete cds
          Length = 851

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 587 agcatgatcttcaccttgatgcccagcacaccctgtctgag 547
to top
>gb|AE017199.1| Nanoarchaeum equitans Kin4-M, complete genome
          Length = 490885

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 15     atttttgaaagaagtatcaaa 35
              |||||||||||||||||||||
Sbjct: 174745 atttttgaaagaagtatcaaa 174725
to top
>gb|BC017103.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clone IMAGE:3503171),
            **** WARNING: chimeric clone ****
          Length = 1651

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 428  agcataatcttcaccttgataccaagaacgccctgtctgag 468
            ||||| |||||||||||||| || || || |||||||||||
Sbjct: 1391 agcatgatcttcaccttgatgcccagcacaccctgtctgag 1351
to top
>gb|BC029981.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clone IMAGE:4705217)
          Length = 774

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 520 agcatgatcttcaccttgatgcccagcacaccctgtctgag 480
to top
>ref|NM_001005.3| Homo sapiens ribosomal protein S3 (RPS3), mRNA
          Length = 855

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 599 agcatgatcttcaccttgatgcccagcacaccctgtctgag 559
to top
>emb|CR861393.1| Pongo pygmaeus mRNA; cDNA DKFZp459J022 (from clone DKFZp459J022)
          Length = 922

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 595 agcatgatcttcaccttgatgcccagcacaccctgtctgag 555
to top
>gb|AF402810.1| Ictalurus punctatus 40S ribosomal protein S3 mRNA, complete cds
          Length = 799

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 414 tggggtcccagtcaagcataatcttcaccttgatacc 450
           |||||||||||  |||||| ||||| |||||||||||
Sbjct: 588 tggggtcccagggaagcatgatcttaaccttgatacc 552
to top
>emb|CR623585.1| full-length cDNA clone CS0DA007YC19 of Neuroblastoma of Homo
           sapiens (human)
          Length = 824

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 579 agcatgatcttcaccttgatgcccagcacaccctgtctgag 539
to top
>emb|CR620902.1| full-length cDNA clone CS0DJ012YN02 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 817

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 572 agcatgatcttcaccttgatgcccagcacaccctgtctgag 532
to top
>emb|CR620201.1| full-length cDNA clone CS0DL012YJ20 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 818

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 573 agcatgatcttcaccttgatgcccagcacaccctgtctgag 533
to top
>emb|CR619698.1| full-length cDNA clone CS0DL005YA23 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 830

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 585 agcatgatcttcaccttgatgcccagcacaccctgtctgag 545
to top
>emb|CR617487.1| full-length cDNA clone CS0DK010YL21 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 821

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 576 agcatgatcttcaccttgatgcccagcacaccctgtctgag 536
to top
>emb|CR611679.1| full-length cDNA clone CS0DB002YE09 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 830

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 585 agcatgatcttcaccttgatgcccagcacaccctgtctgag 545
to top
>emb|CR610898.1| full-length cDNA clone CS0DD004YP10 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 796

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 585 agcatgatcttcaccttgatgcccagcacaccctgtctgag 545
to top
>emb|CR610850.1| full-length cDNA clone CS0DH003YE11 of T cells (Jurkat cell line) of
            Homo sapiens (human)
          Length = 1356

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 428  agcataatcttcaccttgataccaagaacgccctgtctgag 468
            ||||| |||||||||||||| || || || |||||||||||
Sbjct: 1203 agcatgatcttcaccttgatgcccagcacaccctgtctgag 1163
to top
>emb|CR611021.1| full-length cDNA clone CS0DL002YG06 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 817

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 576 agcatgatcttcaccttgatgcccagcacaccctgtctgag 536
to top
>emb|CR609618.1| full-length cDNA clone CS0DI083YP04 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1307

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 352 agcatgatcttcaccttgatgcccagcacaccctgtctgag 312
to top
>emb|CR607881.1| full-length cDNA clone CS0DF032YC19 of Fetal brain of Homo sapiens
           (human)
          Length = 1306

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 586 agcatgatcttcaccttgatgcccagcacaccctgtctgag 546
to top
>emb|CR608382.1| full-length cDNA clone CS0DM008YP04 of Fetal liver of Homo sapiens
           (human)
          Length = 830

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 585 agcatgatcttcaccttgatgcccagcacaccctgtctgag 545
to top
>emb|CR606914.1| full-length cDNA clone CS0DN003YN07 of Adult brain of Homo sapiens
           (human)
          Length = 836

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 591 agcatgatcttcaccttgatgcccagcacaccctgtctgag 551
to top
>emb|CR599459.1| full-length cDNA clone CS0DA012YB22 of Neuroblastoma of Homo
           sapiens (human)
          Length = 814

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 585 agcatgatcttcaccttgatgcccagcacaccctgtctgag 545
to top
>emb|CR599018.1| full-length cDNA clone CS0DK010YN19 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 831

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 586 agcatgatcttcaccttgatgcccagcacaccctgtctgag 546
to top
>emb|CR598363.1| full-length cDNA clone CS0CAP007YJ19 of Thymus of Homo sapiens
           (human)
          Length = 799

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 587 agcatgatcttcaccttgatgcccagcacaccctgtctgag 547
to top
>emb|CR598084.1| full-length cDNA clone CS0DD009YH06 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 825

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 580 agcatgatcttcaccttgatgcccagcacaccctgtctgag 540
to top
>emb|CR597126.1| full-length cDNA clone CS0DK011YF16 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 830

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 585 agcatgatcttcaccttgatgcccagcacaccctgtctgag 545
to top
>emb|CR595698.1| full-length cDNA clone CS0DL005YD17 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 830

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 585 agcatgatcttcaccttgatgcccagcacaccctgtctgag 545
to top
>emb|CR593831.1| full-length cDNA clone CS0DI031YM23 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 813

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 568 agcatgatcttcaccttgatgcccagcacaccctgtctgag 528
to top
>emb|CR591204.1| full-length cDNA clone CS0DC019YA14 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 803

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 558 agcatgatcttcaccttgatgcccagcacaccctgtctgag 518
to top
>gb|S42658.1| S3 ribosomal protein [human, colon, mRNA, 826 nt]
          Length = 826

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 577 agcatgatcttcaccttgatgcccagcacaccctgtctgag 537
to top
>gb|BC013196.1|BC013196 Homo sapiens, clone IMAGE:4347401, mRNA, partial cds
          Length = 852

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 567 agcatgatcttcaccttgatgcccagcacaccctgtctgag 527
to top
>gb|BC003577.1|BC003577 Homo sapiens, clone IMAGE:3544292, mRNA, partial cds
          Length = 826

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 567 agcatgatcttcaccttgatgcccagcacaccctgtctgag 527
to top
>emb|BX818844.1|CNS0A8YC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB18ZG02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 969

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 75/93 (80%)
 Strand = Plus / Minus

                                                                       
Query: 406 tttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgccctgtct 465
           ||||||| | |||||||||| |||||| | ||||||||| || || |  || ||||||||
Sbjct: 624 tttgcccgtagggtcccagtgaagcatgaacttcacctttattcccaacaccccctgtct 565

                                            
Query: 466 gagaagaacgtgtctaacagctgcatcaatgta 498
           ||| | ||| | |||||| || ||||| |||||
Sbjct: 564 gagcaaaacatttctaactgcagcatcgatgta 532
to top
>dbj|AK223048.1| Homo sapiens mRNA for ribosomal protein S3 variant, clone: KAT00103
          Length = 922

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 575 agcatgatcttcaccttgatgcccagcacaccctgtctgag 535
to top
>ref|NM_001009239.1| Rattus norvegicus ribosomal protein S3 (Rps3), mRNA
          Length = 843

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||| ||||| || || ||||||||||||||
Sbjct: 581 agcatgatcttcactttgatgcccagcacgccctgtctgag 541
to top
>gb|AC131235.4| Homo sapiens 3 BAC RP11-778D9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 174521

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                      
Query: 428   agcataatcttcaccttgataccaagaacgccctgtctgag 468
             ||||| |||||||||||||| || || || |||||||||||
Sbjct: 61535 agcatgatcttcaccttgatgcccagcacaccctgtctgag 61575
to top
>ref|XM_575143.1| PREDICTED: Rattus norvegicus similar to 40S ribosomal protein S3
           (LOC499803), mRNA
          Length = 830

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||| ||||| || || ||||||||||||||
Sbjct: 587 agcatgatcttcactttgatgcccagcacgccctgtctgag 547
to top
>gb|AY892063.1| Synthetic construct Homo sapiens clone FLH027749.01L ribosomal
           protein S3 (RPS3) mRNA, partial cds
          Length = 732

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 569 agcatgatcttcaccttgatgcccagcacaccctgtctgag 529
to top
>gb|BC071917.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clone MGC:88599
           IMAGE:6297012), complete cds
          Length = 839

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 578 agcatgatcttcaccttgatgcccagcacaccctgtctgag 538
to top
>emb|X51536.1|RRRPS3 Rat mRNA for ribosomal protein S3
          Length = 817

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||| ||||| || || ||||||||||||||
Sbjct: 587 agcatgatcttcactttgatgcccagcacgccctgtctgag 547
to top
>gb|DQ206605.1| Monosiga brevicollis isolate TOA26 ribosomal protein 3 small
           subunit mRNA, partial cds
          Length = 572

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 428 agcataatcttcaccttgataccaa 452
           ||||||||||| |||||||||||||
Sbjct: 488 agcataatcttgaccttgataccaa 464
to top
>gb|BC013231.1| Homo sapiens ribosomal protein S3, mRNA (cDNA clone IMAGE:3462987)
          Length = 843

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 587 agcatgatcttcaccttgatgcccagcacaccctgtctgag 547
to top
>gb|U14992.1|HSU14992 Human IMR-90 ribosomal protein S3 (rpS3) mRNA, complete cds
          Length = 754

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 569 agcatgatcttcaccttgatgcccagcacaccctgtctgag 529
to top
>gb|U14991.1|HSU14991 Human XP2NE ribosomal protein S3 (rpS3) mRNA, complete cds
          Length = 754

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 569 agcatgatcttcaccttgatgcccagcacaccctgtctgag 529
to top
>gb|U14990.1|HSU14990 Human XP1PO ribosomal protein S3 (rpS3) mRNA, complete cds
          Length = 754

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 569 agcatgatcttcaccttgatgcccagcacaccctgtctgag 529
to top
>gb|BC088450.1| Rattus norvegicus ribosomal protein S3, mRNA (cDNA clone MGC:95096
           IMAGE:7126819), complete cds
          Length = 843

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||| ||||| || || ||||||||||||||
Sbjct: 581 agcatgatcttcactttgatgcccagcacgccctgtctgag 541
to top
>emb|X55715.1|HSHUMS3 Human Hums3 mRNA for 40S ribosomal protein s3
          Length = 833

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 591 agcatgatcttcaccttgatgcccagcacaccctgtctgag 551
to top
>gb|AC078872.13| Homo sapiens 12q BAC RP11-542G14 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 166585

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                       
Query: 428    agcataatcttcaccttgataccaagaacgccctgtctgag 468
              ||||| |||||||||||||| || || || |||||||||||
Sbjct: 102409 agcatgatcttcaccttgatgcccagcacaccctgtctgag 102369
to top
>dbj|AB062288.1| Homo sapiens OK/SW-cl.26 mRNA for IMR-90 ribosomal protein S3,
           complete cds
          Length = 810

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 428 agcataatcttcaccttgataccaagaacgccctgtctgag 468
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 562 agcatgatcttcaccttgatgcccagcacaccctgtctgag 522
to top
>ref|XM_593742.2| PREDICTED: Bos taurus similar to serologically defined colon cancer
            antigen 33 like (LOC515677), partial mRNA
          Length = 3176

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 340  cagctcgtcctcctccttcggggg 363
            ||||| ||||||||||||||||||
Sbjct: 1934 cagcttgtcctcctccttcggggg 1911
to top
>gb|AC093458.6| Homo sapiens BAC clone RP11-445N20 from 7, complete sequence
          Length = 16677

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 360   gggggtggatggtgacgaggtcag 383
             |||||||||||||| |||||||||
Sbjct: 12587 gggggtggatggtgccgaggtcag 12610
to top
>gb|AC004986.2| Homo sapiens PAC clone RP5-1166A24 from 7, complete sequence
          Length = 125290

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 33    aaaaacatttaacaaacagt 52
             ||||||||||||||||||||
Sbjct: 88645 aaaaacatttaacaaacagt 88626
to top
>emb|BX957326.8| Zebrafish DNA sequence from clone DKEY-31B16 in linkage group 23,
             complete sequence
          Length = 259092

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 35    aaacatttaacaaacagtat 54
             ||||||||||||||||||||
Sbjct: 47427 aaacatttaacaaacagtat 47408
to top
>ref|XM_784326.1| PREDICTED: Strongylocentrotus purpuratus similar to cytosolic
           sialic acid 9-O-acetylesterase homolog (LOC584468),
           partial mRNA
          Length = 1182

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 428 agcataatcttcaccttgatacca 451
           ||||| ||||||||||||||||||
Sbjct: 714 agcattatcttcaccttgatacca 691
to top
>emb|AL513332.9| Human DNA sequence from clone RP11-58B8 on chromosome 9, complete
             sequence
          Length = 124531

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 160   aaattaaaatggcagcataacata 183
             |||||||||||| |||||||||||
Sbjct: 24006 aaattaaaatggaagcataacata 23983
to top
>ref|XM_502846.1| Yarrowia lipolytica CLIB122, YALI0D15114g predicted mRNA
          Length = 1758

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 481  aacagctgcatcaatgtact 500
            ||||||||||||||||||||
Sbjct: 1500 aacagctgcatcaatgtact 1481
to top
>emb|AL356954.16| Human DNA sequence from clone RP11-520F24 on chromosome 13 Contains an
              HNRPA1 (heterogenous nuclear ribonucleoprotein A1)
              pseudogene, an ELL-related RNA polymerase II, elongation
              factor (ELL2) pseudogene and a ribosomal protein L37
              (RPL37) pseudogene, complete sequence
          Length = 159235

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 160    aaattaaaatggcagcataacata 183
              |||||||||||| |||||||||||
Sbjct: 146748 aaattaaaatggaagcataacata 146725
to top
>gb|AC134516.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone OJA1208D02,
             complete sequence
          Length = 131922

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 252   aggaaacaagctaggaccaa 271
             ||||||||||||||||||||
Sbjct: 85738 aggaaacaagctaggaccaa 85719
to top
>ref|XM_788097.1| PREDICTED: Strongylocentrotus purpuratus similar to Sialate
           O-acetylesterase precursor (Sialic acid-specific
           9-O-acetylesterase) (Yolk sac protein 2) (LOC588411),
           mRNA
          Length = 1101

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 428 agcataatcttcaccttgatacca 451
           ||||| ||||||||||||||||||
Sbjct: 354 agcattatcttcaccttgatacca 331
to top
>emb|BX842627.1| Neurospora crassa DNA linkage group I BAC clone B8J22
          Length = 75335

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 250  ataggaaacaagctaggacc 269
            ||||||||||||||||||||
Sbjct: 7696 ataggaaacaagctaggacc 7677
to top
>gb|AC007286.18| Homo sapiens 12q15 BAC RPCI11-298M11 (Roswell Park Cancer Institute
             Human BAC Library) complete sequence
          Length = 93001

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 180   catagaagcattacacataa 199
             ||||||||||||||||||||
Sbjct: 80945 catagaagcattacacataa 80964
to top
>gb|AC114764.5| Homo sapiens BAC clone RP11-374M14 from 4, complete sequence
          Length = 28603

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 40    tttaacaaacagtattgaag 59
             ||||||||||||||||||||
Sbjct: 24110 tttaacaaacagtattgaag 24129
to top
>gb|AC116926.1| Genomic sequence for Oryza sativa (japonica cultivar-group) cultivar
             Nipponbare clone OJ1341F06, from chromosome 10, complete
             sequence
          Length = 102520

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 252   aggaaacaagctaggaccaa 271
             ||||||||||||||||||||
Sbjct: 88705 aggaaacaagctaggaccaa 88724
to top
>gb|AE016826.1| Buchnera aphidicola str. Bp (Baizongia pistaciae), complete genome
          Length = 615980

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 30     atcaaaaacatttaacaaac 49
              ||||||||||||||||||||
Sbjct: 367399 atcaaaaacatttaacaaac 367418
to top
>gb|AC023163.25| Homo sapiens 12 BAC RP11-239B4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 122882

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 180   catagaagcattacacataa 199
             ||||||||||||||||||||
Sbjct: 40405 catagaagcattacacataa 40386
to top
>gb|AE010300.1| Leptospira interrogans serovar lai str. 56601 chromosome I, complete
               sequence
          Length = 4332241

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 1       actggggaaatgggattttt 20
               ||||||||||||||||||||
Sbjct: 2651811 actggggaaatgggattttt 2651792
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 252      aggaaacaagctaggaccaa 271
                ||||||||||||||||||||
Sbjct: 11277750 aggaaacaagctaggaccaa 11277731
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 95       aatccaaacaatggttcttt 114
                ||||||||||||||||||||
Sbjct: 14686047 aatccaaacaatggttcttt 14686066
to top
>dbj|AP003257.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0460H02
          Length = 155012

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 95    aatccaaacaatggttcttt 114
             ||||||||||||||||||||
Sbjct: 55147 aatccaaacaatggttcttt 55166
to top
>gb|AC006582.13|AC006582 Pan troglodytes 12cp12 BAC RPCI43-77C18 (Roswell Park Cancer
            Institute Human BAC Library) complete sequence
          Length = 186092

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 180  catagaagcattacacataa 199
            ||||||||||||||||||||
Sbjct: 7614 catagaagcattacacataa 7633
to top
>emb|AL133247.1|CNS01DUK BAC sequence from the SPG4 candidate region at 2p21-2p22 BAC 11B22 of
             library CITB_978_SKB from chromosome 2 of Homo sapiens
             (Human)
          Length = 189316

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 32    caaaaacatttaacaaacag 51
             ||||||||||||||||||||
Sbjct: 62833 caaaaacatttaacaaacag 62852
to top
>emb|CR555302.7| Zebrafish DNA sequence from clone CH211-212C19 in linkage group 10,
              complete sequence
          Length = 202469

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 162    attaaaatggcagcataaca 181
              ||||||||||||||||||||
Sbjct: 151367 attaaaatggcagcataaca 151386
to top
>gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130, chromosome
               I, complete sequence
          Length = 4277185

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 1       actggggaaatgggattttt 20
               ||||||||||||||||||||
Sbjct: 1635559 actggggaaatgggattttt 1635578
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 252      aggaaacaagctaggaccaa 271
                ||||||||||||||||||||
Sbjct: 11284190 aggaaacaagctaggaccaa 11284171
to top
>emb|AL928672.14| Zebrafish DNA sequence from clone CH211-136O4, complete sequence
          Length = 187939

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 162   attaaaatggcagcataaca 181
             ||||||||||||||||||||
Sbjct: 56077 attaaaatggcagcataaca 56096
to top
>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 481     aacagctgcatcaatgtact 500
               ||||||||||||||||||||
Sbjct: 1841825 aacagctgcatcaatgtact 1841806
to top
>gb|AY884245.1| Homo sapiens steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5
             alpha-steroid delta 4-dehydrogenase alpha 2) (SRD5A2)
             gene, complete cds
          Length = 60301

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 32    caaaaacatttaacaaacag 51
             ||||||||||||||||||||
Sbjct: 32408 caaaaacatttaacaaacag 32389


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,954,253
Number of Sequences: 3902068
Number of extensions: 4954253
Number of successful extensions: 97924
Number of sequences better than 10.0: 146
Number of HSP's better than 10.0 without gapping: 146
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 97430
Number of HSP's gapped (non-prelim): 492
length of query: 512
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 489
effective length of database: 17,143,297,704
effective search space: 8383072577256
effective search space used: 8383072577256
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top